Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:PRR11-SUZ12

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: PRR11-SUZ12
	FusionPDB ID: 69116
	FusionGDB2.0 ID: 69116
		Hgene	Tgene
	Gene symbol	PRR11	SUZ12
	Gene ID	55771	23512
	Gene name	proline rich 11	SUZ12 polycomb repressive complex 2 subunit
	Synonyms	-	CHET9\|IMMAS\|JJAZ1
	Cytomap	17q22	17q11.2
	Type of gene	protein-coding	protein-coding
	Description	proline-rich protein 11transcription repressor of MHCII	polycomb protein SUZ12chET 9 proteinchromatin precipitated E2F target 9 proteinjoined to JAZF1 proteinsuppressor of zeste 12 protein homolog
	Modification date	20200313	20200313
	UniProtAcc	.	Q15022 Main function of 5'-partner protein: FUNCTION: Polycomb group (PcG) protein. Component of the PRC2 complex, which methylates 'Lys-9' (H3K9me) and 'Lys-27' (H3K27me) of histone H3, leading to transcriptional repression of the affected target gene (PubMed:15225548, PubMed:15231737, PubMed:15385962, PubMed:16618801, PubMed:17344414, PubMed:18285464, PubMed:28229514, PubMed:29499137, PubMed:31959557). The PRC2 complex may also serve as a recruiting platform for DNA methyltransferases, thereby linking two epigenetic repression systems (PubMed:12435631, PubMed:12351676, PubMed:15385962, PubMed:15099518, PubMed:15225548, PubMed:15684044, PubMed:16431907, PubMed:18086877, PubMed:18285464). Genes repressed by the PRC2 complex include HOXC8, HOXA9, MYT1 and CDKN2A (PubMed:15231737, PubMed:16618801, PubMed:17200670, PubMed:31959557). {ECO:0000269\|PubMed:12351676, ECO:0000269\|PubMed:12435631, ECO:0000269\|PubMed:15099518, ECO:0000269\|PubMed:15225548, ECO:0000269\|PubMed:15231737, ECO:0000269\|PubMed:15385962, ECO:0000269\|PubMed:15684044, ECO:0000269\|PubMed:16431907, ECO:0000269\|PubMed:16618801, ECO:0000269\|PubMed:17200670, ECO:0000269\|PubMed:17344414, ECO:0000269\|PubMed:18086877, ECO:0000269\|PubMed:18285464, ECO:0000269\|PubMed:28229514, ECO:0000269\|PubMed:29499137, ECO:0000269\|PubMed:31959557}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000262293,	ENST00000322652, ENST00000580398,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	6 X 5 X 5=150	10 X 8 X 5=400
	# samples	6	8
	** MAII score	log2(6/150*10)=-1.32192809488736 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(8/400*10)=-2.32192809488736 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: PRR11 [Title/Abstract] AND SUZ12 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: PRR11 [Title/Abstract] AND SUZ12 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	PRR11(57275150)-SUZ12(30315339), # samples:1
Anticipated loss of major functional domain due to fusion event.	PRR11-SUZ12 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. PRR11-SUZ12 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. PRR11-SUZ12 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. PRR11-SUZ12 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	PRR11	GO:0051726	regulation of cell cycle	23246489

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr17:57275150/chr17:30315339)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across PRR11 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across SUZ12 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst

Tenst

Hgene

Hchr

Hbp

Hstrand

Tgene

Tchr

Tbp

Tstrand

Seq length
(transcript)

BP loci
(transcript)

Predicted start
(transcript)

Predicted stop
(transcript)

Seq length
(amino acids)

ENST00000262293

PRR11

chr17

57275150

ENST00000322652

SUZ12

chr17

30315339

4565

1326

312

2522

736

ENST00000262293

PRR11

chr17

57275150

ENST00000580398

SUZ12

chr17

30315339

4169

1326

312

2522

736

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000262293	ENST00000322652	PRR11	chr17	57275150	-	SUZ12	chr17	30315339	+	0.000959276	0.99904066
ENST00000262293	ENST00000580398	PRR11	chr17	57275150	-	SUZ12	chr17	30315339	+	0.00115831	0.9988417

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for PRR11-SUZ12

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
PRR11	chr17	57275150	SUZ12	chr17	30315339	1326	180	DSKAVLPPTLPQPASHFPPPPPPPPL

Top

Potential FusionNeoAntigen Information of PRR11-SUZ12 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

PRR11-SUZ12_57275150_30315339.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
PRR11-SUZ12	chr17	57275150	chr17	30315339	1326	HLA-B35:05	LPQPASHF	0.9901	0.7688	9	17
PRR11-SUZ12	chr17	57275150	chr17	30315339	1326	HLA-B35:01	LPQPASHF	0.9845	0.9405	9	17
PRR11-SUZ12	chr17	57275150	chr17	30315339	1326	HLA-B35:08	LPQPASHF	0.9774	0.8794	9	17
PRR11-SUZ12	chr17	57275150	chr17	30315339	1326	HLA-B53:01	LPQPASHF	0.8921	0.5926	9	17
PRR11-SUZ12	chr17	57275150	chr17	30315339	1326	HLA-B15:01	TLPQPASHF	0.9976	0.9645	8	17
PRR11-SUZ12	chr17	57275150	chr17	30315339	1326	HLA-A24:25	TLPQPASHF	0.9877	0.5545	8	17
PRR11-SUZ12	chr17	57275150	chr17	30315339	1326	HLA-B56:01	LPPTLPQPA	0.9865	0.9242	5	14
PRR11-SUZ12	chr17	57275150	chr17	30315339	1326	HLA-A24:20	TLPQPASHF	0.9859	0.5511	8	17
PRR11-SUZ12	chr17	57275150	chr17	30315339	1326	HLA-A24:15	TLPQPASHF	0.9857	0.5547	8	17
PRR11-SUZ12	chr17	57275150	chr17	30315339	1326	HLA-B46:01	TLPQPASHF	0.9828	0.76	8	17
PRR11-SUZ12	chr17	57275150	chr17	30315339	1326	HLA-A24:31	TLPQPASHF	0.9823	0.5546	8	17
PRR11-SUZ12	chr17	57275150	chr17	30315339	1326	HLA-B15:02	TLPQPASHF	0.9711	0.9846	8	17
PRR11-SUZ12	chr17	57275150	chr17	30315339	1326	HLA-B55:01	LPPTLPQPA	0.9531	0.8734	5	14
PRR11-SUZ12	chr17	57275150	chr17	30315339	1326	HLA-B15:25	TLPQPASHF	0.939	0.9829	8	17
PRR11-SUZ12	chr17	57275150	chr17	30315339	1326	HLA-A24:17	TLPQPASHF	0.9378	0.6107	8	17
PRR11-SUZ12	chr17	57275150	chr17	30315339	1326	HLA-A24:14	TLPQPASHF	0.7974	0.7519	8	17
PRR11-SUZ12	chr17	57275150	chr17	30315339	1326	HLA-B42:02	LPQPASHF	0.9138	0.8871	9	17
PRR11-SUZ12	chr17	57275150	chr17	30315339	1326	HLA-B54:01	LPPTLPQPA	0.9973	0.976	5	14
PRR11-SUZ12	chr17	57275150	chr17	30315339	1326	HLA-B54:01	LPQPASHFP	0.9879	0.5092	9	18
PRR11-SUZ12	chr17	57275150	chr17	30315339	1326	HLA-A24:02	TLPQPASHF	0.9859	0.5511	8	17
PRR11-SUZ12	chr17	57275150	chr17	30315339	1326	HLA-B15:21	TLPQPASHF	0.9762	0.9754	8	17
PRR11-SUZ12	chr17	57275150	chr17	30315339	1326	HLA-B78:01	LPPTLPQPA	0.9621	0.9441	5	14
PRR11-SUZ12	chr17	57275150	chr17	30315339	1326	HLA-B54:01	QPASHFPPP	0.9154	0.6272	11	20
PRR11-SUZ12	chr17	57275150	chr17	30315339	1326	HLA-B15:31	TLPQPASHF	0.8678	0.9492	8	17
PRR11-SUZ12	chr17	57275150	chr17	30315339	1326	HLA-B15:05	TLPQPASHF	0.805	0.9476	8	17
PRR11-SUZ12	chr17	57275150	chr17	30315339	1326	HLA-C04:14	TLPQPASHF	0.5517	0.88	8	17
PRR11-SUZ12	chr17	57275150	chr17	30315339	1326	HLA-A02:07	TLPQPASHF	0.5276	0.8229	8	17
PRR11-SUZ12	chr17	57275150	chr17	30315339	1326	HLA-C04:07	TLPQPASHF	0.4473	0.8888	8	17
PRR11-SUZ12	chr17	57275150	chr17	30315339	1326	HLA-C04:10	TLPQPASHF	0.4386	0.9003	8	17
PRR11-SUZ12	chr17	57275150	chr17	30315339	1326	HLA-C04:06	TLPQPASHF	0.3938	0.9401	8	17
PRR11-SUZ12	chr17	57275150	chr17	30315339	1326	HLA-C01:17	TLPQPASHF	0.3052	0.987	8	17
PRR11-SUZ12	chr17	57275150	chr17	30315339	1326	HLA-C07:29	TLPQPASHF	0.29	0.9782	8	17
PRR11-SUZ12	chr17	57275150	chr17	30315339	1326	HLA-C07:13	TLPQPASHF	0.2757	0.979	8	17
PRR11-SUZ12	chr17	57275150	chr17	30315339	1326	HLA-C01:30	TLPQPASHF	0.2605	0.9877	8	17
PRR11-SUZ12	chr17	57275150	chr17	30315339	1326	HLA-A02:07	VLPPTLPQPA	0.8361	0.6986	4	14
PRR11-SUZ12	chr17	57275150	chr17	30315339	1326	HLA-B35:17	LPQPASHF	0.993	0.8915	9	17
PRR11-SUZ12	chr17	57275150	chr17	30315339	1326	HLA-B35:30	LPQPASHF	0.993	0.8915	9	17
PRR11-SUZ12	chr17	57275150	chr17	30315339	1326	HLA-B35:11	LPQPASHF	0.9874	0.9591	9	17
PRR11-SUZ12	chr17	57275150	chr17	30315339	1326	HLA-B35:23	LPQPASHF	0.9857	0.9477	9	17
PRR11-SUZ12	chr17	57275150	chr17	30315339	1326	HLA-B35:77	LPQPASHF	0.9845	0.9405	9	17
PRR11-SUZ12	chr17	57275150	chr17	30315339	1326	HLA-B35:24	LPQPASHF	0.9778	0.9467	9	17
PRR11-SUZ12	chr17	57275150	chr17	30315339	1326	HLA-B35:43	LPQPASHF	0.9046	0.8812	9	17
PRR11-SUZ12	chr17	57275150	chr17	30315339	1326	HLA-B53:02	LPQPASHF	0.8973	0.6238	9	17
PRR11-SUZ12	chr17	57275150	chr17	30315339	1326	HLA-B18:07	LPQPASHF	0.6758	0.9411	9	17
PRR11-SUZ12	chr17	57275150	chr17	30315339	1326	HLA-B15:27	TLPQPASHF	0.9978	0.9655	8	17
PRR11-SUZ12	chr17	57275150	chr17	30315339	1326	HLA-B15:50	TLPQPASHF	0.9977	0.9822	8	17
PRR11-SUZ12	chr17	57275150	chr17	30315339	1326	HLA-B15:135	TLPQPASHF	0.9977	0.9619	8	17
PRR11-SUZ12	chr17	57275150	chr17	30315339	1326	HLA-B15:125	TLPQPASHF	0.9976	0.9645	8	17
PRR11-SUZ12	chr17	57275150	chr17	30315339	1326	HLA-B15:33	TLPQPASHF	0.9976	0.9645	8	17
PRR11-SUZ12	chr17	57275150	chr17	30315339	1326	HLA-B15:34	TLPQPASHF	0.9976	0.9645	8	17
PRR11-SUZ12	chr17	57275150	chr17	30315339	1326	HLA-B15:24	TLPQPASHF	0.9949	0.9836	8	17
PRR11-SUZ12	chr17	57275150	chr17	30315339	1326	HLA-B15:12	TLPQPASHF	0.9907	0.9686	8	17
PRR11-SUZ12	chr17	57275150	chr17	30315339	1326	HLA-B55:02	LPPTLPQPA	0.9781	0.9436	5	14
PRR11-SUZ12	chr17	57275150	chr17	30315339	1326	HLA-B56:05	LPPTLPQPA	0.9644	0.923	5	14
PRR11-SUZ12	chr17	57275150	chr17	30315339	1326	HLA-B78:02	LPPTLPQPA	0.9495	0.9686	5	14
PRR11-SUZ12	chr17	57275150	chr17	30315339	1326	HLA-B15:39	TLPQPASHF	0.9441	0.9665	8	17
PRR11-SUZ12	chr17	57275150	chr17	30315339	1326	HLA-B15:13	TLPQPASHF	0.9358	0.9701	8	17
PRR11-SUZ12	chr17	57275150	chr17	30315339	1326	HLA-B15:73	TLPQPASHF	0.9355	0.9734	8	17
PRR11-SUZ12	chr17	57275150	chr17	30315339	1326	HLA-B15:30	TLPQPASHF	0.8861	0.9827	8	17
PRR11-SUZ12	chr17	57275150	chr17	30315339	1326	HLA-B78:02	LPQPASHFP	0.7646	0.6503	9	18
PRR11-SUZ12	chr17	57275150	chr17	30315339	1326	HLA-A25:01	TLPQPASHF	0.7037	0.9831	8	17
PRR11-SUZ12	chr17	57275150	chr17	30315339	1326	HLA-C04:03	TLPQPASHF	0.4616	0.8979	8	17
PRR11-SUZ12	chr17	57275150	chr17	30315339	1326	HLA-C04:01	TLPQPASHF	0.4473	0.8888	8	17
PRR11-SUZ12	chr17	57275150	chr17	30315339	1326	HLA-C04:04	TLPQPASHF	0.3881	0.9557	8	17
PRR11-SUZ12	chr17	57275150	chr17	30315339	1326	HLA-C18:01	TLPQPASHF	0.3002	0.8925	8	17
PRR11-SUZ12	chr17	57275150	chr17	30315339	1326	HLA-C01:02	TLPQPASHF	0.2995	0.9867	8	17
PRR11-SUZ12	chr17	57275150	chr17	30315339	1326	HLA-B78:02	QPASHFPPP	0.2981	0.8521	11	20
PRR11-SUZ12	chr17	57275150	chr17	30315339	1326	HLA-C01:03	TLPQPASHF	0.225	0.9757	8	17

