Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:POLB-ASH2L

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: POLB-ASH2L
	FusionPDB ID: 66887
	FusionGDB2.0 ID: 66887
		Hgene	Tgene
	Gene symbol	POLB	ASH2L
	Gene ID	11232	9070
	Gene name	DNA polymerase gamma 2, accessory subunit	ASH2 like, histone lysine methyltransferase complex subunit
	Synonyms	HP55\|MTDPS16\|MTPOLB\|PEOA4\|POLB\|POLG-BETA\|POLGB	ASH2\|ASH2L1\|ASH2L2\|Bre2
	Cytomap	17q23.3	8p11.23
	Type of gene	protein-coding	protein-coding
	Description	DNA polymerase subunit gamma-2, mitochondrialDNA polymerase gamma accessory 55 kDa subunitmitochondrial DNA polymerase subunit gamma-2mitochondrial DNA polymerase, accessory subunitp55polymerase (DNA directed), gamma 2, accessory subunitpolymerase (	set1/Ash2 histone methyltransferase complex subunit ASH2ASH2-like proteinash2 (absent, small, or homeotic)-like
	Modification date	20200313	20200313
	UniProtAcc	.	Q9UBL3 Main function of 5'-partner protein: FUNCTION: Transcriptional regulator (PubMed:12670868). Component or associated component of some histone methyltransferase complexes which regulates transcription through recruitment of those complexes to gene promoters (PubMed:19131338). Component of the Set1/Ash2 histone methyltransferase (HMT) complex, a complex that specifically methylates 'Lys-4' of histone H3, but not if the neighboring 'Lys-9' residue is already methylated (PubMed:19556245). As part of the MLL1/MLL complex it is involved in methylation and dimethylation at 'Lys-4' of histone H3 (PubMed:19556245). May play a role in hematopoiesis (PubMed:12670868). In association with RBBP5 and WDR5, stimulates the histone methyltransferase activities of KMT2A, KMT2B, KMT2C, KMT2D, SETD1A and SETD1B (PubMed:21220120, PubMed:22266653). {ECO:0000269\|PubMed:12670868, ECO:0000269\|PubMed:19131338, ECO:0000269\|PubMed:19556245, ECO:0000269\|PubMed:21220120, ECO:0000269\|PubMed:22266653}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000265421, ENST00000521492, ENST00000538005, ENST00000530566,	ENST00000524263, ENST00000250635, ENST00000343823, ENST00000428278, ENST00000521652, ENST00000545394,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	6 X 3 X 4=72	9 X 9 X 6=486
	# samples	8	9
	** MAII score	log2(8/72*10)=0.15200309344505 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0	log2(9/486*10)=-2.43295940727611 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: POLB [Title/Abstract] AND ASH2L [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: POLB [Title/Abstract] AND ASH2L [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	POLB(42227506)-ASH2L(37976788), # samples:1 POLB(42227506)-ASH2L(37976787), # samples:1
Anticipated loss of major functional domain due to fusion event.	POLB-ASH2L seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. POLB-ASH2L seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. POLB-ASH2L seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. POLB-ASH2L seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	POLB	GO:0006261	DNA-dependent DNA replication	10608893\|15167897\|19837034\|19858216\|26123486\|26446790\|28430993
Hgene	POLB	GO:1900264	positive regulation of DNA-directed DNA polymerase activity	10608893\|19837034\|19858216\|26123486
Tgene	ASH2L	GO:0006974	cellular response to DNA damage stimulus	17500065
Tgene	ASH2L	GO:0043627	response to estrogen	16603732
Tgene	ASH2L	GO:0051568	histone H3-K4 methylation	17355966\|19556245

