|
Fusion Protein:PNPLA8-CFTR |
Fusion Gene and Fusion Protein Summary |
Fusion gene summary |
Fusion partner gene information | Fusion gene name: PNPLA8-CFTR | FusionPDB ID: 66785 | FusionGDB2.0 ID: 66785 | Hgene | Tgene | Gene symbol | PNPLA8 | CFTR | Gene ID | 50640 | 1080 |
Gene name | patatin like phospholipase domain containing 8 | CF transmembrane conductance regulator | |
Synonyms | IPLA2-2|IPLA2G|MMLA|PNPLA-gamma|iPLA2gamma | ABC35|ABCC7|CF|CFTR/MRP|MRP7|TNR-CFTR|dJ760C5.1 | |
Cytomap | 7q31.1 | 7q31.2 | |
Type of gene | protein-coding | protein-coding | |
Description | calcium-independent phospholipase A2-gammaintracellular membrane-associated calcium-independent phospholipase A2 gammamembrane-associated calcium-independent phospholipase A2 gamma | cystic fibrosis transmembrane conductance regulatorcAMP-dependent chloride channelchannel conductance-controlling ATPasecystic fibrosis transmembrane conductance regulatingcystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-f | |
Modification date | 20200313 | 20200329 | |
UniProtAcc | . | P13569 Main function of 5'-partner protein: FUNCTION: Epithelial ion channel that plays an important role in the regulation of epithelial ion and water transport and fluid homeostasis (PubMed:26823428). Mediates the transport of chloride ions across the cell membrane (PubMed:10792060, PubMed:11524016, PubMed:11707463, PubMed:12519745, PubMed:15010471, PubMed:12588899, PubMed:17036051, PubMed:19398555, PubMed:19621064, PubMed:22178883, PubMed:25330774, PubMed:1712898, PubMed:8910473, PubMed:9804160, PubMed:12529365, PubMed:17182731, PubMed:26846474, PubMed:28087700). Channel activity is coupled to ATP hydrolysis (PubMed:8910473). The ion channel is also permeable to HCO(3-); selectivity depends on the extracellular chloride concentration (PubMed:15010471, PubMed:19019741). Exerts its function also by modulating the activity of other ion channels and transporters (PubMed:12403779, PubMed:22178883, PubMed:22121115, PubMed:27941075). Plays an important role in airway fluid homeostasis (PubMed:16645176, PubMed:19621064, PubMed:26823428). Contributes to the regulation of the pH and the ion content of the airway surface fluid layer and thereby plays an important role in defense against pathogens (PubMed:14668433, PubMed:16645176, PubMed:26823428). Modulates the activity of the epithelial sodium channel (ENaC) complex, in part by regulating the cell surface expression of the ENaC complex (PubMed:17434346, PubMed:27941075, PubMed:17182731). Inhibits the activity of the ENaC channel containing subunits SCNN1A, SCNN1B and SCNN1G (PubMed:17182731). Inhibits the activity of the ENaC channel containing subunits SCNN1D, SCNN1B and SCNN1G, but not of the ENaC channel containing subunits SCNN1A, SCNN1B and SCNN1G (PubMed:27941075). May regulate bicarbonate secretion and salvage in epithelial cells by regulating the transporter SLC4A7 (PubMed:12403779). Can inhibit the chloride channel activity of ANO1 (PubMed:22178883). Plays a role in the chloride and bicarbonate homeostasis during sperm epididymal maturation and capacitation (PubMed:19923167, PubMed:27714810). {ECO:0000269|PubMed:10792060, ECO:0000269|PubMed:11524016, ECO:0000269|PubMed:11707463, ECO:0000269|PubMed:12403779, ECO:0000269|PubMed:12519745, ECO:0000269|PubMed:12529365, ECO:0000269|PubMed:12588899, ECO:0000269|PubMed:14668433, ECO:0000269|PubMed:15010471, ECO:0000269|PubMed:16645176, ECO:0000269|PubMed:17036051, ECO:0000269|PubMed:1712898, ECO:0000269|PubMed:17182731, ECO:0000269|PubMed:19019741, ECO:0000269|PubMed:19398555, ECO:0000269|PubMed:19621064, ECO:0000269|PubMed:22178883, ECO:0000269|PubMed:25330774, ECO:0000269|PubMed:26627831, ECO:0000269|PubMed:26823428, ECO:0000269|PubMed:26846474, ECO:0000269|PubMed:27714810, ECO:0000269|PubMed:27941075, ECO:0000269|PubMed:28087700, ECO:0000269|PubMed:8910473, ECO:0000269|PubMed:9804160, ECO:0000305|PubMed:19923167}. | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000257694, ENST00000422087, ENST00000436062, ENST00000453144, ENST00000388728, ENST00000426128, ENST00000483879, | ENST00000608965, ENST00000003084, ENST00000454343, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 2 X 2 X 2=8 | 13 X 15 X 10=1950 |
# samples | 2 | 13 | |
** MAII score | log2(2/8*10)=1.32192809488736 | log2(13/1950*10)=-3.90689059560852 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: PNPLA8 [Title/Abstract] AND CFTR [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: PNPLA8 [Title/Abstract] AND CFTR [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | PNPLA8(108128203)-CFTR(117282492), # samples:3 | ||
Anticipated loss of major functional domain due to fusion event. | PNPLA8-CFTR seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. PNPLA8-CFTR seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. PNPLA8-CFTR seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. PNPLA8-CFTR seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. PNPLA8-CFTR seems lost the major protein functional domain in Hgene partner, which is a cell metabolism gene due to the frame-shifted ORF. PNPLA8-CFTR seems lost the major protein functional domain in Hgene partner, which is a essential gene due to the frame-shifted ORF. PNPLA8-CFTR seems lost the major protein functional domain in Tgene partner, which is a IUPHAR drug target due to the frame-shifted ORF. PNPLA8-CFTR seems lost the major protein functional domain in Tgene partner, which is a tumor suppressor due to the frame-shifted ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
Partner | Gene | GO ID | GO term | PubMed ID |
Hgene | PNPLA8 | GO:0001516 | prostaglandin biosynthetic process | 15695510 |
Hgene | PNPLA8 | GO:0006631 | fatty acid metabolic process | 10744668 |
Hgene | PNPLA8 | GO:0008219 | cell death | 15695510 |
Hgene | PNPLA8 | GO:0019369 | arachidonic acid metabolic process | 10833412|15695510 |
Hgene | PNPLA8 | GO:0034638 | phosphatidylcholine catabolic process | 15695510 |
Hgene | PNPLA8 | GO:0043651 | linoleic acid metabolic process | 15695510 |
Hgene | PNPLA8 | GO:0046338 | phosphatidylethanolamine catabolic process | 15695510 |
Hgene | PNPLA8 | GO:0050482 | arachidonic acid secretion | 10833412|15695510 |
Tgene | CFTR | GO:0015701 | bicarbonate transport | 15010471|19019741 |
Tgene | CFTR | GO:0034976 | response to endoplasmic reticulum stress | 21884936|28067262 |
Tgene | CFTR | GO:1902476 | chloride transmembrane transport | 11524016|11707463|19019741 |
Tgene | CFTR | GO:1902943 | positive regulation of voltage-gated chloride channel activity | 22006324 |
Tgene | CFTR | GO:1904322 | cellular response to forskolin | 15010471|19621064 |
Four levels of functional features of fusion genes Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr7:108128203/chr7:117282492) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here. |
Fusion gene breakpoints across PNPLA8 (5'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
Fusion gene breakpoints across CFTR (3'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
Top |
Fusion Amino Acid Sequences |
Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB. |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000422087 | PNPLA8 | chr7 | 108128203 | - | ENST00000003084 | CFTR | chr7 | 117282492 | + | 4564 | 2285 | 407 | 3010 | 867 |
ENST00000422087 | PNPLA8 | chr7 | 108128203 | - | ENST00000454343 | CFTR | chr7 | 117282492 | + | 4568 | 2285 | 407 | 3010 | 867 |
ENST00000453144 | PNPLA8 | chr7 | 108128203 | - | ENST00000003084 | CFTR | chr7 | 117282492 | + | 4400 | 2121 | 270 | 2846 | 858 |
ENST00000453144 | PNPLA8 | chr7 | 108128203 | - | ENST00000454343 | CFTR | chr7 | 117282492 | + | 4404 | 2121 | 270 | 2846 | 858 |
DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated. |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000422087 | ENST00000003084 | PNPLA8 | chr7 | 108128203 | - | CFTR | chr7 | 117282492 | + | 0.000200967 | 0.9997991 |
ENST00000422087 | ENST00000454343 | PNPLA8 | chr7 | 108128203 | - | CFTR | chr7 | 117282492 | + | 0.000198362 | 0.9998017 |
ENST00000453144 | ENST00000003084 | PNPLA8 | chr7 | 108128203 | - | CFTR | chr7 | 117282492 | + | 0.00039459 | 0.9996055 |
ENST00000453144 | ENST00000454343 | PNPLA8 | chr7 | 108128203 | - | CFTR | chr7 | 117282492 | + | 0.000388912 | 0.9996111 |
Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones. |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for PNPLA8-CFTR |
+/-13 AA sequence from the breakpoints of the fusion protein sequences. |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
PNPLA8 | chr7 | 108128203 | CFTR | chr7 | 117282492 | 2121 | 617 | YFAEYALGNDLHQVGLLGRTGSGKST |
PNPLA8 | chr7 | 108128203 | CFTR | chr7 | 117282492 | 2285 | 626 | YFAEYALGNDLHQVGLLGRTGSGKST |
Top |
Potential FusionNeoAntigen Information of PNPLA8-CFTR in HLA I |
Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
PNPLA8-CFTR_108128203_117282492.msa |
Potential FusionNeoAntigen Information * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
PNPLA8-CFTR | chr7 | 108128203 | chr7 | 117282492 | 2285 | HLA-A02:22 | ALGNDLHQV | 0.998 | 0.7235 | 5 | 14 |
PNPLA8-CFTR | chr7 | 108128203 | chr7 | 117282492 | 2285 | HLA-A02:11 | ALGNDLHQV | 0.9977 | 0.7424 | 5 | 14 |
PNPLA8-CFTR | chr7 | 108128203 | chr7 | 117282492 | 2285 | HLA-A02:30 | ALGNDLHQV | 0.9976 | 0.7127 | 5 | 14 |
PNPLA8-CFTR | chr7 | 108128203 | chr7 | 117282492 | 2285 | HLA-A02:24 | ALGNDLHQV | 0.9976 | 0.7127 | 5 | 14 |
PNPLA8-CFTR | chr7 | 108128203 | chr7 | 117282492 | 2285 | HLA-A02:67 | ALGNDLHQV | 0.9976 | 0.7127 | 5 | 14 |
PNPLA8-CFTR | chr7 | 108128203 | chr7 | 117282492 | 2285 | HLA-A02:27 | ALGNDLHQV | 0.9975 | 0.7091 | 5 | 14 |
PNPLA8-CFTR | chr7 | 108128203 | chr7 | 117282492 | 2285 | HLA-A02:60 | ALGNDLHQV | 0.9975 | 0.7111 | 5 | 14 |
PNPLA8-CFTR | chr7 | 108128203 | chr7 | 117282492 | 2285 | HLA-A02:16 | ALGNDLHQV | 0.9972 | 0.7161 | 5 | 14 |
PNPLA8-CFTR | chr7 | 108128203 | chr7 | 117282492 | 2285 | HLA-A02:21 | ALGNDLHQV | 0.9967 | 0.8046 | 5 | 14 |
PNPLA8-CFTR | chr7 | 108128203 | chr7 | 117282492 | 2285 | HLA-A02:13 | ALGNDLHQV | 0.9964 | 0.792 | 5 | 14 |
PNPLA8-CFTR | chr7 | 108128203 | chr7 | 117282492 | 2285 | HLA-A02:19 | ALGNDLHQV | 0.9915 | 0.5779 | 5 | 14 |
PNPLA8-CFTR | chr7 | 108128203 | chr7 | 117282492 | 2285 | HLA-A02:04 | ALGNDLHQV | 0.9904 | 0.9107 | 5 | 14 |
PNPLA8-CFTR | chr7 | 108128203 | chr7 | 117282492 | 2285 | HLA-A02:38 | ALGNDLHQV | 0.9879 | 0.8104 | 5 | 14 |
PNPLA8-CFTR | chr7 | 108128203 | chr7 | 117282492 | 2285 | HLA-A02:17 | ALGNDLHQV | 0.9779 | 0.8322 | 5 | 14 |
PNPLA8-CFTR | chr7 | 108128203 | chr7 | 117282492 | 2285 | HLA-A02:35 | ALGNDLHQV | 0.9376 | 0.7218 | 5 | 14 |
PNPLA8-CFTR | chr7 | 108128203 | chr7 | 117282492 | 2285 | HLA-A02:29 | ALGNDLHQV | 0.8971 | 0.7116 | 5 | 14 |
PNPLA8-CFTR | chr7 | 108128203 | chr7 | 117282492 | 2285 | HLA-A02:20 | ALGNDLHQV | 0.8887 | 0.7131 | 5 | 14 |
PNPLA8-CFTR | chr7 | 108128203 | chr7 | 117282492 | 2285 | HLA-B13:02 | ALGNDLHQV | 0.0895 | 0.9846 | 5 | 14 |
PNPLA8-CFTR | chr7 | 108128203 | chr7 | 117282492 | 2285 | HLA-A02:60 | YALGNDLHQV | 0.9951 | 0.6957 | 4 | 14 |
PNPLA8-CFTR | chr7 | 108128203 | chr7 | 117282492 | 2285 | HLA-A02:30 | YALGNDLHQV | 0.9948 | 0.7095 | 4 | 14 |
PNPLA8-CFTR | chr7 | 108128203 | chr7 | 117282492 | 2285 | HLA-A02:24 | YALGNDLHQV | 0.9948 | 0.7095 | 4 | 14 |
PNPLA8-CFTR | chr7 | 108128203 | chr7 | 117282492 | 2285 | HLA-A02:67 | YALGNDLHQV | 0.9948 | 0.7095 | 4 | 14 |
PNPLA8-CFTR | chr7 | 108128203 | chr7 | 117282492 | 2285 | HLA-A02:21 | YALGNDLHQV | 0.9937 | 0.7986 | 4 | 14 |
PNPLA8-CFTR | chr7 | 108128203 | chr7 | 117282492 | 2285 | HLA-A02:11 | YALGNDLHQV | 0.9933 | 0.7417 | 4 | 14 |
PNPLA8-CFTR | chr7 | 108128203 | chr7 | 117282492 | 2285 | HLA-A02:22 | YALGNDLHQV | 0.9888 | 0.6766 | 4 | 14 |
PNPLA8-CFTR | chr7 | 108128203 | chr7 | 117282492 | 2285 | HLA-A02:35 | YALGNDLHQV | 0.9864 | 0.7296 | 4 | 14 |
PNPLA8-CFTR | chr7 | 108128203 | chr7 | 117282492 | 2285 | HLA-A02:29 | YALGNDLHQV | 0.9861 | 0.712 | 4 | 14 |
