Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:PTPRF-LEFTY2

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: PTPRF-LEFTY2
	FusionPDB ID: 70380
	FusionGDB2.0 ID: 70380
		Hgene	Tgene
	Gene symbol	PTPRF	LEFTY2
	Gene ID	5792	7044
	Gene name	protein tyrosine phosphatase receptor type F	left-right determination factor 2
	Synonyms	BNAH2\|LAR	EBAF\|LEFTA\|LEFTYA\|TGFB4
	Cytomap	1p34.2	1q42.12
	Type of gene	protein-coding	protein-coding
	Description	receptor-type tyrosine-protein phosphatase FLCA-homologleukocyte antigen-related (LAR) PTP receptorleukocyte antigen-related tyrosine phosphataseleukocyte common antigen relatedprotein tyrosine phosphatase, receptor type, F polypeptidereceptor-linke	left-right determination factor 2TGF-beta-4endometrial bleeding-associated factorleft-right determination factor Aprotein lefty-2protein lefty-Atransforming growth factor beta-4
	Modification date	20200313	20200313
	UniProtAcc	.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000359947, ENST00000372413, ENST00000372414, ENST00000438120, ENST00000422171, ENST00000496447,	ENST00000474493, ENST00000366820, ENST00000420304,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	22 X 15 X 12=3960	3 X 2 X 3=18
	# samples	24	3
	** MAII score	log2(24/3960*10)=-4.04439411935845 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(3/18*10)=0.736965594166206 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0
Fusion gene context	PubMed: PTPRF [Title/Abstract] AND LEFTY2 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: PTPRF [Title/Abstract] AND LEFTY2 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	PTPRF(44019612)-LEFTY2(226127702), # samples:2
Anticipated loss of major functional domain due to fusion event.	PTPRF-LEFTY2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. PTPRF-LEFTY2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. PTPRF-LEFTY2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. PTPRF-LEFTY2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	PTPRF	GO:0099560	synaptic membrane adhesion	26321637

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr1:44019612/chr1:226127702)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across PTPRF (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across LEFTY2 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000359947	PTPRF	chr1	44019612	+	ENST00000420304	LEFTY2	chr1	226127702	-	2311	719	310	1467	385
ENST00000359947	PTPRF	chr1	44019612	+	ENST00000366820	LEFTY2	chr1	226127702	-	2407	719	310	1569	419
ENST00000438120	PTPRF	chr1	44019612	+	ENST00000420304	LEFTY2	chr1	226127702	-	2297	705	296	1453	385
ENST00000438120	PTPRF	chr1	44019612	+	ENST00000366820	LEFTY2	chr1	226127702	-	2393	705	296	1555	419
ENST00000372413	PTPRF	chr1	44019612	+	ENST00000420304	LEFTY2	chr1	226127702	-	2017	425	16	1173	385
ENST00000372413	PTPRF	chr1	44019612	+	ENST00000366820	LEFTY2	chr1	226127702	-	2113	425	16	1275	419
ENST00000372414	PTPRF	chr1	44019612	+	ENST00000420304	LEFTY2	chr1	226127702	-	2017	425	16	1173	385
ENST00000372414	PTPRF	chr1	44019612	+	ENST00000366820	LEFTY2	chr1	226127702	-	2113	425	16	1275	419

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000359947	ENST00000420304	PTPRF	chr1	44019612	+	LEFTY2	chr1	226127702	-	0.16337511	0.8366249
ENST00000359947	ENST00000366820	PTPRF	chr1	44019612	+	LEFTY2	chr1	226127702	-	0.16071355	0.8392864
ENST00000438120	ENST00000420304	PTPRF	chr1	44019612	+	LEFTY2	chr1	226127702	-	0.16197589	0.83802414
ENST00000438120	ENST00000366820	PTPRF	chr1	44019612	+	LEFTY2	chr1	226127702	-	0.15895057	0.8410494
ENST00000372413	ENST00000420304	PTPRF	chr1	44019612	+	LEFTY2	chr1	226127702	-	0.119336	0.880664
ENST00000372413	ENST00000366820	PTPRF	chr1	44019612	+	LEFTY2	chr1	226127702	-	0.14236456	0.8576355
ENST00000372414	ENST00000420304	PTPRF	chr1	44019612	+	LEFTY2	chr1	226127702	-	0.119336	0.880664
ENST00000372414	ENST00000366820	PTPRF	chr1	44019612	+	LEFTY2	chr1	226127702	-	0.14236456	0.8576355

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for PTPRF-LEFTY2

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
PTPRF	chr1	44019612	LEFTY2	chr1	226127702	425	136	GEINTSAKLSVLEEVAGRFLASEAAL
PTPRF	chr1	44019612	LEFTY2	chr1	226127702	425	136	GEINTSAKLSVLEEVAGRFLASEAST
PTPRF	chr1	44019612	LEFTY2	chr1	226127702	705	136	GEINTSAKLSVLEEVAGRFLASEAAL
PTPRF	chr1	44019612	LEFTY2	chr1	226127702	705	136	GEINTSAKLSVLEEVAGRFLASEAST
PTPRF	chr1	44019612	LEFTY2	chr1	226127702	719	136	GEINTSAKLSVLEEVAGRFLASEAAL
PTPRF	chr1	44019612	LEFTY2	chr1	226127702	719	136	GEINTSAKLSVLEEVAGRFLASEAST

Top

Potential FusionNeoAntigen Information of PTPRF-LEFTY2 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

PTPRF-LEFTY2_44019612_226127702.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	HLA-B45:01	EEVAGRFLA	0.997	0.6808	12	21
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	HLA-A74:09	SVLEEVAGR	0.9398	0.7429	9	18
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	HLA-A74:03	SVLEEVAGR	0.9398	0.7429	9	18
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	HLA-A74:11	SVLEEVAGR	0.9398	0.7429	9	18
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	HLA-A31:02	SVLEEVAGR	0.8618	0.683	9	18
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	HLA-B41:01	EEVAGRFLA	0.4991	0.8722	12	21
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	HLA-B50:01	EEVAGRFLA	0.3808	0.5245	12	21
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	HLA-A11:01	SVLEEVAGR	0.9924	0.5121	9	18
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	HLA-A31:01	SVLEEVAGR	0.9477	0.6634	9	18
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	HLA-B39:08	LEEVAGRFL	0.4391	0.9091	11	20
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	HLA-B18:03	EEVAGRFL	0.9967	0.7584	12	20
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	HLA-C04:03	VLEEVAGRF	0.997	0.8486	10	19
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	HLA-B40:04	LEEVAGRFL	0.9939	0.5821	11	20
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	HLA-A11:02	SVLEEVAGR	0.9924	0.5121	9	18
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	HLA-A74:01	SVLEEVAGR	0.9398	0.7429	9	18
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	HLA-B50:05	EEVAGRFLA	0.3808	0.5245	12	21
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	HLA-B50:04	EEVAGRFLA	0.3808	0.5245	12	21
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	HLA-B41:03	LEEVAGRFL	0.2537	0.7192	11	20

Top

Potential FusionNeoAntigen Information of PTPRF-LEFTY2 in HLA II

PTPRF-LEFTY2_44019612_226127702.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	DRB1-1117	GEINTSAKLSVLEEV	0	15
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	DRB1-1117	GEINTSAKLSVLEEV	0	15
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	DRB1-1152	GEINTSAKLSVLEEV	0	15
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	DRB1-1152	GEINTSAKLSVLEEV	0	15
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	DRB1-1401	GEINTSAKLSVLEEV	0	15
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	DRB1-1401	GEINTSAKLSVLEEV	0	15
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	DRB1-1404	GEINTSAKLSVLEEV	0	15
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	DRB1-1404	GEINTSAKLSVLEEV	0	15
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	DRB1-1405	GEINTSAKLSVLEEV	0	15
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	DRB1-1405	GEINTSAKLSVLEEV	0	15
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	DRB1-1408	GEINTSAKLSVLEEV	0	15
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	DRB1-1408	GEINTSAKLSVLEEV	0	15
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	DRB1-1418	GEINTSAKLSVLEEV	0	15
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	DRB1-1418	GEINTSAKLSVLEEV	0	15
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	DRB1-1423	GEINTSAKLSVLEEV	0	15
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	DRB1-1423	GEINTSAKLSVLEEV	0	15
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	DRB1-1426	GEINTSAKLSVLEEV	0	15
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	DRB1-1426	GEINTSAKLSVLEEV	0	15
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	DRB1-1428	GEINTSAKLSVLEEV	0	15
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	DRB1-1428	GEINTSAKLSVLEEV	0	15
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	DRB1-1435	GEINTSAKLSVLEEV	0	15
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	DRB1-1435	GEINTSAKLSVLEEV	0	15
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	DRB1-1438	GEINTSAKLSVLEEV	0	15
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	DRB1-1438	GEINTSAKLSVLEEV	0	15
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	DRB1-1443	GEINTSAKLSVLEEV	0	15
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	DRB1-1443	GEINTSAKLSVLEEV	0	15
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	DRB1-1445	GEINTSAKLSVLEEV	0	15
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	DRB1-1445	GEINTSAKLSVLEEV	0	15
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	DRB1-1450	GEINTSAKLSVLEEV	0	15
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	DRB1-1450	GEINTSAKLSVLEEV	0	15
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	DRB1-1454	GEINTSAKLSVLEEV	0	15
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	DRB1-1454	GEINTSAKLSVLEEV	0	15
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	DRB1-1456	GEINTSAKLSVLEEV	0	15
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	DRB1-1456	GEINTSAKLSVLEEV	0	15
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	DRB1-1458	GEINTSAKLSVLEEV	0	15
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	DRB1-1458	GEINTSAKLSVLEEV	0	15
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	DRB1-1459	GEINTSAKLSVLEEV	0	15
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	DRB1-1459	GEINTSAKLSVLEEV	0	15
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	DRB1-1460	GEINTSAKLSVLEEV	0	15
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	DRB1-1460	GEINTSAKLSVLEEV	0	15
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	DRB1-1461	GEINTSAKLSVLEEV	0	15
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	DRB1-1461	GEINTSAKLSVLEEV	0	15
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	DRB1-1462	GEINTSAKLSVLEEV	0	15
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	DRB1-1462	GEINTSAKLSVLEEV	0	15
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	DRB1-1464	GEINTSAKLSVLEEV	0	15
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	DRB1-1464	GEINTSAKLSVLEEV	0	15
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	DRB1-1470	GEINTSAKLSVLEEV	0	15
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	DRB1-1470	GEINTSAKLSVLEEV	0	15
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	DRB1-1471	GEINTSAKLSVLEEV	0	15
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	DRB1-1471	GEINTSAKLSVLEEV	0	15
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	DRB1-1472	GEINTSAKLSVLEEV	0	15
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	DRB1-1472	GEINTSAKLSVLEEV	0	15
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	DRB1-1475	GEINTSAKLSVLEEV	0	15
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	DRB1-1475	GEINTSAKLSVLEEV	0	15
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	DRB1-1482	GEINTSAKLSVLEEV	0	15
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	DRB1-1482	GEINTSAKLSVLEEV	0	15
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	DRB1-1486	GEINTSAKLSVLEEV	0	15
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	DRB1-1486	GEINTSAKLSVLEEV	0	15
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	DRB1-1487	GEINTSAKLSVLEEV	0	15
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	DRB1-1487	GEINTSAKLSVLEEV	0	15
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	DRB1-1488	GEINTSAKLSVLEEV	0	15
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	DRB1-1488	GEINTSAKLSVLEEV	0	15
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	DRB1-1490	GEINTSAKLSVLEEV	0	15
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	DRB1-1490	GEINTSAKLSVLEEV	0	15
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	DRB1-1491	GEINTSAKLSVLEEV	0	15
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	DRB1-1491	GEINTSAKLSVLEEV	0	15
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	DRB1-1495	GEINTSAKLSVLEEV	0	15
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	DRB1-1495	GEINTSAKLSVLEEV	0	15
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	DRB1-1496	GEINTSAKLSVLEEV	0	15
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	DRB1-1496	GEINTSAKLSVLEEV	0	15
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	DRB1-1497	GEINTSAKLSVLEEV	0	15
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	DRB1-1497	GEINTSAKLSVLEEV	0	15
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	DRB1-1499	GEINTSAKLSVLEEV	0	15
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	719	DRB1-1499	GEINTSAKLSVLEEV	0	15

Top

Fusion breakpoint peptide structures of PTPRF-LEFTY2

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
321	AKLSVLEEVAGRFL	PTPRF	LEFTY2	chr1	44019612	chr1	226127702	719

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of PTPRF-LEFTY2

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	321	AKLSVLEEVAGRFL	-7.37157	-7.48337
HLA-B14:02	3BVN	321	AKLSVLEEVAGRFL	-5.75216	-6.79526
HLA-B52:01	3W39	321	AKLSVLEEVAGRFL	-7.36854	-7.48034
HLA-B52:01	3W39	321	AKLSVLEEVAGRFL	-4.42371	-5.46681
HLA-A11:01	4UQ2	321	AKLSVLEEVAGRFL	-8.60667	-9.64977
HLA-A11:01	4UQ2	321	AKLSVLEEVAGRFL	-5.54504	-5.65684
HLA-A24:02	5HGA	321	AKLSVLEEVAGRFL	-7.65859	-7.77039
HLA-A24:02	5HGA	321	AKLSVLEEVAGRFL	-6.03094	-7.07404
HLA-B44:05	3DX8	321	AKLSVLEEVAGRFL	-5.82315	-5.93495
HLA-B44:05	3DX8	321	AKLSVLEEVAGRFL	-2.98805	-4.03115

Top

Vaccine Design for the FusionNeoAntigens of PTPRF-LEFTY2

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	10	19	VLEEVAGRF	TGCTCGAAGAGGTGGCCGGCAGGTTCC
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	11	20	LEEVAGRFL	TCGAAGAGGTGGCCGGCAGGTTCCTGG
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	12	20	EEVAGRFL	AAGAGGTGGCCGGCAGGTTCCTGG
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	12	21	EEVAGRFLA	AAGAGGTGGCCGGCAGGTTCCTGGCGT
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	9	18	SVLEEVAGR	CAGTGCTCGAAGAGGTGGCCGGCAGGT

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
PTPRF-LEFTY2	chr1	44019612	chr1	226127702	0	15	GEINTSAKLSVLEEV	GTGAGATCAACACTAGTGCCAAGCTCTCAGTGCTCGAAGAGGTGG

Top

Information of the samples that have these potential fusion neoantigens of PTPRF-LEFTY2

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
BRCA	PTPRF-LEFTY2	chr1	44019612	ENST00000359947	chr1	226127702	ENST00000420304	TCGA-BH-A18J-01A

Top

Potential target of CAR-T therapy development for PTPRF-LEFTY2

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to PTPRF-LEFTY2

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to PTPRF-LEFTY2

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)