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr8:42227506/chr8:37976788)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across POLB (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across ASH2L (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000265421	POLB	chr8	42227506	+	ENST00000343823	ASH2L	chr8	37976788	+	3011	1083	170	2116	648
ENST00000265421	POLB	chr8	42227506	+	ENST00000250635	ASH2L	chr8	37976788	+	2654	1083	170	2017	615
ENST00000265421	POLB	chr8	42227506	+	ENST00000545394	ASH2L	chr8	37976788	+	2569	1083	170	2116	648
ENST00000265421	POLB	chr8	42227506	+	ENST00000428278	ASH2L	chr8	37976788	+	2749	1083	170	2116	648
ENST00000265421	POLB	chr8	42227506	+	ENST00000521652	ASH2L	chr8	37976788	+	2650	1083	170	2017	615
ENST00000538005	POLB	chr8	42227506	+	ENST00000343823	ASH2L	chr8	37976788	+	2730	802	282	1835	517
ENST00000538005	POLB	chr8	42227506	+	ENST00000250635	ASH2L	chr8	37976788	+	2373	802	282	1736	484
ENST00000538005	POLB	chr8	42227506	+	ENST00000545394	ASH2L	chr8	37976788	+	2288	802	282	1835	517
ENST00000538005	POLB	chr8	42227506	+	ENST00000428278	ASH2L	chr8	37976788	+	2468	802	282	1835	517
ENST00000538005	POLB	chr8	42227506	+	ENST00000521652	ASH2L	chr8	37976788	+	2369	802	282	1736	484
ENST00000521492	POLB	chr8	42227506	+	ENST00000343823	ASH2L	chr8	37976788	+	2468	540	401	1573	390
ENST00000521492	POLB	chr8	42227506	+	ENST00000250635	ASH2L	chr8	37976788	+	2111	540	401	1474	357
ENST00000521492	POLB	chr8	42227506	+	ENST00000545394	ASH2L	chr8	37976788	+	2026	540	401	1573	390
ENST00000521492	POLB	chr8	42227506	+	ENST00000428278	ASH2L	chr8	37976788	+	2206	540	401	1573	390
ENST00000521492	POLB	chr8	42227506	+	ENST00000521652	ASH2L	chr8	37976788	+	2107	540	401	1474	357
ENST00000265421	POLB	chr8	42227506	+	ENST00000343823	ASH2L	chr8	37976787	+	3011	1083	170	2116	648
ENST00000265421	POLB	chr8	42227506	+	ENST00000250635	ASH2L	chr8	37976787	+	2654	1083	170	2017	615
ENST00000265421	POLB	chr8	42227506	+	ENST00000545394	ASH2L	chr8	37976787	+	2569	1083	170	2116	648
ENST00000265421	POLB	chr8	42227506	+	ENST00000428278	ASH2L	chr8	37976787	+	2749	1083	170	2116	648
ENST00000265421	POLB	chr8	42227506	+	ENST00000521652	ASH2L	chr8	37976787	+	2650	1083	170	2017	615
ENST00000538005	POLB	chr8	42227506	+	ENST00000343823	ASH2L	chr8	37976787	+	2730	802	282	1835	517
ENST00000538005	POLB	chr8	42227506	+	ENST00000250635	ASH2L	chr8	37976787	+	2373	802	282	1736	484
ENST00000538005	POLB	chr8	42227506	+	ENST00000545394	ASH2L	chr8	37976787	+	2288	802	282	1835	517
ENST00000538005	POLB	chr8	42227506	+	ENST00000428278	ASH2L	chr8	37976787	+	2468	802	282	1835	517
ENST00000538005	POLB	chr8	42227506	+	ENST00000521652	ASH2L	chr8	37976787	+	2369	802	282	1736	484
ENST00000521492	POLB	chr8	42227506	+	ENST00000343823	ASH2L	chr8	37976787	+	2468	540	401	1573	390
ENST00000521492	POLB	chr8	42227506	+	ENST00000250635	ASH2L	chr8	37976787	+	2111	540	401	1474	357
ENST00000521492	POLB	chr8	42227506	+	ENST00000545394	ASH2L	chr8	37976787	+	2026	540	401	1573	390
ENST00000521492	POLB	chr8	42227506	+	ENST00000428278	ASH2L	chr8	37976787	+	2206	540	401	1573	390
ENST00000521492	POLB	chr8	42227506	+	ENST00000521652	ASH2L	chr8	37976787	+	2107	540	401	1474	357

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000265421	ENST00000343823	POLB	chr8	42227506	+	ASH2L	chr8	37976788	+	0.000382843	0.9996171
ENST00000265421	ENST00000250635	POLB	chr8	42227506	+	ASH2L	chr8	37976788	+	0.00044079	0.9995592
ENST00000265421	ENST00000545394	POLB	chr8	42227506	+	ASH2L	chr8	37976788	+	0.000527799	0.9994722
ENST00000265421	ENST00000428278	POLB	chr8	42227506	+	ASH2L	chr8	37976788	+	0.000401775	0.9995982
ENST00000265421	ENST00000521652	POLB	chr8	42227506	+	ASH2L	chr8	37976788	+	0.000464241	0.9995358
ENST00000538005	ENST00000343823	POLB	chr8	42227506	+	ASH2L	chr8	37976788	+	0.000352984	0.999647
ENST00000538005	ENST00000250635	POLB	chr8	42227506	+	ASH2L	chr8	37976788	+	0.000482822	0.9995172
ENST00000538005	ENST00000545394	POLB	chr8	42227506	+	ASH2L	chr8	37976788	+	0.000480956	0.9995191
ENST00000538005	ENST00000428278	POLB	chr8	42227506	+	ASH2L	chr8	37976788	+	0.000376088	0.9996239
ENST00000538005	ENST00000521652	POLB	chr8	42227506	+	ASH2L	chr8	37976788	+	0.00050387	0.9994961
ENST00000521492	ENST00000343823	POLB	chr8	42227506	+	ASH2L	chr8	37976788	+	0.000148997	0.999851
ENST00000521492	ENST00000250635	POLB	chr8	42227506	+	ASH2L	chr8	37976788	+	0.000247382	0.9997526
ENST00000521492	ENST00000545394	POLB	chr8	42227506	+	ASH2L	chr8	37976788	+	0.000186657	0.9998134
ENST00000521492	ENST00000428278	POLB	chr8	42227506	+	ASH2L	chr8	37976788	+	0.000142784	0.9998572
ENST00000521492	ENST00000521652	POLB	chr8	42227506	+	ASH2L	chr8	37976788	+	0.00025747	0.99974257
ENST00000265421	ENST00000343823	POLB	chr8	42227506	+	ASH2L	chr8	37976787	+	0.000382843	0.9996171
ENST00000265421	ENST00000250635	POLB	chr8	42227506	+	ASH2L	chr8	37976787	+	0.00044079	0.9995592
ENST00000265421	ENST00000545394	POLB	chr8	42227506	+	ASH2L	chr8	37976787	+	0.000527799	0.9994722
ENST00000265421	ENST00000428278	POLB	chr8	42227506	+	ASH2L	chr8	37976787	+	0.000401775	0.9995982
ENST00000265421	ENST00000521652	POLB	chr8	42227506	+	ASH2L	chr8	37976787	+	0.000464241	0.9995358
ENST00000538005	ENST00000343823	POLB	chr8	42227506	+	ASH2L	chr8	37976787	+	0.000352984	0.999647
ENST00000538005	ENST00000250635	POLB	chr8	42227506	+	ASH2L	chr8	37976787	+	0.000482822	0.9995172
ENST00000538005	ENST00000545394	POLB	chr8	42227506	+	ASH2L	chr8	37976787	+	0.000480956	0.9995191
ENST00000538005	ENST00000428278	POLB	chr8	42227506	+	ASH2L	chr8	37976787	+	0.000376088	0.9996239
ENST00000538005	ENST00000521652	POLB	chr8	42227506	+	ASH2L	chr8	37976787	+	0.00050387	0.9994961
ENST00000521492	ENST00000343823	POLB	chr8	42227506	+	ASH2L	chr8	37976787	+	0.000148997	0.999851
ENST00000521492	ENST00000250635	POLB	chr8	42227506	+	ASH2L	chr8	37976787	+	0.000247382	0.9997526
ENST00000521492	ENST00000545394	POLB	chr8	42227506	+	ASH2L	chr8	37976787	+	0.000186657	0.9998134
ENST00000521492	ENST00000428278	POLB	chr8	42227506	+	ASH2L	chr8	37976787	+	0.000142784	0.9998572
ENST00000521492	ENST00000521652	POLB	chr8	42227506	+	ASH2L	chr8	37976787	+	0.00025747	0.99974257

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for POLB-ASH2L

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
POLB	chr8	42227506	ASH2L	chr8	37976787	1083	304	TINEYTIRPLGVTGGIAAGSSGKGRG
POLB	chr8	42227506	ASH2L	chr8	37976787	540	46	TINEYTIRPLGVTGGIAAGSSGKGRG
POLB	chr8	42227506	ASH2L	chr8	37976787	802	173	TINEYTIRPLGVTGGIAAGSSGKGRG
POLB	chr8	42227506	ASH2L	chr8	37976788	1083	304	TINEYTIRPLGVTGGIAAGSSGKGRG
POLB	chr8	42227506	ASH2L	chr8	37976788	540	46	TINEYTIRPLGVTGGIAAGSSGKGRG
POLB	chr8	42227506	ASH2L	chr8	37976788	802	173	TINEYTIRPLGVTGGIAAGSSGKGRG

Top

Potential FusionNeoAntigen Information of POLB-ASH2L in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

POLB-ASH2L_42227506_37976787.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
POLB-ASH2L	chr8	42227506	chr8	37976787	1083	HLA-B55:01	RPLGVTGGIA	0.9212	0.5442	7	17
POLB-ASH2L	chr8	42227506	chr8	37976787	1083	HLA-B56:01	RPLGVTGGIA	0.8878	0.6283	7	17
POLB-ASH2L	chr8	42227506	chr8	37976787	1083	HLA-B55:01	RPLGVTGGIAA	0.9927	0.7145	7	18
POLB-ASH2L	chr8	42227506	chr8	37976787	1083	HLA-B56:01	RPLGVTGGIAA	0.9886	0.7529	7	18
POLB-ASH2L	chr8	42227506	chr8	37976787	1083	HLA-B54:01	RPLGVTGGIAA	0.9963	0.8841	7	18
POLB-ASH2L	chr8	42227506	chr8	37976787	1083	HLA-B67:01	RPLGVTGGI	0.3057	0.7261	7	16
POLB-ASH2L	chr8	42227506	chr8	37976787	1083	HLA-B55:02	RPLGVTGGIA	0.9078	0.637	7	17
POLB-ASH2L	chr8	42227506	chr8	37976787	1083	HLA-B55:02	RPLGVTGGIAA	0.9926	0.7853	7	18
POLB-ASH2L	chr8	42227506	chr8	37976787	1083	HLA-B56:05	RPLGVTGGIAA	0.9098	0.687	7	18

Top

Potential FusionNeoAntigen Information of POLB-ASH2L in HLA II

POLB-ASH2L_42227506_37976787.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
POLB-ASH2L	chr8	42227506	chr8	37976787	1083	DRB1-0415	EYTIRPLGVTGGIAA	3	18
POLB-ASH2L	chr8	42227506	chr8	37976787	1083	DRB1-0415	NEYTIRPLGVTGGIA	2	17
POLB-ASH2L	chr8	42227506	chr8	37976787	1083	DRB1-0436	EYTIRPLGVTGGIAA	3	18
POLB-ASH2L	chr8	42227506	chr8	37976787	1083	DRB1-0436	NEYTIRPLGVTGGIA	2	17
POLB-ASH2L	chr8	42227506	chr8	37976787	1083	DRB1-0453	EYTIRPLGVTGGIAA	3	18
POLB-ASH2L	chr8	42227506	chr8	37976787	1083	DRB1-0458	EYTIRPLGVTGGIAA	3	18

Top

Fusion breakpoint peptide structures of POLB-ASH2L

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
3953	IRPLGVTGGIAAGS	POLB	ASH2L	chr8	42227506	chr8	37976787	1083

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of POLB-ASH2L

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	3953	IRPLGVTGGIAAGS	-7.75776	-7.86956
HLA-B14:02	3BVN	3953	IRPLGVTGGIAAGS	-4.52646	-5.56956
HLA-B52:01	3W39	3953	IRPLGVTGGIAAGS	-7.1873	-7.2991
HLA-B52:01	3W39	3953	IRPLGVTGGIAAGS	-2.81174	-3.85484
HLA-A11:01	4UQ2	3953	IRPLGVTGGIAAGS	-5.13576	-5.24756
HLA-A24:02	5HGA	3953	IRPLGVTGGIAAGS	-8.42076	-8.53256
HLA-A24:02	5HGA	3953	IRPLGVTGGIAAGS	-7.10496	-8.14806
HLA-B27:05	6PYJ	3953	IRPLGVTGGIAAGS	-9.28296	-9.39476
HLA-B44:05	3DX8	3953	IRPLGVTGGIAAGS	-6.88262	-6.99442
HLA-B44:05	3DX8	3953	IRPLGVTGGIAAGS	-5.46822	-6.51132

Top

Vaccine Design for the FusionNeoAntigens of POLB-ASH2L

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
POLB-ASH2L	chr8	42227506	chr8	37976787	7	16	RPLGVTGGI	GTCCCTTGGGAGTCACTGGGGGAATTG
POLB-ASH2L	chr8	42227506	chr8	37976787	7	17	RPLGVTGGIA	GTCCCTTGGGAGTCACTGGGGGAATTGCAG
POLB-ASH2L	chr8	42227506	chr8	37976787	7	18	RPLGVTGGIAA	GTCCCTTGGGAGTCACTGGGGGAATTGCAGCAG

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
POLB-ASH2L	chr8	42227506	chr8	37976787	2	17	NEYTIRPLGVTGGIA	ATGAGTACACCATCCGTCCCTTGGGAGTCACTGGGGGAATTGCAG
POLB-ASH2L	chr8	42227506	chr8	37976787	3	18	EYTIRPLGVTGGIAA	AGTACACCATCCGTCCCTTGGGAGTCACTGGGGGAATTGCAGCAG

Top

Information of the samples that have these potential fusion neoantigens of POLB-ASH2L

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
OV	POLB-ASH2L	chr8	42227506	ENST00000265421	chr8	37976787	ENST00000250635	TCGA-WR-A838

Top

Potential target of CAR-T therapy development for POLB-ASH2L

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to POLB-ASH2L

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to POLB-ASH2L

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)