![]() |
|||||||
|
Fusion Protein:PNKP-FZR1 |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: PNKP-FZR1 | FusionPDB ID: 66727 | FusionGDB2.0 ID: 66727 | Hgene | Tgene | Gene symbol | PNKP | FZR1 | Gene ID | 11284 | 51343 |
Gene name | polynucleotide kinase 3'-phosphatase | fizzy and cell division cycle 20 related 1 | |
Synonyms | AOA4|EIEE10|MCSZ|PNK | CDC20C|CDH1|FZR|FZR2|HCDH|HCDH1 | |
Cytomap | 19q13.33 | 19p13.3 | |
Type of gene | protein-coding | protein-coding | |
Description | bifunctional polynucleotide phosphatase/kinaseDNA 5'-kinase/3'-phosphataseHomo sapiens polynucleotide kinase 3'-phosphatase (PNKP) | fizzy-related protein homologCDC20 homolog 1CDC20-like 1bCDC20-like protein 1cdh1/Hct1 homologfizzy/cell division cycle 20 related 1 | |
Modification date | 20200313 | 20200313 | |
UniProtAcc | . | Q9UM11 Main function of 5'-partner protein: FUNCTION: Substrate-specific adapter for the anaphase promoting complex/cyclosome (APC/C) E3 ubiquitin-protein ligase complex. Associates with the APC/C in late mitosis, in replacement of CDC20, and activates the APC/C during anaphase and telophase. The APC/C remains active in degrading substrates to ensure that positive regulators of the cell cycle do not accumulate prematurely. At the G1/S transition FZR1 is phosphorylated, leading to its dissociation from the APC/C. Following DNA damage, it is required for the G2 DNA damage checkpoint: its dephosphorylation and reassociation with the APC/C leads to the ubiquitination of PLK1, preventing entry into mitosis. Acts as an adapter for APC/C to target the DNA-end resection factor RBBP8/CtIP for ubiquitination and subsequent proteasomal degradation. Through the regulation of RBBP8/CtIP protein turnover, may play a role in DNA damage response, favoring DNA double-strand repair through error-prone non-homologous end joining (NHEJ) over error-free, RBBP8-mediated homologous recombination (HR) (PubMed:25349192). {ECO:0000269|PubMed:18662541, ECO:0000269|PubMed:21596315, ECO:0000269|PubMed:25349192, ECO:0000269|PubMed:9734353}. | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000322344, ENST00000600573, ENST00000600910, ENST00000596014, ENST00000595792, | ENST00000313639, ENST00000395095, ENST00000441788, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 6 X 3 X 4=72 | 6 X 5 X 4=120 |
# samples | 6 | 6 | |
** MAII score | log2(6/72*10)=-0.263034405833794 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(6/120*10)=-1 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: PNKP [Title/Abstract] AND FZR1 [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: PNKP [Title/Abstract] AND FZR1 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | PNKP(50369656)-FZR1(3525866), # samples:1 | ||
Anticipated loss of major functional domain due to fusion event. | PNKP-FZR1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. PNKP-FZR1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. PNKP-FZR1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. PNKP-FZR1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. PNKP-FZR1 seems lost the major protein functional domain in Hgene partner, which is a essential gene due to the frame-shifted ORF. PNKP-FZR1 seems lost the major protein functional domain in Tgene partner, which is a essential gene due to the frame-shifted ORF. PNKP-FZR1 seems lost the major protein functional domain in Tgene partner, which is a tumor suppressor due to the frame-shifted ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Hgene | PNKP | GO:0006979 | response to oxidative stress | 10446192 |
Hgene | PNKP | GO:0016311 | dephosphorylation | 10446193 |
Hgene | PNKP | GO:0042769 | DNA damage response, detection of DNA damage | 10446192 |
Hgene | PNKP | GO:0046939 | nucleotide phosphorylation | 10446193 |
Tgene | FZR1 | GO:0031145 | anaphase-promoting complex-dependent catabolic process | 18662541|21596315 |
Tgene | FZR1 | GO:0072425 | signal transduction involved in G2 DNA damage checkpoint | 18662541 |
Tgene | FZR1 | GO:1904668 | positive regulation of ubiquitin protein ligase activity | 11459826 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr19:50369656/chr19:3525866) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000596014 | PNKP | chr19 | 50369656 | - | ENST00000441788 | FZR1 | chr19 | 3525866 | + | 5187 | 280 | 58 | 1692 | 544 |
ENST00000596014 | PNKP | chr19 | 50369656 | - | ENST00000313639 | FZR1 | chr19 | 3525866 | + | 1426 | 280 | 58 | 1425 | 456 |
ENST00000596014 | PNKP | chr19 | 50369656 | - | ENST00000395095 | FZR1 | chr19 | 3525866 | + | 1702 | 280 | 58 | 1701 | 548 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000596014 | ENST00000441788 | PNKP | chr19 | 50369656 | - | FZR1 | chr19 | 3525866 | + | 0.03441717 | 0.96558285 |
ENST00000596014 | ENST00000313639 | PNKP | chr19 | 50369656 | - | FZR1 | chr19 | 3525866 | + | 0.12959912 | 0.87040085 |
ENST00000596014 | ENST00000395095 | PNKP | chr19 | 50369656 | - | FZR1 | chr19 | 3525866 | + | 0.06925461 | 0.93074536 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for PNKP-FZR1 |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
PNKP | chr19 | 50369656 | FZR1 | chr19 | 3525866 | 280 | 73 | LVADPETRTVAVKQVTEMRRTLTPAS |
Top |
Potential FusionNeoAntigen Information of PNKP-FZR1 in HLA I |
![]() |
PNKP-FZR1_50369656_3525866.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
PNKP-FZR1 | chr19 | 50369656 | chr19 | 3525866 | 280 | HLA-B15:17 | VAVKQVTEM | 0.997 | 0.8052 | 9 | 18 |
PNKP-FZR1 | chr19 | 50369656 | chr19 | 3525866 | 280 | HLA-B15:16 | VAVKQVTEM | 0.9944 | 0.7758 | 9 | 18 |
PNKP-FZR1 | chr19 | 50369656 | chr19 | 3525866 | 280 | HLA-B35:01 | VAVKQVTEM | 0.9878 | 0.7693 | 9 | 18 |
PNKP-FZR1 | chr19 | 50369656 | chr19 | 3525866 | 280 | HLA-B35:03 | VAVKQVTEM | 0.9769 | 0.7068 | 9 | 18 |
PNKP-FZR1 | chr19 | 50369656 | chr19 | 3525866 | 280 | HLA-B35:02 | VAVKQVTEM | 0.738 | 0.9343 | 9 | 18 |
PNKP-FZR1 | chr19 | 50369656 | chr19 | 3525866 | 280 | HLA-B35:04 | VAVKQVTEM | 0.738 | 0.9343 | 9 | 18 |
PNKP-FZR1 | chr19 | 50369656 | chr19 | 3525866 | 280 | HLA-C03:08 | VAVKQVTEM | 0.9997 | 0.7803 | 9 | 18 |
PNKP-FZR1 | chr19 | 50369656 | chr19 | 3525866 | 280 | HLA-C03:19 | VAVKQVTEM | 0.9997 | 0.9798 | 9 | 18 |
PNKP-FZR1 | chr19 | 50369656 | chr19 | 3525866 | 280 | HLA-C15:04 | VAVKQVTEM | 0.9997 | 0.7841 | 9 | 18 |
PNKP-FZR1 | chr19 | 50369656 | chr19 | 3525866 | 280 | HLA-C03:07 | VAVKQVTEM | 0.9996 | 0.9497 | 9 | 18 |
PNKP-FZR1 | chr19 | 50369656 | chr19 | 3525866 | 280 | HLA-C15:06 | VAVKQVTEM | 0.9991 | 0.6915 | 9 | 18 |
PNKP-FZR1 | chr19 | 50369656 | chr19 | 3525866 | 280 | HLA-B15:21 | VAVKQVTEM | 0.9985 | 0.8609 | 9 | 18 |
PNKP-FZR1 | chr19 | 50369656 | chr19 | 3525866 | 280 | HLA-C06:03 | VAVKQVTEM | 0.9974 | 0.9763 | 9 | 18 |
PNKP-FZR1 | chr19 | 50369656 | chr19 | 3525866 | 280 | HLA-C04:06 | VAVKQVTEM | 0.9973 | 0.8608 | 9 | 18 |
PNKP-FZR1 | chr19 | 50369656 | chr19 | 3525866 | 280 | HLA-C12:04 | VAVKQVTEM | 0.9972 | 0.9828 | 9 | 18 |
PNKP-FZR1 | chr19 | 50369656 | chr19 | 3525866 | 280 | HLA-C12:12 | VAVKQVTEM | 0.9968 | 0.8475 | 9 | 18 |
PNKP-FZR1 | chr19 | 50369656 | chr19 | 3525866 | 280 | HLA-C03:14 | VAVKQVTEM | 0.9945 | 0.9313 | 9 | 18 |
PNKP-FZR1 | chr19 | 50369656 | chr19 | 3525866 | 280 | HLA-C08:04 | VAVKQVTEM | 0.9933 | 0.9677 | 9 | 18 |
PNKP-FZR1 | chr19 | 50369656 | chr19 | 3525866 | 280 | HLA-C08:13 | VAVKQVTEM | 0.9933 | 0.9677 | 9 | 18 |
PNKP-FZR1 | chr19 | 50369656 | chr19 | 3525866 | 280 | HLA-C01:30 | VAVKQVTEM | 0.9628 | 0.9332 | 9 | 18 |
PNKP-FZR1 | chr19 | 50369656 | chr19 | 3525866 | 280 | HLA-C02:06 | VAVKQVTEM | 0.9548 | 0.9127 | 9 | 18 |
PNKP-FZR1 | chr19 | 50369656 | chr19 | 3525866 | 280 | HLA-C08:03 | VAVKQVTEM | 0.8879 | 0.9737 | 9 | 18 |
PNKP-FZR1 | chr19 | 50369656 | chr19 | 3525866 | 280 | HLA-B35:12 | VAVKQVTEM | 0.738 | 0.9343 | 9 | 18 |
PNKP-FZR1 | chr19 | 50369656 | chr19 | 3525866 | 280 | HLA-C12:16 | TRTVAVKQV | 0.0062 | 0.8885 | 6 | 15 |
PNKP-FZR1 | chr19 | 50369656 | chr19 | 3525866 | 280 | HLA-C03:03 | VAVKQVTEM | 0.9998 | 0.9803 | 9 | 18 |
PNKP-FZR1 | chr19 | 50369656 | chr19 | 3525866 | 280 | HLA-C03:04 | VAVKQVTEM | 0.9998 | 0.9803 | 9 | 18 |
PNKP-FZR1 | chr19 | 50369656 | chr19 | 3525866 | 280 | HLA-C03:02 | VAVKQVTEM | 0.9998 | 0.9639 | 9 | 18 |
PNKP-FZR1 | chr19 | 50369656 | chr19 | 3525866 | 280 | HLA-C03:67 | VAVKQVTEM | 0.9997 | 0.9696 | 9 | 18 |
PNKP-FZR1 | chr19 | 50369656 | chr19 | 3525866 | 280 | HLA-C15:09 | VAVKQVTEM | 0.9997 | 0.7841 | 9 | 18 |
PNKP-FZR1 | chr19 | 50369656 | chr19 | 3525866 | 280 | HLA-C03:05 | VAVKQVTEM | 0.9996 | 0.8577 | 9 | 18 |
PNKP-FZR1 | chr19 | 50369656 | chr19 | 3525866 | 280 | HLA-C03:17 | VAVKQVTEM | 0.9995 | 0.9581 | 9 | 18 |
PNKP-FZR1 | chr19 | 50369656 | chr19 | 3525866 | 280 | HLA-C12:02 | VAVKQVTEM | 0.9992 | 0.9219 | 9 | 18 |
PNKP-FZR1 | chr19 | 50369656 | chr19 | 3525866 | 280 | HLA-C15:05 | VAVKQVTEM | 0.999 | 0.746 | 9 | 18 |
PNKP-FZR1 | chr19 | 50369656 | chr19 | 3525866 | 280 | HLA-C15:02 | VAVKQVTEM | 0.9989 | 0.6603 | 9 | 18 |
PNKP-FZR1 | chr19 | 50369656 | chr19 | 3525866 | 280 | HLA-C16:04 | VAVKQVTEM | 0.9984 | 0.9546 | 9 | 18 |
PNKP-FZR1 | chr19 | 50369656 | chr19 | 3525866 | 280 | HLA-B35:11 | VAVKQVTEM | 0.9982 | 0.8266 | 9 | 18 |
PNKP-FZR1 | chr19 | 50369656 | chr19 | 3525866 | 280 | HLA-C12:03 | VAVKQVTEM | 0.9975 | 0.964 | 9 | 18 |
PNKP-FZR1 | chr19 | 50369656 | chr19 | 3525866 | 280 | HLA-B15:11 | VAVKQVTEM | 0.9973 | 0.7598 | 9 | 18 |
PNKP-FZR1 | chr19 | 50369656 | chr19 | 3525866 | 280 | HLA-B15:08 | VAVKQVTEM | 0.9971 | 0.7368 | 9 | 18 |
PNKP-FZR1 | chr19 | 50369656 | chr19 | 3525866 | 280 | HLA-B35:43 | VAVKQVTEM | 0.9962 | 0.7389 | 9 | 18 |
PNKP-FZR1 | chr19 | 50369656 | chr19 | 3525866 | 280 | HLA-C03:06 | VAVKQVTEM | 0.9929 | 0.984 | 9 | 18 |
PNKP-FZR1 | chr19 | 50369656 | chr19 | 3525866 | 280 | HLA-B35:30 | VAVKQVTEM | 0.9924 | 0.6593 | 9 | 18 |
PNKP-FZR1 | chr19 | 50369656 | chr19 | 3525866 | 280 | HLA-B35:17 | VAVKQVTEM | 0.9924 | 0.6593 | 9 | 18 |
PNKP-FZR1 | chr19 | 50369656 | chr19 | 3525866 | 280 | HLA-B35:77 | VAVKQVTEM | 0.9878 | 0.7693 | 9 | 18 |
PNKP-FZR1 | chr19 | 50369656 | chr19 | 3525866 | 280 | HLA-B35:23 | VAVKQVTEM | 0.9875 | 0.7738 | 9 | 18 |
PNKP-FZR1 | chr19 | 50369656 | chr19 | 3525866 | 280 | HLA-C02:02 | VAVKQVTEM | 0.9832 | 0.9524 | 9 | 18 |
PNKP-FZR1 | chr19 | 50369656 | chr19 | 3525866 | 280 | HLA-C02:10 | VAVKQVTEM | 0.9832 | 0.9524 | 9 | 18 |
PNKP-FZR1 | chr19 | 50369656 | chr19 | 3525866 | 280 | HLA-C16:01 | VAVKQVTEM | 0.9773 | 0.9666 | 9 | 18 |
PNKP-FZR1 | chr19 | 50369656 | chr19 | 3525866 | 280 | HLA-B35:13 | VAVKQVTEM | 0.9726 | 0.7138 | 9 | 18 |
PNKP-FZR1 | chr19 | 50369656 | chr19 | 3525866 | 280 | HLA-C06:08 | TRTVAVKQV | 0.9489 | 0.9812 | 6 | 15 |
PNKP-FZR1 | chr19 | 50369656 | chr19 | 3525866 | 280 | HLA-B35:24 | VAVKQVTEM | 0.946 | 0.7227 | 9 | 18 |
PNKP-FZR1 | chr19 | 50369656 | chr19 | 3525866 | 280 | HLA-B78:02 | VAVKQVTEM | 0.917 | 0.7101 | 9 | 18 |
PNKP-FZR1 | chr19 | 50369656 | chr19 | 3525866 | 280 | HLA-B15:73 | VAVKQVTEM | 0.9011 | 0.9014 | 9 | 18 |
PNKP-FZR1 | chr19 | 50369656 | chr19 | 3525866 | 280 | HLA-B15:30 | VAVKQVTEM | 0.899 | 0.8237 | 9 | 18 |
PNKP-FZR1 | chr19 | 50369656 | chr19 | 3525866 | 280 | HLA-C17:01 | VAVKQVTEM | 0.8889 | 0.9498 | 9 | 18 |
PNKP-FZR1 | chr19 | 50369656 | chr19 | 3525866 | 280 | HLA-C08:01 | VAVKQVTEM | 0.8879 | 0.9737 | 9 | 18 |