PNPLA8-CFTR | chr7 | 108128203 | chr7 | 117282492 | 2285 | HLA-A02:20 | YALGNDLHQV | 0.9831 | 0.7137 | 4 | 14 |
PNPLA8-CFTR | chr7 | 108128203 | chr7 | 117282492 | 2285 | HLA-A02:16 | YALGNDLHQV | 0.9811 | 0.6754 | 4 | 14 |
PNPLA8-CFTR | chr7 | 108128203 | chr7 | 117282492 | 2285 | HLA-A02:27 | YALGNDLHQV | 0.9717 | 0.6998 | 4 | 14 |
PNPLA8-CFTR | chr7 | 108128203 | chr7 | 117282492 | 2285 | HLA-A33:05 | DLHQVGLLGR | 0.9688 | 0.7241 | 9 | 19 |
PNPLA8-CFTR | chr7 | 108128203 | chr7 | 117282492 | 2285 | HLA-A33:01 | DLHQVGLLGR | 0.9688 | 0.7241 | 9 | 19 |
PNPLA8-CFTR | chr7 | 108128203 | chr7 | 117282492 | 2285 | HLA-A02:38 | YALGNDLHQV | 0.963 | 0.755 | 4 | 14 |
PNPLA8-CFTR | chr7 | 108128203 | chr7 | 117282492 | 2285 | HLA-A02:13 | YALGNDLHQV | 0.9324 | 0.7838 | 4 | 14 |
PNPLA8-CFTR | chr7 | 108128203 | chr7 | 117282492 | 2285 | HLA-A02:19 | YALGNDLHQV | 0.8939 | 0.5404 | 4 | 14 |
PNPLA8-CFTR | chr7 | 108128203 | chr7 | 117282492 | 2285 | HLA-C08:15 | GNDLHQVGL | 0.9997 | 0.9841 | 7 | 16 |
PNPLA8-CFTR | chr7 | 108128203 | chr7 | 117282492 | 2285 | HLA-A02:02 | ALGNDLHQV | 0.998 | 0.6338 | 5 | 14 |
PNPLA8-CFTR | chr7 | 108128203 | chr7 | 117282492 | 2285 | HLA-A02:07 | ALGNDLHQV | 0.9976 | 0.7356 | 5 | 14 |
PNPLA8-CFTR | chr7 | 108128203 | chr7 | 117282492 | 2285 | HLA-A02:01 | ALGNDLHQV | 0.9976 | 0.7127 | 5 | 14 |
PNPLA8-CFTR | chr7 | 108128203 | chr7 | 117282492 | 2285 | HLA-A02:05 | ALGNDLHQV | 0.9969 | 0.7142 | 5 | 14 |
PNPLA8-CFTR | chr7 | 108128203 | chr7 | 117282492 | 2285 | HLA-B39:08 | GNDLHQVGL | 0.5103 | 0.9623 | 7 | 16 |
PNPLA8-CFTR | chr7 | 108128203 | chr7 | 117282492 | 2285 | HLA-A02:01 | YALGNDLHQV | 0.9948 | 0.7095 | 4 | 14 |
PNPLA8-CFTR | chr7 | 108128203 | chr7 | 117282492 | 2285 | HLA-A02:02 | YALGNDLHQV | 0.9893 | 0.5835 | 4 | 14 |
PNPLA8-CFTR | chr7 | 108128203 | chr7 | 117282492 | 2285 | HLA-A02:05 | YALGNDLHQV | 0.9883 | 0.6688 | 4 | 14 |
PNPLA8-CFTR | chr7 | 108128203 | chr7 | 117282492 | 2285 | HLA-C08:02 | GNDLHQVGL | 0.9997 | 0.9841 | 7 | 16 |
PNPLA8-CFTR | chr7 | 108128203 | chr7 | 117282492 | 2285 | HLA-A02:06 | ALGNDLHQV | 0.9967 | 0.8046 | 5 | 14 |
PNPLA8-CFTR | chr7 | 108128203 | chr7 | 117282492 | 2285 | HLA-A02:14 | ALGNDLHQV | 0.9967 | 0.7502 | 5 | 14 |
PNPLA8-CFTR | chr7 | 108128203 | chr7 | 117282492 | 2285 | HLA-A02:03 | ALGNDLHQV | 0.9961 | 0.7924 | 5 | 14 |
PNPLA8-CFTR | chr7 | 108128203 | chr7 | 117282492 | 2285 | HLA-A02:14 | YALGNDLHQV | 0.9938 | 0.7394 | 4 | 14 |
PNPLA8-CFTR | chr7 | 108128203 | chr7 | 117282492 | 2285 | HLA-A02:06 | YALGNDLHQV | 0.9937 | 0.7986 | 4 | 14 |
PNPLA8-CFTR | chr7 | 108128203 | chr7 | 117282492 | 2285 | HLA-A02:03 | YALGNDLHQV | 0.9803 | 0.7826 | 4 | 14 |
Top |
Potential FusionNeoAntigen Information of PNPLA8-CFTR in HLA II |
Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
Potential FusionNeoAntigen Information * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of PNPLA8-CFTR |
3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
5016 | LGNDLHQVGLLGRT | PNPLA8 | CFTR | chr7 | 108128203 | chr7 | 117282492 | 2285 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of PNPLA8-CFTR |
Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 5016 | LGNDLHQVGLLGRT | -7.9962 | -8.1096 |
HLA-B14:02 | 3BVN | 5016 | LGNDLHQVGLLGRT | -5.70842 | -6.74372 |
HLA-B52:01 | 3W39 | 5016 | LGNDLHQVGLLGRT | -6.83737 | -6.95077 |
HLA-B52:01 | 3W39 | 5016 | LGNDLHQVGLLGRT | -4.4836 | -5.5189 |
HLA-A11:01 | 4UQ2 | 5016 | LGNDLHQVGLLGRT | -10.0067 | -10.1201 |
HLA-A11:01 | 4UQ2 | 5016 | LGNDLHQVGLLGRT | -9.03915 | -10.0745 |
HLA-A24:02 | 5HGA | 5016 | LGNDLHQVGLLGRT | -6.56204 | -6.67544 |
HLA-A24:02 | 5HGA | 5016 | LGNDLHQVGLLGRT | -5.42271 | -6.45801 |
HLA-B44:05 | 3DX8 | 5016 | LGNDLHQVGLLGRT | -7.85648 | -8.89178 |
HLA-B44:05 | 3DX8 | 5016 | LGNDLHQVGLLGRT | -5.3978 | -5.5112 |
HLA-A02:01 | 6TDR | 5016 | LGNDLHQVGLLGRT | -3.37154 | -4.40684 |
Top |
Vaccine Design for the FusionNeoAntigens of PNPLA8-CFTR |
mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is. |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
PNPLA8-CFTR | chr7 | 108128203 | chr7 | 117282492 | 4 | 14 | YALGNDLHQV | TATGCATTGGGAAATGATCTTCATCAAGTG |
PNPLA8-CFTR | chr7 | 108128203 | chr7 | 117282492 | 5 | 14 | ALGNDLHQV | GCATTGGGAAATGATCTTCATCAAGTG |
PNPLA8-CFTR | chr7 | 108128203 | chr7 | 117282492 | 7 | 16 | GNDLHQVGL | GGAAATGATCTTCATCAAGTGGGCCTC |
PNPLA8-CFTR | chr7 | 108128203 | chr7 | 117282492 | 9 | 19 | DLHQVGLLGR | GATCTTCATCAAGTGGGCCTCTTGGGAAGA |
mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs. |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of PNPLA8-CFTR |
These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens. |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
LIHC | PNPLA8-CFTR | chr7 | 108128203 | ENST00000422087 | chr7 | 117282492 | ENST00000003084 | TCGA-RC-A6M6-01A |
Top |
Potential target of CAR-T therapy development for PNPLA8-CFTR |
Predicted 3D structure. We used RoseTTAFold. |
Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
Hgene | PNPLA8 | chr7:108128203 | chr7:117282492 | ENST00000257694 | - | 9 | 11 | 475_495 | 626 | 783.0 | Transmembrane | Helical |
Hgene | PNPLA8 | chr7:108128203 | chr7:117282492 | ENST00000422087 | - | 10 | 12 | 475_495 | 626 | 783.0 | Transmembrane | Helical |
Hgene | PNPLA8 | chr7:108128203 | chr7:117282492 | ENST00000436062 | - | 8 | 10 | 475_495 | 626 | 783.0 | Transmembrane | Helical |
Hgene | PNPLA8 | chr7:108128203 | chr7:117282492 | ENST00000453144 | - | 8 | 10 | 475_495 | 526 | 683.0 | Transmembrane | Helical |
Subcellular localization prediction of the transmembrane domain retained fusion proteins * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to PNPLA8-CFTR |
Drugs used for this fusion-positive patient. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to PNPLA8-CFTR |
Diseases that have this fusion gene. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
Diseases associated with fusion partners. (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |