Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:PPP1CB-BRE

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: PPP1CB-BRE
	FusionPDB ID: 67700
	FusionGDB2.0 ID: 67700
		Hgene	Tgene
	Gene symbol	PPP1CB	BRE
	Gene ID	5500	9577
	Gene name	protein phosphatase 1 catalytic subunit beta	BRISC and BRCA1 A complex member 2
	Synonyms	HEL-S-80p\|MP\|NSLH2\|PP-1B\|PP1B\|PP1beta\|PP1c\|PPP1CD\|PPP1beta	BRCC4\|BRCC45\|BRE
	Cytomap	2p23.2	2p23.2
	Type of gene	protein-coding	protein-coding
	Description	serine/threonine-protein phosphatase PP1-beta catalytic subunitepididymis secretory sperm binding protein Li 80pmyosin phosphataseprotein phosphatase 1, catalytic subunit, beta isoformprotein phosphatase 1, catalytic subunit, beta isozymeprotein phos	BRISC and BRCA1-A complex member 2BRCA1-A complex subunit BREBRCA1/BRCA2-containing complex subunit 45BRCA1/BRCA2-containing complex, subunit 4brain and reproductive organ-expressed (TNFRSF1A modulator)brain and reproductive organ-expressed protein
	Modification date	20200313	20200313
	UniProtAcc	.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000296122, ENST00000358506, ENST00000395366,	ENST00000603461, ENST00000342045, ENST00000344773, ENST00000361704, ENST00000379624, ENST00000379632,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	18 X 17 X 11=3366	20 X 20 X 12=4800
	# samples	35	30
	** MAII score	log2(35/3366*10)=-3.26560834949762 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(30/4800*10)=-4 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: PPP1CB [Title/Abstract] AND BRE [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: PPP1CB [Title/Abstract] AND BRE [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	PPP1CB(28975042)-BRE(28521205), # samples:2 PPP1CB(28975042)-BRE(28152699), # samples:2
Anticipated loss of major functional domain due to fusion event.	PPP1CB-BRE seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. PPP1CB-BRE seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. PPP1CB-BRE seems lost the major protein functional domain in Hgene partner, which is a cell metabolism gene due to the frame-shifted ORF. PPP1CB-BRE seems lost the major protein functional domain in Tgene partner, which is a epigenetic factor due to the frame-shifted ORF. PPP1CB-BRE seems lost the major protein functional domain in Tgene partner, which is a essential gene due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	PPP1CB	GO:0030155	regulation of cell adhesion	20354225
Tgene	BRE	GO:0043066	negative regulation of apoptotic process	15465831

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr2:28975042/chr2:28521205)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across PPP1CB (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across BRE (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000358506	PPP1CB	chr2	28975042	+	ENST00000344773	BRE	chr2	28521204	+	992	212	46	525	159
ENST00000358506	PPP1CB	chr2	28975042	+	ENST00000379624	BRE	chr2	28521204	+	818	212	456	1	152
ENST00000358506	PPP1CB	chr2	28975042	+	ENST00000342045	BRE	chr2	28521204	+	818	212	456	1	152
ENST00000358506	PPP1CB	chr2	28975042	+	ENST00000379632	BRE	chr2	28521204	+	890	212	528	1	176
ENST00000358506	PPP1CB	chr2	28975042	+	ENST00000361704	BRE	chr2	28521204	+	890	212	528	1	176
ENST00000296122	PPP1CB	chr2	28975042	+	ENST00000344773	BRE	chr2	28521204	+	1030	250	54	563	169
ENST00000296122	PPP1CB	chr2	28975042	+	ENST00000379624	BRE	chr2	28521204	+	856	250	54	467	137
ENST00000296122	PPP1CB	chr2	28975042	+	ENST00000342045	BRE	chr2	28521204	+	856	250	54	467	137
ENST00000296122	PPP1CB	chr2	28975042	+	ENST00000379632	BRE	chr2	28521204	+	928	250	566	102	154
ENST00000296122	PPP1CB	chr2	28975042	+	ENST00000361704	BRE	chr2	28521204	+	928	250	566	102	154
ENST00000395366	PPP1CB	chr2	28975042	+	ENST00000344773	BRE	chr2	28521204	+	1104	324	571	59	170
ENST00000395366	PPP1CB	chr2	28975042	+	ENST00000379624	BRE	chr2	28521204	+	930	324	568	59	169
ENST00000395366	PPP1CB	chr2	28975042	+	ENST00000342045	BRE	chr2	28521204	+	930	324	568	59	169
ENST00000395366	PPP1CB	chr2	28975042	+	ENST00000379632	BRE	chr2	28521204	+	1002	324	640	59	193
ENST00000395366	PPP1CB	chr2	28975042	+	ENST00000361704	BRE	chr2	28521204	+	1002	324	640	59	193
ENST00000358506	PPP1CB	chr2	28975042	+	ENST00000344773	BRE	chr2	28521205	+	992	212	46	525	159
ENST00000358506	PPP1CB	chr2	28975042	+	ENST00000379624	BRE	chr2	28521205	+	818	212	456	1	152
ENST00000358506	PPP1CB	chr2	28975042	+	ENST00000342045	BRE	chr2	28521205	+	818	212	456	1	152
ENST00000358506	PPP1CB	chr2	28975042	+	ENST00000379632	BRE	chr2	28521205	+	890	212	528	1	176
ENST00000358506	PPP1CB	chr2	28975042	+	ENST00000361704	BRE	chr2	28521205	+	890	212	528	1	176
ENST00000296122	PPP1CB	chr2	28975042	+	ENST00000344773	BRE	chr2	28521205	+	1030	250	54	563	169
ENST00000296122	PPP1CB	chr2	28975042	+	ENST00000379624	BRE	chr2	28521205	+	856	250	54	467	137
ENST00000296122	PPP1CB	chr2	28975042	+	ENST00000342045	BRE	chr2	28521205	+	856	250	54	467	137
ENST00000296122	PPP1CB	chr2	28975042	+	ENST00000379632	BRE	chr2	28521205	+	928	250	566	102	154
ENST00000296122	PPP1CB	chr2	28975042	+	ENST00000361704	BRE	chr2	28521205	+	928	250	566	102	154
ENST00000395366	PPP1CB	chr2	28975042	+	ENST00000344773	BRE	chr2	28521205	+	1104	324	571	59	170
ENST00000395366	PPP1CB	chr2	28975042	+	ENST00000379624	BRE	chr2	28521205	+	930	324	568	59	169
ENST00000395366	PPP1CB	chr2	28975042	+	ENST00000342045	BRE	chr2	28521205	+	930	324	568	59	169
ENST00000395366	PPP1CB	chr2	28975042	+	ENST00000379632	BRE	chr2	28521205	+	1002	324	640	59	193
ENST00000395366	PPP1CB	chr2	28975042	+	ENST00000361704	BRE	chr2	28521205	+	1002	324	640	59	193
ENST00000358506	PPP1CB	chr2	28975041	+	ENST00000344773	BRE	chr2	28521204	+	992	212	46	525	159
ENST00000358506	PPP1CB	chr2	28975041	+	ENST00000379624	BRE	chr2	28521204	+	818	212	456	1	152
ENST00000358506	PPP1CB	chr2	28975041	+	ENST00000342045	BRE	chr2	28521204	+	818	212	456	1	152
ENST00000358506	PPP1CB	chr2	28975041	+	ENST00000379632	BRE	chr2	28521204	+	890	212	528	1	176
ENST00000358506	PPP1CB	chr2	28975041	+	ENST00000361704	BRE	chr2	28521204	+	890	212	528	1	176
ENST00000296122	PPP1CB	chr2	28975041	+	ENST00000344773	BRE	chr2	28521204	+	1030	250	54	563	169
ENST00000296122	PPP1CB	chr2	28975041	+	ENST00000379624	BRE	chr2	28521204	+	856	250	54	467	137
ENST00000296122	PPP1CB	chr2	28975041	+	ENST00000342045	BRE	chr2	28521204	+	856	250	54	467	137
ENST00000296122	PPP1CB	chr2	28975041	+	ENST00000379632	BRE	chr2	28521204	+	928	250	566	102	154
ENST00000296122	PPP1CB	chr2	28975041	+	ENST00000361704	BRE	chr2	28521204	+	928	250	566	102	154
ENST00000395366	PPP1CB	chr2	28975041	+	ENST00000344773	BRE	chr2	28521204	+	1104	324	571	59	170
ENST00000395366	PPP1CB	chr2	28975041	+	ENST00000379624	BRE	chr2	28521204	+	930	324	568	59	169
ENST00000395366	PPP1CB	chr2	28975041	+	ENST00000342045	BRE	chr2	28521204	+	930	324	568	59	169
ENST00000395366	PPP1CB	chr2	28975041	+	ENST00000379632	BRE	chr2	28521204	+	1002	324	640	59	193
ENST00000395366	PPP1CB	chr2	28975041	+	ENST00000361704	BRE	chr2	28521204	+	1002	324	640	59	193

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000358506	ENST00000344773	PPP1CB	chr2	28975042	+	BRE	chr2	28521204	+	0.58829516	0.4117048
ENST00000358506	ENST00000379624	PPP1CB	chr2	28975042	+	BRE	chr2	28521204	+	0.09699141	0.9030085
ENST00000358506	ENST00000342045	PPP1CB	chr2	28975042	+	BRE	chr2	28521204	+	0.09699141	0.9030085
ENST00000358506	ENST00000379632	PPP1CB	chr2	28975042	+	BRE	chr2	28521204	+	0.107874416	0.8921256
ENST00000358506	ENST00000361704	PPP1CB	chr2	28975042	+	BRE	chr2	28521204	+	0.107874416	0.8921256
ENST00000296122	ENST00000344773	PPP1CB	chr2	28975042	+	BRE	chr2	28521204	+	0.68673253	0.31326744
ENST00000296122	ENST00000379624	PPP1CB	chr2	28975042	+	BRE	chr2	28521204	+	0.114814736	0.8851853
ENST00000296122	ENST00000342045	PPP1CB	chr2	28975042	+	BRE	chr2	28521204	+	0.114814736	0.8851853
ENST00000296122	ENST00000379632	PPP1CB	chr2	28975042	+	BRE	chr2	28521204	+	0.09105005	0.9089499
ENST00000296122	ENST00000361704	PPP1CB	chr2	28975042	+	BRE	chr2	28521204	+	0.09105005	0.9089499
ENST00000395366	ENST00000344773	PPP1CB	chr2	28975042	+	BRE	chr2	28521204	+	0.72574085	0.2742591
ENST00000395366	ENST00000379624	PPP1CB	chr2	28975042	+	BRE	chr2	28521204	+	0.15439054	0.8456094
ENST00000395366	ENST00000342045	PPP1CB	chr2	28975042	+	BRE	chr2	28521204	+	0.15439054	0.8456094
ENST00000395366	ENST00000379632	PPP1CB	chr2	28975042	+	BRE	chr2	28521204	+	0.18250781	0.8174922
ENST00000395366	ENST00000361704	PPP1CB	chr2	28975042	+	BRE	chr2	28521204	+	0.18250781	0.8174922
ENST00000358506	ENST00000344773	PPP1CB	chr2	28975042	+	BRE	chr2	28521205	+	0.58829516	0.4117048
ENST00000358506	ENST00000379624	PPP1CB	chr2	28975042	+	BRE	chr2	28521205	+	0.09699141	0.9030085
ENST00000358506	ENST00000342045	PPP1CB	chr2	28975042	+	BRE	chr2	28521205	+	0.09699141	0.9030085
ENST00000358506	ENST00000379632	PPP1CB	chr2	28975042	+	BRE	chr2	28521205	+	0.107874416	0.8921256
ENST00000358506	ENST00000361704	PPP1CB	chr2	28975042	+	BRE	chr2	28521205	+	0.107874416	0.8921256
ENST00000296122	ENST00000344773	PPP1CB	chr2	28975042	+	BRE	chr2	28521205	+	0.68673253	0.31326744
ENST00000296122	ENST00000379624	PPP1CB	chr2	28975042	+	BRE	chr2	28521205	+	0.114814736	0.8851853
ENST00000296122	ENST00000342045	PPP1CB	chr2	28975042	+	BRE	chr2	28521205	+	0.114814736	0.8851853
ENST00000296122	ENST00000379632	PPP1CB	chr2	28975042	+	BRE	chr2	28521205	+	0.09105005	0.9089499
ENST00000296122	ENST00000361704	PPP1CB	chr2	28975042	+	BRE	chr2	28521205	+	0.09105005	0.9089499
ENST00000395366	ENST00000344773	PPP1CB	chr2	28975042	+	BRE	chr2	28521205	+	0.72574085	0.2742591
ENST00000395366	ENST00000379624	PPP1CB	chr2	28975042	+	BRE	chr2	28521205	+	0.15439054	0.8456094
ENST00000395366	ENST00000342045	PPP1CB	chr2	28975042	+	BRE	chr2	28521205	+	0.15439054	0.8456094
ENST00000395366	ENST00000379632	PPP1CB	chr2	28975042	+	BRE	chr2	28521205	+	0.18250781	0.8174922
ENST00000395366	ENST00000361704	PPP1CB	chr2	28975042	+	BRE	chr2	28521205	+	0.18250781	0.8174922
ENST00000358506	ENST00000344773	PPP1CB	chr2	28975041	+	BRE	chr2	28521204	+	0.58829516	0.4117048
ENST00000358506	ENST00000379624	PPP1CB	chr2	28975041	+	BRE	chr2	28521204	+	0.09699141	0.9030085
ENST00000358506	ENST00000342045	PPP1CB	chr2	28975041	+	BRE	chr2	28521204	+	0.09699141	0.9030085
ENST00000358506	ENST00000379632	PPP1CB	chr2	28975041	+	BRE	chr2	28521204	+	0.107874416	0.8921256
ENST00000358506	ENST00000361704	PPP1CB	chr2	28975041	+	BRE	chr2	28521204	+	0.107874416	0.8921256
ENST00000296122	ENST00000344773	PPP1CB	chr2	28975041	+	BRE	chr2	28521204	+	0.68673253	0.31326744
ENST00000296122	ENST00000379624	PPP1CB	chr2	28975041	+	BRE	chr2	28521204	+	0.114814736	0.8851853
ENST00000296122	ENST00000342045	PPP1CB	chr2	28975041	+	BRE	chr2	28521204	+	0.114814736	0.8851853
ENST00000296122	ENST00000379632	PPP1CB	chr2	28975041	+	BRE	chr2	28521204	+	0.09105005	0.9089499
ENST00000296122	ENST00000361704	PPP1CB	chr2	28975041	+	BRE	chr2	28521204	+	0.09105005	0.9089499
ENST00000395366	ENST00000344773	PPP1CB	chr2	28975041	+	BRE	chr2	28521204	+	0.72574085	0.2742591
ENST00000395366	ENST00000379624	PPP1CB	chr2	28975041	+	BRE	chr2	28521204	+	0.15439054	0.8456094
ENST00000395366	ENST00000342045	PPP1CB	chr2	28975041	+	BRE	chr2	28521204	+	0.15439054	0.8456094
ENST00000395366	ENST00000379632	PPP1CB	chr2	28975041	+	BRE	chr2	28521204	+	0.18250781	0.8174922
ENST00000395366	ENST00000361704	PPP1CB	chr2	28975041	+	BRE	chr2	28521204	+	0.18250781	0.8174922

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for PPP1CB-BRE

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
PPP1CB	chr2	28975041	BRE	chr2	28521204	212	55	ELNVDSLITRLLEVDLPLFFPRDQPT
PPP1CB	chr2	28975041	BRE	chr2	28521204	250	65	ELNVDSLITRLLEVDLPLFFPRDQPT
PPP1CB	chr2	28975042	BRE	chr2	28521204	212	55	ELNVDSLITRLLEVDLPLFFPRDQPT
PPP1CB	chr2	28975042	BRE	chr2	28521204	250	65	ELNVDSLITRLLEVDLPLFFPRDQPT
PPP1CB	chr2	28975042	BRE	chr2	28521205	212	55	ELNVDSLITRLLEVDLPLFFPRDQPT
PPP1CB	chr2	28975042	BRE	chr2	28521205	250	65	ELNVDSLITRLLEVDLPLFFPRDQPT

Top

Potential FusionNeoAntigen Information of PPP1CB-BRE in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

PPP1CB-BRE_28975041_28521204.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
PPP1CB-BRE	chr2	28975041	chr2	28521204	250	HLA-B18:01	LEVDLPLF	0.9971	0.9061	11	19
PPP1CB-BRE	chr2	28975041	chr2	28521204	250	HLA-A02:30	RLLEVDLPL	0.9975	0.6683	9	18
PPP1CB-BRE	chr2	28975041	chr2	28521204	250	HLA-A02:24	RLLEVDLPL	0.9975	0.6683	9	18
PPP1CB-BRE	chr2	28975041	chr2	28521204	250	HLA-A02:60	RLLEVDLPL	0.9975	0.6161	9	18
PPP1CB-BRE	chr2	28975041	chr2	28521204	250	HLA-A02:67	RLLEVDLPL	0.9975	0.6683	9	18
PPP1CB-BRE	chr2	28975041	chr2	28521204	250	HLA-A02:11	RLLEVDLPL	0.9973	0.697	9	18
PPP1CB-BRE	chr2	28975041	chr2	28521204	250	HLA-A02:16	RLLEVDLPL	0.9962	0.6008	9	18
PPP1CB-BRE	chr2	28975041	chr2	28521204	250	HLA-A02:22	RLLEVDLPL	0.996	0.6114	9	18
PPP1CB-BRE	chr2	28975041	chr2	28521204	250	HLA-A02:04	RLLEVDLPL	0.9959	0.5902	9	18
PPP1CB-BRE	chr2	28975041	chr2	28521204	250	HLA-A02:21	RLLEVDLPL	0.9959	0.7681	9	18
PPP1CB-BRE	chr2	28975041	chr2	28521204	250	HLA-A02:27	RLLEVDLPL	0.9954	0.6927	9	18
PPP1CB-BRE	chr2	28975041	chr2	28521204	250	HLA-A02:13	RLLEVDLPL	0.9939	0.7409	9	18
PPP1CB-BRE	chr2	28975041	chr2	28521204	250	HLA-B18:01	LEVDLPLFF	0.9931	0.8881	11	20
PPP1CB-BRE	chr2	28975041	chr2	28521204	250	HLA-B44:03	LEVDLPLFF	0.9898	0.9204	11	20
PPP1CB-BRE	chr2	28975041	chr2	28521204	250	HLA-B13:01	LEVDLPLFF	0.9897	0.7815	11	20
PPP1CB-BRE	chr2	28975041	chr2	28521204	250	HLA-A02:38	RLLEVDLPL	0.9873	0.7207	9	18
PPP1CB-BRE	chr2	28975041	chr2	28521204	250	HLA-A02:19	RLLEVDLPL	0.9811	0.582	9	18
PPP1CB-BRE	chr2	28975041	chr2	28521204	250	HLA-A02:35	RLLEVDLPL	0.9752	0.6928	9	18
PPP1CB-BRE	chr2	28975041	chr2	28521204	250	HLA-A02:29	RLLEVDLPL	0.9558	0.6689	9	18
PPP1CB-BRE	chr2	28975041	chr2	28521204	250	HLA-A02:20	RLLEVDLPL	0.9284	0.6716	9	18
PPP1CB-BRE	chr2	28975041	chr2	28521204	250	HLA-B13:01	RLLEVDLPL	0.2773	0.9848	9	18
PPP1CB-BRE	chr2	28975041	chr2	28521204	250	HLA-B13:02	RLLEVDLPL	0.2725	0.6529	9	18
PPP1CB-BRE	chr2	28975041	chr2	28521204	250	HLA-A32:13	RLLEVDLPLF	0.991	0.9534	9	19
PPP1CB-BRE	chr2	28975041	chr2	28521204	250	HLA-B13:01	RLLEVDLPLF	0.6823	0.9777	9	19
PPP1CB-BRE	chr2	28975041	chr2	28521204	250	HLA-B27:02	TRLLEVDLPLF	1	0.5756	8	19
PPP1CB-BRE	chr2	28975041	chr2	28521204	250	HLA-A32:13	RLLEVDLPLFF	0.994	0.9512	9	20
PPP1CB-BRE	chr2	28975041	chr2	28521204	250	HLA-B47:01	RLLEVDLPLFF	0.9332	0.6475	9	20
PPP1CB-BRE	chr2	28975041	chr2	28521204	250	HLA-B44:03	RLLEVDLPLFF	0.8666	0.9518	9	20
PPP1CB-BRE	chr2	28975041	chr2	28521204	250	HLA-B13:01	RLLEVDLPLFF	0.8242	0.9751	9	20
PPP1CB-BRE	chr2	28975041	chr2	28521204	250	HLA-A02:01	RLLEVDLPL	0.9975	0.6683	9	18
PPP1CB-BRE	chr2	28975041	chr2	28521204	250	HLA-A02:07	RLLEVDLPL	0.9974	0.6526	9	18
PPP1CB-BRE	chr2	28975041	chr2	28521204	250	HLA-B73:01	TRLLEVDLP	0.9578	0.6659	8	17
PPP1CB-BRE	chr2	28975041	chr2	28521204	250	HLA-B15:05	RLLEVDLPLF	0.893	0.8941	9	19
PPP1CB-BRE	chr2	28975041	chr2	28521204	250	HLA-C04:03	EVDLPLFF	0.9999	0.7176	12	20
PPP1CB-BRE	chr2	28975041	chr2	28521204	250	HLA-B18:06	LEVDLPLF	0.9976	0.9211	11	19
PPP1CB-BRE	chr2	28975041	chr2	28521204	250	HLA-B18:04	LEVDLPLF	0.9976	0.9198	11	19
PPP1CB-BRE	chr2	28975041	chr2	28521204	250	HLA-B18:08	LEVDLPLF	0.9976	0.8735	11	19
PPP1CB-BRE	chr2	28975041	chr2	28521204	250	HLA-B18:05	LEVDLPLF	0.9971	0.9061	11	19
PPP1CB-BRE	chr2	28975041	chr2	28521204	250	HLA-B18:03	LEVDLPLF	0.9966	0.9005	11	19
PPP1CB-BRE	chr2	28975041	chr2	28521204	250	HLA-B18:11	LEVDLPLF	0.9838	0.8562	11	19
PPP1CB-BRE	chr2	28975041	chr2	28521204	250	HLA-B18:04	LEVDLPLFF	0.9963	0.9038	11	20
PPP1CB-BRE	chr2	28975041	chr2	28521204	250	HLA-A02:14	RLLEVDLPL	0.996	0.6875	9	18
PPP1CB-BRE	chr2	28975041	chr2	28521204	250	HLA-A02:06	RLLEVDLPL	0.9959	0.7681	9	18
PPP1CB-BRE	chr2	28975041	chr2	28521204	250	HLA-B18:07	LEVDLPLFF	0.9948	0.8487	11	20
PPP1CB-BRE	chr2	28975041	chr2	28521204	250	HLA-B18:08	LEVDLPLFF	0.9939	0.8478	11	20
PPP1CB-BRE	chr2	28975041	chr2	28521204	250	HLA-B18:05	LEVDLPLFF	0.9931	0.8881	11	20
PPP1CB-BRE	chr2	28975041	chr2	28521204	250	HLA-B18:06	LEVDLPLFF	0.9926	0.9006	11	20
PPP1CB-BRE	chr2	28975041	chr2	28521204	250	HLA-B44:13	LEVDLPLFF	0.9898	0.9204	11	20
PPP1CB-BRE	chr2	28975041	chr2	28521204	250	HLA-B44:07	LEVDLPLFF	0.9898	0.9204	11	20
PPP1CB-BRE	chr2	28975041	chr2	28521204	250	HLA-B18:03	LEVDLPLFF	0.9898	0.8815	11	20
PPP1CB-BRE	chr2	28975041	chr2	28521204	250	HLA-B44:26	LEVDLPLFF	0.9898	0.9204	11	20
PPP1CB-BRE	chr2	28975041	chr2	28521204	250	HLA-B40:04	LEVDLPLFF	0.9869	0.6192	11	20
PPP1CB-BRE	chr2	28975041	chr2	28521204	250	HLA-A32:01	RLLEVDLPL	0.9731	0.9608	9	18
PPP1CB-BRE	chr2	28975041	chr2	28521204	250	HLA-B18:11	LEVDLPLFF	0.9321	0.8394	11	20
PPP1CB-BRE	chr2	28975041	chr2	28521204	250	HLA-B15:73	RLLEVDLPL	0.9113	0.8074	9	18
PPP1CB-BRE	chr2	28975041	chr2	28521204	250	HLA-B15:30	RLLEVDLPL	0.8098	0.9215	9	18
PPP1CB-BRE	chr2	28975041	chr2	28521204	250	HLA-B35:20	LEVDLPLFF	0.6756	0.8563	11	20
PPP1CB-BRE	chr2	28975041	chr2	28521204	250	HLA-B35:28	LEVDLPLFF	0.6713	0.8342	11	20
PPP1CB-BRE	chr2	28975041	chr2	28521204	250	HLA-B48:02	LEVDLPLFF	0.3626	0.8084	11	20
PPP1CB-BRE	chr2	28975041	chr2	28521204	250	HLA-B15:53	LEVDLPLFF	0.3054	0.7907	11	20
PPP1CB-BRE	chr2	28975041	chr2	28521204	250	HLA-B41:03	LEVDLPLFF	0.2652	0.5124	11	20
PPP1CB-BRE	chr2	28975041	chr2	28521204	250	HLA-A32:01	RLLEVDLPLF	0.9962	0.9572	9	19
PPP1CB-BRE	chr2	28975041	chr2	28521204	250	HLA-B15:20	RLLEVDLPLF	0.8965	0.946	9	19
PPP1CB-BRE	chr2	28975041	chr2	28521204	250	HLA-A32:01	RLLEVDLPLFF	0.9973	0.9585	9	20
PPP1CB-BRE	chr2	28975041	chr2	28521204	250	HLA-B44:07	RLLEVDLPLFF	0.8666	0.9518	9	20
PPP1CB-BRE	chr2	28975041	chr2	28521204	250	HLA-B44:26	RLLEVDLPLFF	0.8666	0.9518	9	20
PPP1CB-BRE	chr2	28975041	chr2	28521204	250	HLA-B44:13	RLLEVDLPLFF	0.8666	0.9518	9	20

Top

Potential FusionNeoAntigen Information of PPP1CB-BRE in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of PPP1CB-BRE

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
5132	LITRLLEVDLPLFF	PPP1CB	BRE	chr2	28975041	chr2	28521204	250

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of PPP1CB-BRE

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	5132	LITRLLEVDLPLFF	-7.9962	-8.1096
HLA-B14:02	3BVN	5132	LITRLLEVDLPLFF	-5.70842	-6.74372
HLA-B52:01	3W39	5132	LITRLLEVDLPLFF	-6.83737	-6.95077
HLA-B52:01	3W39	5132	LITRLLEVDLPLFF	-4.4836	-5.5189
HLA-A11:01	4UQ2	5132	LITRLLEVDLPLFF	-10.0067	-10.1201
HLA-A11:01	4UQ2	5132	LITRLLEVDLPLFF	-9.03915	-10.0745
HLA-A24:02	5HGA	5132	LITRLLEVDLPLFF	-6.56204	-6.67544
HLA-A24:02	5HGA	5132	LITRLLEVDLPLFF	-5.42271	-6.45801
HLA-B44:05	3DX8	5132	LITRLLEVDLPLFF	-7.85648	-8.89178
HLA-B44:05	3DX8	5132	LITRLLEVDLPLFF	-5.3978	-5.5112
HLA-A02:01	6TDR	5132	LITRLLEVDLPLFF	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of PPP1CB-BRE

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
PPP1CB-BRE	chr2	28975041	chr2	28521204	11	19	LEVDLPLF	TGGAGGTTGACCTGCCTCTGTTTT
PPP1CB-BRE	chr2	28975041	chr2	28521204	11	20	LEVDLPLFF	TGGAGGTTGACCTGCCTCTGTTTTTCC
PPP1CB-BRE	chr2	28975041	chr2	28521204	12	20	EVDLPLFF	AGGTTGACCTGCCTCTGTTTTTCC
PPP1CB-BRE	chr2	28975041	chr2	28521204	8	17	TRLLEVDLP	CCCGGCTGCTGGAGGTTGACCTGCCTC
PPP1CB-BRE	chr2	28975041	chr2	28521204	8	19	TRLLEVDLPLF	CCCGGCTGCTGGAGGTTGACCTGCCTCTGTTTT
PPP1CB-BRE	chr2	28975041	chr2	28521204	9	18	RLLEVDLPL	GGCTGCTGGAGGTTGACCTGCCTCTGT
PPP1CB-BRE	chr2	28975041	chr2	28521204	9	19	RLLEVDLPLF	GGCTGCTGGAGGTTGACCTGCCTCTGTTTT
PPP1CB-BRE	chr2	28975041	chr2	28521204	9	20	RLLEVDLPLFF	GGCTGCTGGAGGTTGACCTGCCTCTGTTTTTCC

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of PPP1CB-BRE

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
ACC	PPP1CB-BRE	chr2	28975041	ENST00000296122	chr2	28521204	ENST00000342045	TCGA-OR-A5KY-01A

Top

Potential target of CAR-T therapy development for PPP1CB-BRE

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to PPP1CB-BRE

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to PPP1CB-BRE

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)