Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:PRKAR1A-PITPNC1

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: PRKAR1A-PITPNC1
	FusionPDB ID: 68661
	FusionGDB2.0 ID: 68661
		Hgene	Tgene
	Gene symbol	PRKAR1A	PITPNC1
	Gene ID	5573	26207
	Gene name	protein kinase cAMP-dependent type I regulatory subunit alpha	phosphatidylinositol transfer protein cytoplasmic 1
	Synonyms	ACRDYS1\|ADOHR\|CAR\|CNC\|CNC1\|PKR1\|PPNAD1\|PRKAR1\|TSE1	M-RDGB-beta\|MRDGBbeta\|RDGB-BETA\|RDGBB\|RDGBB1
	Cytomap	17q24.2	17q24.2
	Type of gene	protein-coding	protein-coding
	Description	cAMP-dependent protein kinase type I-alpha regulatory subunitCarney complex type 1cAMP-dependent protein kinase regulatory subunit RIalphacAMP-dependent protein kinase type I-alpha regulatory chainepididymis secretory sperm binding proteinprotein kin	cytoplasmic phosphatidylinositol transfer protein 1M-rdgB betamammalian rdgB homolog betaretinal degeneration B beta 1retinal degeneration B homolog beta
	Modification date	20200329	20200313
	UniProtAcc	P10644 Main function of 5'-partner protein: FUNCTION: Regulatory subunit of the cAMP-dependent protein kinases involved in cAMP signaling in cells. {ECO:0000269\|PubMed:16491121, ECO:0000269\|PubMed:20215566, ECO:0000269\|PubMed:26405036}.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000358598, ENST00000392711, ENST00000536854, ENST00000586397, ENST00000588188, ENST00000589228,	ENST00000299954, ENST00000335257, ENST00000580974, ENST00000581322,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	15 X 15 X 8=1800	31 X 22 X 12=8184
	# samples	18	52
	** MAII score	log2(18/1800*10)=-3.32192809488736 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(52/8184*10)=-3.97622261671687 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: PRKAR1A [Title/Abstract] AND PITPNC1 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: PRKAR1A [Title/Abstract] AND PITPNC1 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	PRKAR1A(66511717)-PITPNC1(65528918), # samples:3
Anticipated loss of major functional domain due to fusion event.	PRKAR1A-PITPNC1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. PRKAR1A-PITPNC1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	PRKAR1A	GO:2000480	negative regulation of cAMP-dependent protein kinase activity	21812984
Tgene	PITPNC1	GO:0015914	phospholipid transport	22822086

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr17:66511717/chr17:65528918)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across PRKAR1A (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across PITPNC1 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000358598	PRKAR1A	chr17	66511717	+	ENST00000580974	PITPNC1	chr17	65528918	+	5732	294	117	1052	311
ENST00000358598	PRKAR1A	chr17	66511717	+	ENST00000299954	PITPNC1	chr17	65528918	+	2005	294	117	1052	311
ENST00000358598	PRKAR1A	chr17	66511717	+	ENST00000335257	PITPNC1	chr17	65528918	+	1886	294	117	1244	375
ENST00000358598	PRKAR1A	chr17	66511717	+	ENST00000581322	PITPNC1	chr17	65528918	+	1370	294	117	1244	375
ENST00000392711	PRKAR1A	chr17	66511717	+	ENST00000580974	PITPNC1	chr17	65528918	+	5799	361	184	1119	311
ENST00000392711	PRKAR1A	chr17	66511717	+	ENST00000299954	PITPNC1	chr17	65528918	+	2072	361	184	1119	311
ENST00000392711	PRKAR1A	chr17	66511717	+	ENST00000335257	PITPNC1	chr17	65528918	+	1953	361	184	1311	375
ENST00000392711	PRKAR1A	chr17	66511717	+	ENST00000581322	PITPNC1	chr17	65528918	+	1437	361	184	1311	375
ENST00000589228	PRKAR1A	chr17	66511717	+	ENST00000580974	PITPNC1	chr17	65528918	+	5743	305	56	1063	335
ENST00000589228	PRKAR1A	chr17	66511717	+	ENST00000299954	PITPNC1	chr17	65528918	+	2016	305	56	1063	335
ENST00000589228	PRKAR1A	chr17	66511717	+	ENST00000335257	PITPNC1	chr17	65528918	+	1897	305	56	1255	399
ENST00000589228	PRKAR1A	chr17	66511717	+	ENST00000581322	PITPNC1	chr17	65528918	+	1381	305	56	1255	399
ENST00000536854	PRKAR1A	chr17	66511717	+	ENST00000580974	PITPNC1	chr17	65528918	+	5853	415	205	1173	322
ENST00000536854	PRKAR1A	chr17	66511717	+	ENST00000299954	PITPNC1	chr17	65528918	+	2126	415	205	1173	322
ENST00000536854	PRKAR1A	chr17	66511717	+	ENST00000335257	PITPNC1	chr17	65528918	+	2007	415	205	1365	386
ENST00000536854	PRKAR1A	chr17	66511717	+	ENST00000581322	PITPNC1	chr17	65528918	+	1491	415	205	1365	386
ENST00000586397	PRKAR1A	chr17	66511717	+	ENST00000580974	PITPNC1	chr17	65528918	+	6194	756	528	1514	328
ENST00000586397	PRKAR1A	chr17	66511717	+	ENST00000299954	PITPNC1	chr17	65528918	+	2467	756	528	1514	328
ENST00000586397	PRKAR1A	chr17	66511717	+	ENST00000335257	PITPNC1	chr17	65528918	+	2348	756	528	1706	392
ENST00000586397	PRKAR1A	chr17	66511717	+	ENST00000581322	PITPNC1	chr17	65528918	+	1832	756	528	1706	392
ENST00000588188	PRKAR1A	chr17	66511717	+	ENST00000580974	PITPNC1	chr17	65528918	+	5615	177	0	935	311
ENST00000588188	PRKAR1A	chr17	66511717	+	ENST00000299954	PITPNC1	chr17	65528918	+	1888	177	0	935	311
ENST00000588188	PRKAR1A	chr17	66511717	+	ENST00000335257	PITPNC1	chr17	65528918	+	1769	177	0	1127	375
ENST00000588188	PRKAR1A	chr17	66511717	+	ENST00000581322	PITPNC1	chr17	65528918	+	1253	177	0	1127	375
ENST00000358598	PRKAR1A	chr17	66511717	+	ENST00000580974	PITPNC1	chr17	65528917	+	5732	294	117	1052	311
ENST00000358598	PRKAR1A	chr17	66511717	+	ENST00000299954	PITPNC1	chr17	65528917	+	2005	294	117	1052	311
ENST00000358598	PRKAR1A	chr17	66511717	+	ENST00000335257	PITPNC1	chr17	65528917	+	1886	294	117	1244	375
ENST00000358598	PRKAR1A	chr17	66511717	+	ENST00000581322	PITPNC1	chr17	65528917	+	1370	294	117	1244	375
ENST00000392711	PRKAR1A	chr17	66511717	+	ENST00000580974	PITPNC1	chr17	65528917	+	5799	361	184	1119	311
ENST00000392711	PRKAR1A	chr17	66511717	+	ENST00000299954	PITPNC1	chr17	65528917	+	2072	361	184	1119	311
ENST00000392711	PRKAR1A	chr17	66511717	+	ENST00000335257	PITPNC1	chr17	65528917	+	1953	361	184	1311	375
ENST00000392711	PRKAR1A	chr17	66511717	+	ENST00000581322	PITPNC1	chr17	65528917	+	1437	361	184	1311	375
ENST00000589228	PRKAR1A	chr17	66511717	+	ENST00000580974	PITPNC1	chr17	65528917	+	5743	305	56	1063	335
ENST00000589228	PRKAR1A	chr17	66511717	+	ENST00000299954	PITPNC1	chr17	65528917	+	2016	305	56	1063	335
ENST00000589228	PRKAR1A	chr17	66511717	+	ENST00000335257	PITPNC1	chr17	65528917	+	1897	305	56	1255	399
ENST00000589228	PRKAR1A	chr17	66511717	+	ENST00000581322	PITPNC1	chr17	65528917	+	1381	305	56	1255	399
ENST00000536854	PRKAR1A	chr17	66511717	+	ENST00000580974	PITPNC1	chr17	65528917	+	5853	415	205	1173	322
ENST00000536854	PRKAR1A	chr17	66511717	+	ENST00000299954	PITPNC1	chr17	65528917	+	2126	415	205	1173	322
ENST00000536854	PRKAR1A	chr17	66511717	+	ENST00000335257	PITPNC1	chr17	65528917	+	2007	415	205	1365	386
ENST00000536854	PRKAR1A	chr17	66511717	+	ENST00000581322	PITPNC1	chr17	65528917	+	1491	415	205	1365	386
ENST00000586397	PRKAR1A	chr17	66511717	+	ENST00000580974	PITPNC1	chr17	65528917	+	6194	756	528	1514	328
ENST00000586397	PRKAR1A	chr17	66511717	+	ENST00000299954	PITPNC1	chr17	65528917	+	2467	756	528	1514	328
ENST00000586397	PRKAR1A	chr17	66511717	+	ENST00000335257	PITPNC1	chr17	65528917	+	2348	756	528	1706	392
ENST00000586397	PRKAR1A	chr17	66511717	+	ENST00000581322	PITPNC1	chr17	65528917	+	1832	756	528	1706	392
ENST00000588188	PRKAR1A	chr17	66511717	+	ENST00000580974	PITPNC1	chr17	65528917	+	5615	177	0	935	311
ENST00000588188	PRKAR1A	chr17	66511717	+	ENST00000299954	PITPNC1	chr17	65528917	+	1888	177	0	935	311
ENST00000588188	PRKAR1A	chr17	66511717	+	ENST00000335257	PITPNC1	chr17	65528917	+	1769	177	0	1127	375
ENST00000588188	PRKAR1A	chr17	66511717	+	ENST00000581322	PITPNC1	chr17	65528917	+	1253	177	0	1127	375

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000358598	ENST00000580974	PRKAR1A	chr17	66511717	+	PITPNC1	chr17	65528918	+	0.000227795	0.99977225
ENST00000358598	ENST00000299954	PRKAR1A	chr17	66511717	+	PITPNC1	chr17	65528918	+	0.000662359	0.9993376
ENST00000358598	ENST00000335257	PRKAR1A	chr17	66511717	+	PITPNC1	chr17	65528918	+	0.000757863	0.9992422
ENST00000358598	ENST00000581322	PRKAR1A	chr17	66511717	+	PITPNC1	chr17	65528918	+	0.002277403	0.99772257
ENST00000392711	ENST00000580974	PRKAR1A	chr17	66511717	+	PITPNC1	chr17	65528918	+	0.000222564	0.9997775
ENST00000392711	ENST00000299954	PRKAR1A	chr17	66511717	+	PITPNC1	chr17	65528918	+	0.000843967	0.999156
ENST00000392711	ENST00000335257	PRKAR1A	chr17	66511717	+	PITPNC1	chr17	65528918	+	0.000901526	0.99909854
ENST00000392711	ENST00000581322	PRKAR1A	chr17	66511717	+	PITPNC1	chr17	65528918	+	0.002837088	0.9971629
ENST00000589228	ENST00000580974	PRKAR1A	chr17	66511717	+	PITPNC1	chr17	65528918	+	0.000217816	0.99978215
ENST00000589228	ENST00000299954	PRKAR1A	chr17	66511717	+	PITPNC1	chr17	65528918	+	0.000726997	0.999273
ENST00000589228	ENST00000335257	PRKAR1A	chr17	66511717	+	PITPNC1	chr17	65528918	+	0.000789451	0.9992105
ENST00000589228	ENST00000581322	PRKAR1A	chr17	66511717	+	PITPNC1	chr17	65528918	+	0.002634827	0.9973652
ENST00000536854	ENST00000580974	PRKAR1A	chr17	66511717	+	PITPNC1	chr17	65528918	+	0.000211775	0.9997882
ENST00000536854	ENST00000299954	PRKAR1A	chr17	66511717	+	PITPNC1	chr17	65528918	+	0.000668811	0.99933124
ENST00000536854	ENST00000335257	PRKAR1A	chr17	66511717	+	PITPNC1	chr17	65528918	+	0.000687316	0.99931264
ENST00000536854	ENST00000581322	PRKAR1A	chr17	66511717	+	PITPNC1	chr17	65528918	+	0.002013764	0.9979862
ENST00000586397	ENST00000580974	PRKAR1A	chr17	66511717	+	PITPNC1	chr17	65528918	+	0.000189276	0.99981076
ENST00000586397	ENST00000299954	PRKAR1A	chr17	66511717	+	PITPNC1	chr17	65528918	+	0.00027176	0.99972826
ENST00000586397	ENST00000335257	PRKAR1A	chr17	66511717	+	PITPNC1	chr17	65528918	+	0.000290951	0.99970907
ENST00000586397	ENST00000581322	PRKAR1A	chr17	66511717	+	PITPNC1	chr17	65528918	+	0.000412841	0.9995871
ENST00000588188	ENST00000580974	PRKAR1A	chr17	66511717	+	PITPNC1	chr17	65528918	+	0.000204897	0.99979514
ENST00000588188	ENST00000299954	PRKAR1A	chr17	66511717	+	PITPNC1	chr17	65528918	+	0.000502006	0.999498
ENST00000588188	ENST00000335257	PRKAR1A	chr17	66511717	+	PITPNC1	chr17	65528918	+	0.000523693	0.9994764
ENST00000588188	ENST00000581322	PRKAR1A	chr17	66511717	+	PITPNC1	chr17	65528918	+	0.001603788	0.9983962
ENST00000358598	ENST00000580974	PRKAR1A	chr17	66511717	+	PITPNC1	chr17	65528917	+	0.000227795	0.99977225
ENST00000358598	ENST00000299954	PRKAR1A	chr17	66511717	+	PITPNC1	chr17	65528917	+	0.000662359	0.9993376
ENST00000358598	ENST00000335257	PRKAR1A	chr17	66511717	+	PITPNC1	chr17	65528917	+	0.000757863	0.9992422
ENST00000358598	ENST00000581322	PRKAR1A	chr17	66511717	+	PITPNC1	chr17	65528917	+	0.002277403	0.99772257
ENST00000392711	ENST00000580974	PRKAR1A	chr17	66511717	+	PITPNC1	chr17	65528917	+	0.000222564	0.9997775
ENST00000392711	ENST00000299954	PRKAR1A	chr17	66511717	+	PITPNC1	chr17	65528917	+	0.000843967	0.999156
ENST00000392711	ENST00000335257	PRKAR1A	chr17	66511717	+	PITPNC1	chr17	65528917	+	0.000901526	0.99909854
ENST00000392711	ENST00000581322	PRKAR1A	chr17	66511717	+	PITPNC1	chr17	65528917	+	0.002837088	0.9971629
ENST00000589228	ENST00000580974	PRKAR1A	chr17	66511717	+	PITPNC1	chr17	65528917	+	0.000217816	0.99978215
ENST00000589228	ENST00000299954	PRKAR1A	chr17	66511717	+	PITPNC1	chr17	65528917	+	0.000726997	0.999273
ENST00000589228	ENST00000335257	PRKAR1A	chr17	66511717	+	PITPNC1	chr17	65528917	+	0.000789451	0.9992105
ENST00000589228	ENST00000581322	PRKAR1A	chr17	66511717	+	PITPNC1	chr17	65528917	+	0.002634827	0.9973652
ENST00000536854	ENST00000580974	PRKAR1A	chr17	66511717	+	PITPNC1	chr17	65528917	+	0.000211775	0.9997882
ENST00000536854	ENST00000299954	PRKAR1A	chr17	66511717	+	PITPNC1	chr17	65528917	+	0.000668811	0.99933124
ENST00000536854	ENST00000335257	PRKAR1A	chr17	66511717	+	PITPNC1	chr17	65528917	+	0.000687316	0.99931264
ENST00000536854	ENST00000581322	PRKAR1A	chr17	66511717	+	PITPNC1	chr17	65528917	+	0.002013764	0.9979862
ENST00000586397	ENST00000580974	PRKAR1A	chr17	66511717	+	PITPNC1	chr17	65528917	+	0.000189276	0.99981076
ENST00000586397	ENST00000299954	PRKAR1A	chr17	66511717	+	PITPNC1	chr17	65528917	+	0.00027176	0.99972826
ENST00000586397	ENST00000335257	PRKAR1A	chr17	66511717	+	PITPNC1	chr17	65528917	+	0.000290951	0.99970907
ENST00000586397	ENST00000581322	PRKAR1A	chr17	66511717	+	PITPNC1	chr17	65528917	+	0.000412841	0.9995871
ENST00000588188	ENST00000580974	PRKAR1A	chr17	66511717	+	PITPNC1	chr17	65528917	+	0.000204897	0.99979514
ENST00000588188	ENST00000299954	PRKAR1A	chr17	66511717	+	PITPNC1	chr17	65528917	+	0.000502006	0.999498
ENST00000588188	ENST00000335257	PRKAR1A	chr17	66511717	+	PITPNC1	chr17	65528917	+	0.000523693	0.9994764
ENST00000588188	ENST00000581322	PRKAR1A	chr17	66511717	+	PITPNC1	chr17	65528917	+	0.001603788	0.9983962

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for PRKAR1A-PITPNC1

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
PRKAR1A	chr17	66511717	PITPNC1	chr17	65528917	177	59	MAFLREYFERLEKYKIGQLYMISKHS
PRKAR1A	chr17	66511717	PITPNC1	chr17	65528917	294	59	MAFLREYFERLEKYKIGQLYMISKHS
PRKAR1A	chr17	66511717	PITPNC1	chr17	65528917	305	83	MAFLREYFERLEKYKIGQLYMISKHS
PRKAR1A	chr17	66511717	PITPNC1	chr17	65528917	361	59	MAFLREYFERLEKYKIGQLYMISKHS
PRKAR1A	chr17	66511717	PITPNC1	chr17	65528917	415	70	MAFLREYFERLEKYKIGQLYMISKHS
PRKAR1A	chr17	66511717	PITPNC1	chr17	65528917	756	76	MAFLREYFERLEKYKIGQLYMISKHS
PRKAR1A	chr17	66511717	PITPNC1	chr17	65528918	177	59	MAFLREYFERLEKYKIGQLYMISKHS
PRKAR1A	chr17	66511717	PITPNC1	chr17	65528918	294	59	MAFLREYFERLEKYKIGQLYMISKHS
PRKAR1A	chr17	66511717	PITPNC1	chr17	65528918	305	83	MAFLREYFERLEKYKIGQLYMISKHS
PRKAR1A	chr17	66511717	PITPNC1	chr17	65528918	361	59	MAFLREYFERLEKYKIGQLYMISKHS
PRKAR1A	chr17	66511717	PITPNC1	chr17	65528918	415	70	MAFLREYFERLEKYKIGQLYMISKHS
PRKAR1A	chr17	66511717	PITPNC1	chr17	65528918	756	76	MAFLREYFERLEKYKIGQLYMISKHS

Top

Potential FusionNeoAntigen Information of PRKAR1A-PITPNC1 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

PRKAR1A-PITPNC1_66511717_65528917.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	HLA-B15:18	EYFERLEKY	0.2417	0.5526	5	14
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	HLA-B44:03	REYFERLEKY	0.9995	0.889	4	14
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	HLA-B44:03	LEKYKIGQLY	0.978	0.595	10	20
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	HLA-B18:01	REYFERLEKY	0.9722	0.8932	4	14
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	HLA-B15:03	REYFERLEKY	0.929	0.7837	4	14
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	HLA-B18:01	LEKYKIGQLY	0.8941	0.5322	10	20
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	HLA-B15:01	RLEKYKIGQLY	0.9966	0.5618	9	20
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	HLA-B15:25	RLEKYKIGQLY	0.969	0.5229	9	20
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	HLA-B15:21	EYFERLEKY	0.6608	0.8101	5	14
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	HLA-C07:80	EYFERLEKY	0.5435	0.902	5	14
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	HLA-C07:67	EYFERLEKY	0.5435	0.902	5	14
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	HLA-C07:10	EYFERLEKY	0.4453	0.9268	5	14
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	HLA-C07:27	EYFERLEKY	0.4276	0.9046	5	14
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	HLA-C07:46	EYFERLEKY	0.4265	0.7589	5	14
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	HLA-C07:05	EYFERLEKY	0.1522	0.9005	5	14
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	HLA-C12:16	EYFERLEKY	0.1306	0.9601	5	14
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	HLA-B15:04	RLEKYKIGQLY	0.9439	0.5907	9	20
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	HLA-C14:03	YFERLEKY	0.9482	0.928	6	14
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	HLA-C14:02	YFERLEKY	0.9482	0.928	6	14
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	HLA-B35:20	EYFERLEKY	0.6877	0.8849	5	14
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	HLA-B18:04	EYFERLEKY	0.5589	0.8903	5	14
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	HLA-C07:02	EYFERLEKY	0.5435	0.902	5	14
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	HLA-C07:22	EYFERLEKY	0.5211	0.7251	5	14
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	HLA-C07:01	EYFERLEKY	0.5144	0.5202	5	14
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	HLA-C07:17	EYFERLEKY	0.4694	0.9679	5	14
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	HLA-B18:06	EYFERLEKY	0.3589	0.869	5	14
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	HLA-A25:01	EYFERLEKY	0.3483	0.8122	5	14
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	HLA-B18:03	EYFERLEKY	0.3362	0.8693	5	14
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	HLA-B18:07	EYFERLEKY	0.3323	0.8463	5	14
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	HLA-B18:08	EYFERLEKY	0.3243	0.6895	5	14
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	HLA-C06:17	EYFERLEKY	0.1324	0.9894	5	14
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	HLA-C06:02	EYFERLEKY	0.1324	0.9894	5	14
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	HLA-C14:03	EYFERLEKY	0.0414	0.951	5	14
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	HLA-C14:02	EYFERLEKY	0.0414	0.951	5	14
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	HLA-C06:08	EYFERLEKY	0.0071	0.9858	5	14
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	HLA-C06:06	EYFERLEKY	0.0067	0.9801	5	14
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	HLA-B44:26	REYFERLEKY	0.9995	0.889	4	14
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	HLA-B44:07	REYFERLEKY	0.9995	0.889	4	14
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	HLA-B44:13	REYFERLEKY	0.9995	0.889	4	14
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	HLA-B18:11	REYFERLEKY	0.9913	0.8949	4	14
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	HLA-B15:53	REYFERLEKY	0.9878	0.9239	4	14
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	HLA-B15:54	REYFERLEKY	0.9795	0.9181	4	14
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	HLA-B44:13	LEKYKIGQLY	0.978	0.595	10	20
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	HLA-B44:26	LEKYKIGQLY	0.978	0.595	10	20
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	HLA-B44:07	LEKYKIGQLY	0.978	0.595	10	20
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	HLA-B18:05	REYFERLEKY	0.9722	0.8932	4	14
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	HLA-B18:08	REYFERLEKY	0.9703	0.7421	4	14
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	HLA-B18:04	LEKYKIGQLY	0.9412	0.5658	10	20
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	HLA-B15:68	REYFERLEKY	0.9222	0.7087	4	14
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	HLA-B35:28	REYFERLEKY	0.9141	0.9121	4	14
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	HLA-B18:05	LEKYKIGQLY	0.8941	0.5322	10	20
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	HLA-B48:02	REYFERLEKY	0.8705	0.9039	4	14
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	HLA-B18:11	LEKYKIGQLY	0.8553	0.5239	10	20
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	HLA-B15:34	RLEKYKIGQLY	0.9966	0.5618	9	20
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	HLA-B15:125	RLEKYKIGQLY	0.9966	0.5618	9	20
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	HLA-B15:33	RLEKYKIGQLY	0.9966	0.5618	9	20
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	HLA-B15:27	RLEKYKIGQLY	0.9966	0.5759	9	20
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	HLA-B15:135	RLEKYKIGQLY	0.9963	0.6016	9	20
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	HLA-B15:35	RLEKYKIGQLY	0.9931	0.5794	9	20
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	HLA-B15:20	RLEKYKIGQLY	0.9585	0.7111	9	20
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	HLA-B15:54	RLEKYKIGQLY	0.9529	0.5113	9	20
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	HLA-A32:01	RLEKYKIGQLY	0.8639	0.5728	9	20

Top

Potential FusionNeoAntigen Information of PRKAR1A-PITPNC1 in HLA II

PRKAR1A-PITPNC1_66511717_65528917.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	DRB1-0807	LREYFERLEKYKIGQ	3	18
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	DRB1-0807	REYFERLEKYKIGQL	4	19
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	DRB1-0819	LREYFERLEKYKIGQ	3	18
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	DRB1-0819	REYFERLEKYKIGQL	4	19
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	DRB1-0825	LREYFERLEKYKIGQ	3	18
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	DRB1-0825	REYFERLEKYKIGQL	4	19
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	DRB1-0825	FLREYFERLEKYKIG	2	17
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	DRB1-0832	LREYFERLEKYKIGQ	3	18
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	DRB1-0834	LREYFERLEKYKIGQ	3	18
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	DRB1-0834	REYFERLEKYKIGQL	4	19
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	DRB1-1172	LREYFERLEKYKIGQ	3	18
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	DRB1-1172	REYFERLEKYKIGQL	4	19
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	DRB1-1172	FLREYFERLEKYKIG	2	17
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	DRB1-1216	LREYFERLEKYKIGQ	3	18
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	DRB1-1216	REYFERLEKYKIGQL	4	19
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	DRB1-1216	FLREYFERLEKYKIG	2	17
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	DRB1-1222	LREYFERLEKYKIGQ	3	18
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	DRB1-1222	REYFERLEKYKIGQL	4	19
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	DRB1-13100	LREYFERLEKYKIGQ	3	18
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	DRB1-13100	REYFERLEKYKIGQL	4	19
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	DRB1-13100	FLREYFERLEKYKIG	2	17
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	DRB1-1331	LREYFERLEKYKIGQ	3	18
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	DRB1-1331	REYFERLEKYKIGQL	4	19
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	DRB1-1346	LREYFERLEKYKIGQ	3	18
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	DRB1-1346	REYFERLEKYKIGQL	4	19
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	DRB1-1346	FLREYFERLEKYKIG	2	17
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	DRB1-1386	LREYFERLEKYKIGQ	3	18
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	DRB1-1386	REYFERLEKYKIGQL	4	19
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	DRB1-1402	LREYFERLEKYKIGQ	3	18
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	DRB1-1407	LREYFERLEKYKIGQ	3	18
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	DRB1-1407	REYFERLEKYKIGQL	4	19
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	DRB1-1413	LREYFERLEKYKIGQ	3	18
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	DRB1-1422	LREYFERLEKYKIGQ	3	18
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	DRB1-1425	LREYFERLEKYKIGQ	3	18
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	DRB1-1430	LREYFERLEKYKIGQ	3	18
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	DRB1-1441	LREYFERLEKYKIGQ	3	18
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	DRB1-1442	LREYFERLEKYKIGQ	3	18
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	DRB1-1448	LREYFERLEKYKIGQ	3	18
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	DRB1-1448	REYFERLEKYKIGQL	4	19
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	DRB1-1449	LREYFERLEKYKIGQ	3	18
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	DRB1-1449	REYFERLEKYKIGQL	4	19
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	DRB1-1449	FLREYFERLEKYKIG	2	17
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	DRB1-1453	LREYFERLEKYKIGQ	3	18
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	DRB1-1468	LREYFERLEKYKIGQ	3	18
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	DRB1-1468	REYFERLEKYKIGQL	4	19
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	DRB1-1468	FLREYFERLEKYKIG	2	17
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	DRB1-1469	LREYFERLEKYKIGQ	3	18
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	DRB1-1469	REYFERLEKYKIGQL	4	19
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	DRB1-1493	LREYFERLEKYKIGQ	3	18
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	294	DRB1-1494	LREYFERLEKYKIGQ	3	18

Top

Fusion breakpoint peptide structures of PRKAR1A-PITPNC1

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
10623	YFERLEKYKIGQLY	PRKAR1A	PITPNC1	chr17	66511717	chr17	65528917	294

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of PRKAR1A-PITPNC1

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	10623	YFERLEKYKIGQLY	-7.10743	-7.22083
HLA-B14:02	3BVN	10623	YFERLEKYKIGQLY	-3.79488	-4.83018
HLA-B52:01	3W39	10623	YFERLEKYKIGQLY	-6.78681	-6.90021
HLA-B52:01	3W39	10623	YFERLEKYKIGQLY	-3.75119	-4.78649
HLA-A11:01	4UQ2	10623	YFERLEKYKIGQLY	-10.1888	-11.2241
HLA-A11:01	4UQ2	10623	YFERLEKYKIGQLY	-6.59241	-6.70581
HLA-A24:02	5HGA	10623	YFERLEKYKIGQLY	-8.29771	-9.33301
HLA-A24:02	5HGA	10623	YFERLEKYKIGQLY	-8.23185	-8.34525
HLA-B44:05	3DX8	10623	YFERLEKYKIGQLY	-7.25218	-7.36558
HLA-B44:05	3DX8	10623	YFERLEKYKIGQLY	-3.76181	-4.79711
HLA-A02:01	6TDR	10623	YFERLEKYKIGQLY	-2.73959	-3.77489