PNKP-FZR1 | chr19 | 50369656 | chr19 | 3525866 | 280 | HLA-B07:13 | VAVKQVTEM | 0.8748 | 0.7137 | 9 | 18 |
PNKP-FZR1 | chr19 | 50369656 | chr19 | 3525866 | 280 | HLA-C16:02 | VAVKQVTEM | 0.8553 | 0.9835 | 9 | 18 |
PNKP-FZR1 | chr19 | 50369656 | chr19 | 3525866 | 280 | HLA-B35:09 | VAVKQVTEM | 0.738 | 0.9343 | 9 | 18 |
PNKP-FZR1 | chr19 | 50369656 | chr19 | 3525866 | 280 | HLA-C06:02 | TRTVAVKQV | 0.0929 | 0.9796 | 6 | 15 |
PNKP-FZR1 | chr19 | 50369656 | chr19 | 3525866 | 280 | HLA-C06:17 | TRTVAVKQV | 0.0929 | 0.9796 | 6 | 15 |
Top |
Potential FusionNeoAntigen Information of PNKP-FZR1 in HLA II |
![]() |
PNKP-FZR1_50369656_3525866.msa |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
PNKP-FZR1 | chr19 | 50369656 | chr19 | 3525866 | 280 | DRB1-1192 | VKQVTEMRRTLTPAS | 11 | 26 |
Top |
Fusion breakpoint peptide structures of PNKP-FZR1 |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
9616 | TRTVAVKQVTEMRR | PNKP | FZR1 | chr19 | 50369656 | chr19 | 3525866 | 280 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of PNKP-FZR1 |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 9616 | TRTVAVKQVTEMRR | -7.15543 | -7.26883 |
HLA-B14:02 | 3BVN | 9616 | TRTVAVKQVTEMRR | -4.77435 | -5.80965 |
HLA-B52:01 | 3W39 | 9616 | TRTVAVKQVTEMRR | -6.80875 | -6.92215 |
HLA-B52:01 | 3W39 | 9616 | TRTVAVKQVTEMRR | -4.20386 | -5.23916 |
HLA-A11:01 | 4UQ2 | 9616 | TRTVAVKQVTEMRR | -7.5194 | -8.5547 |
HLA-A11:01 | 4UQ2 | 9616 | TRTVAVKQVTEMRR | -6.9601 | -7.0735 |
HLA-A24:02 | 5HGA | 9616 | TRTVAVKQVTEMRR | -7.52403 | -7.63743 |
HLA-A24:02 | 5HGA | 9616 | TRTVAVKQVTEMRR | -5.82433 | -6.85963 |
HLA-B27:05 | 6PYJ | 9616 | TRTVAVKQVTEMRR | -3.28285 | -4.31815 |
HLA-B44:05 | 3DX8 | 9616 | TRTVAVKQVTEMRR | -5.91172 | -6.94702 |
HLA-B44:05 | 3DX8 | 9616 | TRTVAVKQVTEMRR | -4.24346 | -4.35686 |
Top |
Vaccine Design for the FusionNeoAntigens of PNKP-FZR1 |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
PNKP-FZR1 | chr19 | 50369656 | chr19 | 3525866 | 6 | 15 | TRTVAVKQV | CGGACAGTGGCAGTGAAACAGGTCACA |
PNKP-FZR1 | chr19 | 50369656 | chr19 | 3525866 | 9 | 18 | VAVKQVTEM | GCAGTGAAACAGGTCACAGAGATGCGG |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
PNKP-FZR1 | chr19 | 50369656 | chr19 | 3525866 | 11 | 26 | VKQVTEMRRTLTPAS | AAACAGGTCACAGAGATGCGGCGGACCCTGACGCCTGCCAGCTCC |
Top |
Information of the samples that have these potential fusion neoantigens of PNKP-FZR1 |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
STAD | PNKP-FZR1 | chr19 | 50369656 | ENST00000596014 | chr19 | 3525866 | ENST00000313639 | TCGA-BR-A4PD-01A |
Top |
Potential target of CAR-T therapy development for PNKP-FZR1 |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to PNKP-FZR1 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to PNKP-FZR1 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |