Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:ARL15-MOCS2

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: ARL15-MOCS2
	FusionPDB ID: 6565
	FusionGDB2.0 ID: 6565
		Hgene	Tgene
	Gene symbol	ARL15	MOCS2
	Gene ID	54622	4338
	Gene name	ADP ribosylation factor like GTPase 15	molybdenum cofactor synthesis 2
	Synonyms	ARFRP2	MCBPE\|MOCO1\|MOCODB\|MPTS
	Cytomap	5q11.2	5q11.2
	Type of gene	protein-coding	protein-coding
	Description	ADP-ribosylation factor-like protein 15ADP-ribosylation factor-like 15ADP-ribosylation factor-related protein 2ARF-related protein 2	molybdopterin synthase catalytic subunitmolybdopterin synthase sulfur carrier subunitmolybdenum cofactor biosynthesis protein E
	Modification date	20200313	20200313
	UniProtAcc	Q9NXU5 Main function of 5'-partner protein:	O96033 Main function of 5'-partner protein: FUNCTION: Acts as a sulfur carrier required for molybdopterin biosynthesis. Component of the molybdopterin synthase complex that catalyzes the conversion of precursor Z into molybdopterin by mediating the incorporation of 2 sulfur atoms into precursor Z to generate a dithiolene group. In the complex, serves as sulfur donor by being thiocarboxylated (-COSH) at its C-terminus by MOCS3. After interaction with MOCS2B, the sulfur is then transferred to precursor Z to form molybdopterin. {ECO:0000255\|HAMAP-Rule:MF_03051, ECO:0000269\|PubMed:12732628}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000504924, ENST00000507646, ENST00000502271, ENST00000510591,	ENST00000396954, ENST00000450852, ENST00000508922, ENST00000510818, ENST00000527216, ENST00000582677, ENST00000584946, ENST00000361377,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	18 X 13 X 7=1638	3 X 3 X 2=18
	# samples	18	3
	** MAII score	log2(18/1638*10)=-3.18586654531133 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(3/18*10)=0.736965594166206 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0
Fusion gene context	PubMed: ARL15 [Title/Abstract] AND MOCS2 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: ARL15 [Title/Abstract] AND MOCS2 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	ARL15(53603718)-MOCS2(52404473), # samples:1 ARL15(53606262)-MOCS2(52404473), # samples:1
Anticipated loss of major functional domain due to fusion event.	ARL15-MOCS2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ARL15-MOCS2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Tgene	MOCS2	GO:0006777	Mo-molybdopterin cofactor biosynthetic process	12732628\|15073332

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr5:53603718/chr5:52404473)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across ARL15 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across MOCS2 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000504924	ARL15	chr5	53606262	-	ENST00000361377	MOCS2	chr5	52404473	-	3650	142	1	390	129
ENST00000507646	ARL15	chr5	53606262	-	ENST00000361377	MOCS2	chr5	52404473	-	3653	145	1	393	130

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000504924	ENST00000361377	ARL15	chr5	53606262	-	MOCS2	chr5	52404473	-	0.04417817	0.9558219
ENST00000507646	ENST00000361377	ARL15	chr5	53606262	-	MOCS2	chr5	52404473	-	0.044570513	0.9554295

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for ARL15-MOCS2

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
ARL15	chr5	53606262	MOCS2	chr5	52404473	142	47	LRITEAFLYMDYLVEVLYFAKSAEIT
ARL15	chr5	53606262	MOCS2	chr5	52404473	145	48	LRITEAFLYMDYLVEVLYFAKSAEIT

Top

Potential FusionNeoAntigen Information of ARL15-MOCS2 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

ARL15-MOCS2_53606262_52404473.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-A02:24	YMDYLVEV	0.9992	0.6842	8	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-A02:67	YMDYLVEV	0.9992	0.6842	8	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-A02:30	YMDYLVEV	0.9992	0.6842	8	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-A02:60	YMDYLVEV	0.9992	0.6661	8	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-A02:11	YMDYLVEV	0.9991	0.7309	8	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-A02:16	YMDYLVEV	0.9967	0.5592	8	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-A02:22	YMDYLVEV	0.9967	0.6183	8	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-A02:38	YMDYLVEV	0.9939	0.5999	8	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-A02:13	YMDYLVEV	0.9915	0.6709	8	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-A02:27	YMDYLVEV	0.9895	0.5757	8	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-A02:29	YMDYLVEV	0.9882	0.6902	8	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-A02:35	YMDYLVEV	0.9363	0.7283	8	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-A02:11	YLVEVLYFA	0.9969	0.5546	11	20
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-A02:24	YLVEVLYFA	0.9968	0.5366	11	20
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-A02:60	YLVEVLYFA	0.9968	0.509	11	20
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-A02:30	YLVEVLYFA	0.9968	0.5366	11	20
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-A02:67	YLVEVLYFA	0.9968	0.5366	11	20
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-A02:21	YLVEVLYFA	0.9965	0.6578	11	20
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-A02:27	YLVEVLYFA	0.996	0.5352	11	20
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-A02:30	YMDYLVEVL	0.9955	0.6574	8	17
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-A02:67	YMDYLVEVL	0.9955	0.6574	8	17
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-A02:24	YMDYLVEVL	0.9955	0.6574	8	17
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-A02:60	YMDYLVEVL	0.9952	0.6333	8	17
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-A02:13	YLVEVLYFA	0.9945	0.625	11	20
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-A02:11	YMDYLVEVL	0.9944	0.6937	8	17
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-A02:35	YLVEVLYFA	0.9931	0.585	11	20
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-A02:21	YMDYLVEVL	0.993	0.7782	8	17
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-A02:38	YLVEVLYFA	0.9917	0.5083	11	20
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-A02:22	YMDYLVEVL	0.9917	0.5913	8	17
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-A02:04	YMDYLVEVL	0.9903	0.6501	8	17
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-A02:29	YLVEVLYFA	0.987	0.5443	11	20
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-A02:27	YMDYLVEVL	0.9851	0.562	8	17
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-A02:04	YLVEVLYFA	0.9813	0.5515	11	20
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-A02:20	YLVEVLYFA	0.9794	0.5406	11	20
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-A02:13	YMDYLVEVL	0.9741	0.7082	8	17
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-A02:38	YMDYLVEVL	0.9558	0.6651	8	17
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-A02:35	YMDYLVEVL	0.9374	0.707	8	17
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-A02:29	YMDYLVEVL	0.9169	0.6642	8	17
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-A02:20	YMDYLVEVL	0.8899	0.6614	8	17
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-B47:01	MDYLVEVLY	0.8505	0.6132	9	18
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-B18:01	MDYLVEVLY	0.842	0.9215	9	18
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-B39:01	YMDYLVEVL	0.6509	0.9582	8	17
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-A02:22	FLYMDYLVEV	0.9996	0.6948	6	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-A02:60	FLYMDYLVEV	0.9994	0.5872	6	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-A02:30	FLYMDYLVEV	0.9994	0.5789	6	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-A02:67	FLYMDYLVEV	0.9994	0.5789	6	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-A02:24	FLYMDYLVEV	0.9994	0.5789	6	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-A02:11	FLYMDYLVEV	0.9994	0.6317	6	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-A02:21	FLYMDYLVEV	0.9992	0.713	6	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-A02:27	FLYMDYLVEV	0.9992	0.5911	6	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-A02:13	FLYMDYLVEV	0.9991	0.6413	6	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-A02:16	FLYMDYLVEV	0.999	0.5786	6	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-A02:35	FLYMDYLVEV	0.9974	0.6307	6	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-A02:29	FLYMDYLVEV	0.9971	0.5867	6	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-A02:20	FLYMDYLVEV	0.9961	0.5904	6	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-A02:04	FLYMDYLVEV	0.9954	0.8393	6	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-A02:17	FLYMDYLVEV	0.9934	0.5324	6	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-A02:38	FLYMDYLVEV	0.9887	0.5901	6	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-C04:07	YMDYLVEV	1	0.7384	8	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-C05:09	YMDYLVEV	1	0.9828	8	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-C04:10	YMDYLVEV	1	0.7307	8	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-C08:15	YMDYLVEV	0.9992	0.9868	8	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-A02:07	YMDYLVEV	0.9992	0.7083	8	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-A02:01	YMDYLVEV	0.9992	0.6842	8	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-C04:06	YMDYLVEV	0.9991	0.9131	8	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-C04:14	YMDYLVEV	0.9953	0.8433	8	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-C05:09	YMDYLVEVL	0.9999	0.9603	8	17
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-C04:10	YMDYLVEVL	0.9998	0.6716	8	17
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-C04:07	YMDYLVEVL	0.9998	0.66	8	17
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-C08:15	YMDYLVEVL	0.9997	0.9753	8	17
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-C01:17	YMDYLVEVL	0.999	0.951	8	17
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-A02:07	YLVEVLYFA	0.997	0.5237	11	20
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-A02:01	YLVEVLYFA	0.9968	0.5366	11	20
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-A02:07	YMDYLVEVL	0.9957	0.7106	8	17
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-A02:01	YMDYLVEVL	0.9955	0.6574	8	17
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-C03:19	YMDYLVEVL	0.9943	0.9916	8	17
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-C04:06	YMDYLVEVL	0.9942	0.8856	8	17
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-C01:30	YMDYLVEVL	0.9915	0.9694	8	17
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-C08:04	YMDYLVEVL	0.9806	0.9777	8	17
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-C08:13	YMDYLVEVL	0.9806	0.9777	8	17
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-C04:14	YMDYLVEVL	0.9683	0.7818	8	17
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-C08:03	YMDYLVEVL	0.964	0.989	8	17
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-C04:07	LYMDYLVEV	0.8962	0.7809	7	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-C07:13	YMDYLVEVL	0.8511	0.9458	8	17
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-C04:14	LYMDYLVEV	0.8502	0.8212	7	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-B39:08	YMDYLVEVL	0.833	0.8863	8	17
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-C07:29	YMDYLVEVL	0.8326	0.9645	8	17
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-B39:09	YMDYLVEVL	0.753	0.6514	8	17
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-C07:05	LYMDYLVEV	0.4259	0.981	7	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-C12:16	LYMDYLVEV	0.3591	0.9834	7	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-C07:10	DYLVEVLYF	0.3503	0.9388	10	19
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-C07:80	LYMDYLVEV	0.283	0.9669	7	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-C07:67	LYMDYLVEV	0.283	0.9669	7	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-C07:10	LYMDYLVEV	0.2764	0.9756	7	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-C07:46	LYMDYLVEV	0.2747	0.9125	7	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-C07:19	LYMDYLVEV	0.2628	0.7737	7	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-C07:29	LYMDYLVEV	0.2163	0.9556	7	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-C07:13	LYMDYLVEV	0.2104	0.9403	7	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-C07:27	LYMDYLVEV	0.1077	0.9768	7	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-C07:95	LYMDYLVEV	0.1027	0.8169	7	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-A02:02	FLYMDYLVEV	0.9996	0.6895	6	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-A02:07	FLYMDYLVEV	0.9994	0.6259	6	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-A02:01	FLYMDYLVEV	0.9994	0.5789	6	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-A02:05	FLYMDYLVEV	0.9994	0.7884	6	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-C04:03	YMDYLVEV	1	0.7855	8	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-C18:01	YMDYLVEV	1	0.7413	8	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-C04:01	YMDYLVEV	1	0.7384	8	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-C05:01	YMDYLVEV	1	0.9828	8	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-C08:02	YMDYLVEV	0.9992	0.9868	8	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-C04:03	YMDYLVEVL	0.9999	0.6994	8	17
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-C05:01	YMDYLVEVL	0.9999	0.9603	8	17
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-C04:01	YMDYLVEVL	0.9998	0.66	8	17
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-C08:02	YMDYLVEVL	0.9997	0.9753	8	17
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-C18:01	YMDYLVEVL	0.9997	0.6666	8	17
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-C01:03	YMDYLVEVL	0.9996	0.9064	8	17
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-C01:02	YMDYLVEVL	0.9993	0.9488	8	17
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-A02:03	YLVEVLYFA	0.9974	0.6152	11	20
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-A02:06	YLVEVLYFA	0.9965	0.6578	11	20
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-A02:14	YLVEVLYFA	0.9963	0.5709	11	20
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-A02:06	YMDYLVEVL	0.993	0.7782	8	17
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-A02:14	YMDYLVEVL	0.9929	0.7109	8	17
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-C03:67	YMDYLVEVL	0.9869	0.9868	8	17
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-C04:04	YMDYLVEVL	0.9866	0.8848	8	17
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-C03:06	YMDYLVEVL	0.9865	0.9931	8	17
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-C08:01	YMDYLVEVL	0.964	0.989	8	17
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-B18:11	MDYLVEVLY	0.9586	0.9136	9	18
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-B35:20	MDYLVEVLY	0.9515	0.9368	9	18
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-B18:04	MDYLVEVLY	0.9393	0.9319	9	18
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-C17:01	YMDYLVEVL	0.918	0.9473	8	17
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-C07:04	YMDYLVEVL	0.9096	0.932	8	17
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-C18:01	LYMDYLVEV	0.9011	0.8096	7	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-C04:01	LYMDYLVEV	0.8962	0.7809	7	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-B18:07	MDYLVEVLY	0.8642	0.8848	9	18
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-B18:08	MDYLVEVLY	0.8618	0.8913	9	18
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-C04:04	LYMDYLVEV	0.8613	0.898	7	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-B18:05	MDYLVEVLY	0.842	0.9215	9	18
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-B18:06	MDYLVEVLY	0.8332	0.9287	9	18
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-B18:03	MDYLVEVLY	0.816	0.9119	9	18
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-B39:11	YMDYLVEVL	0.8056	0.8513	8	17
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-C06:02	LYMDYLVEV	0.7289	0.9962	7	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-C06:17	LYMDYLVEV	0.7289	0.9962	7	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-B08:12	YMDYLVEVL	0.6372	0.8038	8	17
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-C06:06	LYMDYLVEV	0.5805	0.989	7	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-B15:09	YMDYLVEVL	0.5159	0.6064	8	17
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-C14:02	LYMDYLVEV	0.4373	0.9776	7	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-C14:03	LYMDYLVEV	0.4373	0.9776	7	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-C07:02	LYMDYLVEV	0.283	0.9669	7	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-C03:67	LYMDYLVEV	0.2785	0.9886	7	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-C06:08	LYMDYLVEV	0.2548	0.9946	7	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-C07:04	LYMDYLVEV	0.2335	0.9538	7	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-C07:17	LYMDYLVEV	0.195	0.9812	7	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-B07:13	YMDYLVEVL	0.1258	0.8833	8	17
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-C07:01	LYMDYLVEV	0.1048	0.7937	7	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-C07:22	LYMDYLVEV	0.0984	0.8809	7	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-A02:03	FLYMDYLVEV	0.9995	0.7322	6	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-A02:06	FLYMDYLVEV	0.9992	0.713	6	16
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	HLA-A02:14	FLYMDYLVEV	0.9992	0.6951	6	16

Top

Potential FusionNeoAntigen Information of ARL15-MOCS2 in HLA II

ARL15-MOCS2_53606262_52404473.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
ARL15-MOCS2	chr5	53606262	chr5	52404473	142	DRB1-0907	YLVEVLYFAKSAEIT	11	26

Top

Fusion breakpoint peptide structures of ARL15-MOCS2

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
2467	FLYMDYLVEVLYFA	ARL15	MOCS2	chr5	53606262	chr5	52404473	142

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of ARL15-MOCS2

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	2467	FLYMDYLVEVLYFA	-7.9962	-8.1096
HLA-B14:02	3BVN	2467	FLYMDYLVEVLYFA	-5.70842	-6.74372
HLA-B52:01	3W39	2467	FLYMDYLVEVLYFA	-6.83737	-6.95077
HLA-B52:01	3W39	2467	FLYMDYLVEVLYFA	-4.4836	-5.5189
HLA-A11:01	4UQ2	2467	FLYMDYLVEVLYFA	-10.0067	-10.1201
HLA-A11:01	4UQ2	2467	FLYMDYLVEVLYFA	-9.03915	-10.0745
HLA-A24:02	5HGA	2467	FLYMDYLVEVLYFA	-6.56204	-6.67544
HLA-A24:02	5HGA	2467	FLYMDYLVEVLYFA	-5.42271	-6.45801
HLA-B44:05	3DX8	2467	FLYMDYLVEVLYFA	-7.85648	-8.89178
HLA-B44:05	3DX8	2467	FLYMDYLVEVLYFA	-5.3978	-5.5112
HLA-A02:01	6TDR	2467	FLYMDYLVEVLYFA	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of ARL15-MOCS2

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
ARL15-MOCS2	chr5	53606262	chr5	52404473	10	19	DYLVEVLYF	GATTATCTGGTTGAAGTATTGTATTTT
ARL15-MOCS2	chr5	53606262	chr5	52404473	11	20	YLVEVLYFA	TATCTGGTTGAAGTATTGTATTTTGCA
ARL15-MOCS2	chr5	53606262	chr5	52404473	6	16	FLYMDYLVEV	TTTCTGTACATGGATTATCTGGTTGAAGTA
ARL15-MOCS2	chr5	53606262	chr5	52404473	7	16	LYMDYLVEV	CTGTACATGGATTATCTGGTTGAAGTA
ARL15-MOCS2	chr5	53606262	chr5	52404473	8	16	YMDYLVEV	TACATGGATTATCTGGTTGAAGTA
ARL15-MOCS2	chr5	53606262	chr5	52404473	8	17	YMDYLVEVL	TACATGGATTATCTGGTTGAAGTATTG
ARL15-MOCS2	chr5	53606262	chr5	52404473	9	18	MDYLVEVLY	ATGGATTATCTGGTTGAAGTATTGTAT

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
ARL15-MOCS2	chr5	53606262	chr5	52404473	11	26	YLVEVLYFAKSAEIT	TATCTGGTTGAAGTATTGTATTTTGCAAAAAGTGCTGAAATAACA

Top

Information of the samples that have these potential fusion neoantigens of ARL15-MOCS2

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
LUSC	ARL15-MOCS2	chr5	53606262	ENST00000504924	chr5	52404473	ENST00000361377	TCGA-21-1079-01A

Top

Potential target of CAR-T therapy development for ARL15-MOCS2

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to ARL15-MOCS2

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to ARL15-MOCS2

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)