Top

Vaccine Design for the FusionNeoAntigens of PRKAR1A-PITPNC1

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	10	20	LEKYKIGQLY	TTGGAGAAGTACAAAATTGGACAGCTGTAC
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	4	14	REYFERLEKY	AGGGAATACTTTGAGAGGTTGGAGAAGTAC
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	5	14	EYFERLEKY	GAATACTTTGAGAGGTTGGAGAAGTAC
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	6	14	YFERLEKY	TACTTTGAGAGGTTGGAGAAGTAC
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	9	20	RLEKYKIGQLY	AGGTTGGAGAAGTACAAAATTGGACAGCTGTAC

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	2	17	FLREYFERLEKYKIG	TTCCTCAGGGAATACTTTGAGAGGTTGGAGAAGTACAAAATTGGA
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	3	18	LREYFERLEKYKIGQ	CTCAGGGAATACTTTGAGAGGTTGGAGAAGTACAAAATTGGACAG
PRKAR1A-PITPNC1	chr17	66511717	chr17	65528917	4	19	REYFERLEKYKIGQL	AGGGAATACTTTGAGAGGTTGGAGAAGTACAAAATTGGACAGCTG

Top

Information of the samples that have these potential fusion neoantigens of PRKAR1A-PITPNC1

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
COAD	PRKAR1A-PITPNC1	chr17	66511717	ENST00000358598	chr17	65528917	ENST00000299954	TCGA-D5-6929

Top

Potential target of CAR-T therapy development for PRKAR1A-PITPNC1

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to PRKAR1A-PITPNC1

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to PRKAR1A-PITPNC1

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner	Gene	Disease ID	Disease name	# pubmeds	Source
Hgene	PRKAR1A	C2607929	Carney Complex, Type 1	10	CLINGEN;CTD_human;GENOMICS_ENGLAND;UNIPROT
Hgene	PRKAR1A	C3276228	ACRODYSOSTOSIS 1 WITH OR WITHOUT HORMONE RESISTANCE	8	CTD_human;GENOMICS_ENGLAND;UNIPROT
Hgene	PRKAR1A	C0406810	Carney Complex	6	CLINGEN;CTD_human;GENOMICS_ENGLAND
Hgene	PRKAR1A	C0220659	Acrodysostosis	4	CTD_human;GENOMICS_ENGLAND;ORPHANET
Hgene	PRKAR1A	C0010481	Cushing Syndrome	2	CTD_human
Hgene	PRKAR1A	C1864846	PIGMENTED NODULAR ADRENOCORTICAL DISEASE, PRIMARY, 1 (disorder)	2	CTD_human;GENOMICS_ENGLAND
Hgene	PRKAR1A	C0001627	Congenital adrenal hyperplasia	1	CTD_human
Hgene	PRKAR1A	C0002170	Alopecia	1	CTD_human
Hgene	PRKAR1A	C0020456	Hyperglycemia	1	CTD_human
Hgene	PRKAR1A	C0021655	Insulin Resistance	1	CTD_human
Hgene	PRKAR1A	C0023487	Acute Promyelocytic Leukemia	1	CTD_human;ORPHANET
Hgene	PRKAR1A	C0026846	Muscular Atrophy	1	CTD_human
Hgene	PRKAR1A	C0028754	Obesity	1	CTD_human
Hgene	PRKAR1A	C0086873	Pseudopelade	1	CTD_human
Hgene	PRKAR1A	C0162311	Androgenetic Alopecia	1	CTD_human
Hgene	PRKAR1A	C0263477	Female pattern alopecia (disorder)	1	CTD_human
Hgene	PRKAR1A	C0270948	Neurogenic Muscular Atrophy	1	CTD_human
Hgene	PRKAR1A	C0920563	Insulin Sensitivity	1	CTD_human
Hgene	PRKAR1A	C1850635	Atrial myxoma, familial	1	CTD_human;ORPHANET
Hgene	PRKAR1A	C1854540	Carney Complex, Type 2	1	CTD_human
Hgene	PRKAR1A	C1855520	Hyperglycemia, Postprandial	1	CTD_human
Hgene	PRKAR1A	C3553250	ACRODYSOSTOSIS 2 WITH OR WITHOUT HORMONE RESISTANCE	1	CTD_human
Hgene	PRKAR1A	C3887949	Apparent mineralocorticoid excess	1	CTD_human
Hgene	PRKAR1A	C4083212	Alopecia, Male Pattern	1	CTD_human
Hgene	PRKAR1A	C4304832	Primary pigmented nodular adrenocortical disease	1	ORPHANET
Hgene	PRKAR1A	C4721502	Peripheral dysostosis	1	CTD_human

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)