Top

Potential FusionNeoAntigen Information of PRR11-SUZ12 in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of PRR11-SUZ12

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
6897	PPTLPQPASHFPPP	PRR11	SUZ12	chr17	57275150	chr17	30315339	1326

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of PRR11-SUZ12

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	6897	PPTLPQPASHFPPP	-7.02924	-7.14264
HLA-B14:02	3BVN	6897	PPTLPQPASHFPPP	-3.38077	-4.41607
HLA-B52:01	3W39	6897	PPTLPQPASHFPPP	-6.41355	-6.52695
HLA-B52:01	3W39	6897	PPTLPQPASHFPPP	-4.44188	-5.47718
HLA-A24:02	5HGA	6897	PPTLPQPASHFPPP	-7.76595	-8.80125
HLA-A24:02	5HGA	6897	PPTLPQPASHFPPP	-7.30892	-7.42232
HLA-B44:05	3DX8	6897	PPTLPQPASHFPPP	-5.65486	-5.76826
HLA-B44:05	3DX8	6897	PPTLPQPASHFPPP	-2.95775	-3.99305

Top

Vaccine Design for the FusionNeoAntigens of PRR11-SUZ12

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
PRR11-SUZ12	chr17	57275150	chr17	30315339	11	20	QPASHFPPP	TTTCAGAGGCTGCCTCCATTCGAAACA
PRR11-SUZ12	chr17	57275150	chr17	30315339	4	14	VLPPTLPQPA	ACGCAGGCCTTAAGGAGAAAGTTTCAGAGG
PRR11-SUZ12	chr17	57275150	chr17	30315339	5	14	LPPTLPQPA	CAGGCCTTAAGGAGAAAGTTTCAGAGG
PRR11-SUZ12	chr17	57275150	chr17	30315339	8	17	TLPQPASHF	AGGAGAAAGTTTCAGAGGCTGCCTCCA
PRR11-SUZ12	chr17	57275150	chr17	30315339	9	17	LPQPASHF	AGAAAGTTTCAGAGGCTGCCTCCA
PRR11-SUZ12	chr17	57275150	chr17	30315339	9	18	LPQPASHFP	AGAAAGTTTCAGAGGCTGCCTCCATTC

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of PRR11-SUZ12

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
HNSC	PRR11-SUZ12	chr17	57275150	ENST00000262293	chr17	30315339	ENST00000322652	TCGA-F7-8298-01A

Top

Potential target of CAR-T therapy development for PRR11-SUZ12

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to PRR11-SUZ12

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to PRR11-SUZ12

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner	Gene	Disease ID	Disease name	# pubmeds	Source
Tgene	SUZ12	C0206727	Nerve Sheath Tumors	2	CTD_human
Tgene	SUZ12	C0751689	Peripheral Nerve Sheath Neoplasm	2	CTD_human
Tgene	SUZ12	C0751691	Perineurioma	2	CTD_human
Tgene	SUZ12	C0001430	Adenoma	1	CTD_human
Tgene	SUZ12	C0014170	Endometrial Neoplasms	1	CTD_human
Tgene	SUZ12	C0017636	Glioblastoma	1	CTD_human
Tgene	SUZ12	C0017638	Glioma	1	CTD_human
Tgene	SUZ12	C0025202	melanoma	1	CTD_human
Tgene	SUZ12	C0027809	Neurilemmoma	1	CTD_human
Tgene	SUZ12	C0027830	neurofibroma	1	CTD_human
Tgene	SUZ12	C0027962	Melanocytic nevus	1	CTD_human
Tgene	SUZ12	C0042063	Urogenital Abnormalities	1	GENOMICS_ENGLAND
Tgene	SUZ12	C0205646	Adenoma, Basal Cell	1	CTD_human
Tgene	SUZ12	C0205647	Follicular adenoma	1	CTD_human
Tgene	SUZ12	C0205648	Adenoma, Microcystic	1	CTD_human
Tgene	SUZ12	C0205649	Adenoma, Monomorphic	1	CTD_human
Tgene	SUZ12	C0205650	Papillary adenoma	1	CTD_human
Tgene	SUZ12	C0205651	Adenoma, Trabecular	1	CTD_human
Tgene	SUZ12	C0206630	Endometrial Stromal Sarcoma	1	ORPHANET
Tgene	SUZ12	C0259783	mixed gliomas	1	CTD_human
Tgene	SUZ12	C0265210	Weaver syndrome	1	ORPHANET
Tgene	SUZ12	C0334588	Giant Cell Glioblastoma	1	CTD_human
Tgene	SUZ12	C0476089	Endometrial Carcinoma	1	CTD_human
Tgene	SUZ12	C0545053	Advanced bone age	1	GENOMICS_ENGLAND
Tgene	SUZ12	C0555198	Malignant Glioma	1	CTD_human
Tgene	SUZ12	C0557874	Global developmental delay	1	GENOMICS_ENGLAND
Tgene	SUZ12	C0751374	Schwannomatosis, Plexiform	1	CTD_human
Tgene	SUZ12	C1621958	Glioblastoma Multiforme	1	CTD_human
Tgene	SUZ12	C1842581	Abnormal corpus callosum morphology	1	GENOMICS_ENGLAND
Tgene	SUZ12	C1849265	Overgrowth	1	GENOMICS_ENGLAND
Tgene	SUZ12	C3714756	Intellectual Disability	1	GENOMICS_ENGLAND
Tgene	SUZ12	C4018871	Abnormality of the respiratory system	1	GENOMICS_ENGLAND
Tgene	SUZ12	C4021664	Abnormality of the abdominal wall	1	GENOMICS_ENGLAND
Tgene	SUZ12	C4021790	Abnormality of the skeletal system	1	GENOMICS_ENGLAND

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)