Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:PTPRK-EYA4

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: PTPRK-EYA4
	FusionPDB ID: 70439
	FusionGDB2.0 ID: 70439
		Hgene	Tgene
	Gene symbol	PTPRK	EYA4
	Gene ID	5796	2070
	Gene name	protein tyrosine phosphatase receptor type K	EYA transcriptional coactivator and phosphatase 4
	Synonyms	R-PTP-kappa	CMD1J\|DFNA10
	Cytomap	6q22.33	6q23.2
	Type of gene	protein-coding	protein-coding
	Description	receptor-type tyrosine-protein phosphatase kappadJ480J14.2.1 (protein tyrosine phosphatase, receptor type, K (R-PTP-KAPPA, protein tyrosine phosphatase kappa , protein tyrosine phosphatase kappaprotein-tyrosine phosphatase kappaprotein-tyrosine phospha	eyes absent homolog 4dJ78N10.1 (eyes absent)eyes absent-like protein 4
	Modification date	20200322	20200313
	UniProtAcc	.	O95677 Main function of 5'-partner protein: FUNCTION: Tyrosine phosphatase that specifically dephosphorylates 'Tyr-142' of histone H2AX (H2AXY142ph). 'Tyr-142' phosphorylation of histone H2AX plays a central role in DNA repair and acts as a mark that distinguishes between apoptotic and repair responses to genotoxic stress. Promotes efficient DNA repair by dephosphorylating H2AX, promoting the recruitment of DNA repair complexes containing MDC1. Its function as histone phosphatase probably explains its role in transcription regulation during organogenesis. May be involved in development of the eye (By similarity). {ECO:0000250\|UniProtKB:Q99502}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000368207, ENST00000368210, ENST00000368213, ENST00000368215, ENST00000368226, ENST00000368227, ENST00000532331, ENST00000524481, ENST00000525459,	ENST00000441015, ENST00000355167, ENST00000355286, ENST00000367895, ENST00000430974, ENST00000431403, ENST00000452339, ENST00000525849, ENST00000531901,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	36 X 18 X 16=10368	7 X 7 X 4=196
	# samples	48	7
	** MAII score	log2(48/10368*10)=-4.43295940727611 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(7/196*10)=-1.48542682717024 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: PTPRK [Title/Abstract] AND EYA4 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: PTPRK [Title/Abstract] AND EYA4 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	PTPRK(128505577)-EYA4(133782252), # samples:1
Anticipated loss of major functional domain due to fusion event.	PTPRK-EYA4 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. PTPRK-EYA4 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. PTPRK-EYA4 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. PTPRK-EYA4 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	PTPRK	GO:0006470	protein dephosphorylation	16263724
Hgene	PTPRK	GO:0007165	signal transduction	16849327
Hgene	PTPRK	GO:0007179	transforming growth factor beta receptor signaling pathway	15899872
Hgene	PTPRK	GO:0008285	negative regulation of cell proliferation	15899872\|18276111
Hgene	PTPRK	GO:0010839	negative regulation of keratinocyte proliferation	16263724
Hgene	PTPRK	GO:0030336	negative regulation of cell migration	18276111
Hgene	PTPRK	GO:0034394	protein localization to cell surface	18276111
Hgene	PTPRK	GO:0034614	cellular response to reactive oxygen species	16849327
Hgene	PTPRK	GO:0034644	cellular response to UV	16849327
Hgene	PTPRK	GO:0045786	negative regulation of cell cycle	15899872
Hgene	PTPRK	GO:0045892	negative regulation of transcription, DNA-templated	18276111

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr6:128505577/chr6:133782252)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across PTPRK (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across EYA4 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000368226	PTPRK	chr6	128505577	-	ENST00000452339	EYA4	chr6	133782252	+	3125	1478	109	3027	972
ENST00000368226	PTPRK	chr6	128505577	-	ENST00000430974	EYA4	chr6	133782252	+	3170	1478	109	2982	957
ENST00000368226	PTPRK	chr6	128505577	-	ENST00000367895	EYA4	chr6	133782252	+	6343	1478	109	3027	972
ENST00000368226	PTPRK	chr6	128505577	-	ENST00000355167	EYA4	chr6	133782252	+	6342	1478	109	3027	972
ENST00000368226	PTPRK	chr6	128505577	-	ENST00000355286	EYA4	chr6	133782252	+	5097	1478	109	3027	972
ENST00000368226	PTPRK	chr6	128505577	-	ENST00000531901	EYA4	chr6	133782252	+	3771	1478	109	3045	978
ENST00000368226	PTPRK	chr6	128505577	-	ENST00000525849	EYA4	chr6	133782252	+	4449	1478	109	3027	972
ENST00000368226	PTPRK	chr6	128505577	-	ENST00000431403	EYA4	chr6	133782252	+	3262	1478	109	3027	972
ENST00000368227	PTPRK	chr6	128505577	-	ENST00000452339	EYA4	chr6	133782252	+	3176	1529	160	3078	972
ENST00000368227	PTPRK	chr6	128505577	-	ENST00000430974	EYA4	chr6	133782252	+	3221	1529	160	3033	957
ENST00000368227	PTPRK	chr6	128505577	-	ENST00000367895	EYA4	chr6	133782252	+	6394	1529	160	3078	972
ENST00000368227	PTPRK	chr6	128505577	-	ENST00000355167	EYA4	chr6	133782252	+	6393	1529	160	3078	972
ENST00000368227	PTPRK	chr6	128505577	-	ENST00000355286	EYA4	chr6	133782252	+	5148	1529	160	3078	972
ENST00000368227	PTPRK	chr6	128505577	-	ENST00000531901	EYA4	chr6	133782252	+	3822	1529	160	3096	978
ENST00000368227	PTPRK	chr6	128505577	-	ENST00000525849	EYA4	chr6	133782252	+	4500	1529	160	3078	972
ENST00000368227	PTPRK	chr6	128505577	-	ENST00000431403	EYA4	chr6	133782252	+	3313	1529	160	3078	972
ENST00000532331	PTPRK	chr6	128505577	-	ENST00000452339	EYA4	chr6	133782252	+	2927	1280	91	2829	912
ENST00000532331	PTPRK	chr6	128505577	-	ENST00000430974	EYA4	chr6	133782252	+	2972	1280	91	2784	897
ENST00000532331	PTPRK	chr6	128505577	-	ENST00000367895	EYA4	chr6	133782252	+	6145	1280	91	2829	912
ENST00000532331	PTPRK	chr6	128505577	-	ENST00000355167	EYA4	chr6	133782252	+	6144	1280	91	2829	912
ENST00000532331	PTPRK	chr6	128505577	-	ENST00000355286	EYA4	chr6	133782252	+	4899	1280	91	2829	912
ENST00000532331	PTPRK	chr6	128505577	-	ENST00000531901	EYA4	chr6	133782252	+	3573	1280	91	2847	918
ENST00000532331	PTPRK	chr6	128505577	-	ENST00000525849	EYA4	chr6	133782252	+	4251	1280	91	2829	912
ENST00000532331	PTPRK	chr6	128505577	-	ENST00000431403	EYA4	chr6	133782252	+	3064	1280	91	2829	912
ENST00000368213	PTPRK	chr6	128505577	-	ENST00000452339	EYA4	chr6	133782252	+	3034	1387	18	2936	972
ENST00000368213	PTPRK	chr6	128505577	-	ENST00000430974	EYA4	chr6	133782252	+	3079	1387	18	2891	957
ENST00000368213	PTPRK	chr6	128505577	-	ENST00000367895	EYA4	chr6	133782252	+	6252	1387	18	2936	972
ENST00000368213	PTPRK	chr6	128505577	-	ENST00000355167	EYA4	chr6	133782252	+	6251	1387	18	2936	972
ENST00000368213	PTPRK	chr6	128505577	-	ENST00000355286	EYA4	chr6	133782252	+	5006	1387	18	2936	972
ENST00000368213	PTPRK	chr6	128505577	-	ENST00000531901	EYA4	chr6	133782252	+	3680	1387	18	2954	978
ENST00000368213	PTPRK	chr6	128505577	-	ENST00000525849	EYA4	chr6	133782252	+	4358	1387	18	2936	972
ENST00000368213	PTPRK	chr6	128505577	-	ENST00000431403	EYA4	chr6	133782252	+	3171	1387	18	2936	972
ENST00000368210	PTPRK	chr6	128505577	-	ENST00000452339	EYA4	chr6	133782252	+	3067	1420	51	2969	972
ENST00000368210	PTPRK	chr6	128505577	-	ENST00000430974	EYA4	chr6	133782252	+	3112	1420	51	2924	957
ENST00000368210	PTPRK	chr6	128505577	-	ENST00000367895	EYA4	chr6	133782252	+	6285	1420	51	2969	972
ENST00000368210	PTPRK	chr6	128505577	-	ENST00000355167	EYA4	chr6	133782252	+	6284	1420	51	2969	972
ENST00000368210	PTPRK	chr6	128505577	-	ENST00000355286	EYA4	chr6	133782252	+	5039	1420	51	2969	972
ENST00000368210	PTPRK	chr6	128505577	-	ENST00000531901	EYA4	chr6	133782252	+	3713	1420	51	2987	978
ENST00000368210	PTPRK	chr6	128505577	-	ENST00000525849	EYA4	chr6	133782252	+	4391	1420	51	2969	972
ENST00000368210	PTPRK	chr6	128505577	-	ENST00000431403	EYA4	chr6	133782252	+	3204	1420	51	2969	972
ENST00000368215	PTPRK	chr6	128505577	-	ENST00000452339	EYA4	chr6	133782252	+	2809	1162	0	2711	903
ENST00000368215	PTPRK	chr6	128505577	-	ENST00000430974	EYA4	chr6	133782252	+	2854	1162	0	2666	888
ENST00000368215	PTPRK	chr6	128505577	-	ENST00000367895	EYA4	chr6	133782252	+	6027	1162	0	2711	903
ENST00000368215	PTPRK	chr6	128505577	-	ENST00000355167	EYA4	chr6	133782252	+	6026	1162	0	2711	903
ENST00000368215	PTPRK	chr6	128505577	-	ENST00000355286	EYA4	chr6	133782252	+	4781	1162	0	2711	903
ENST00000368215	PTPRK	chr6	128505577	-	ENST00000531901	EYA4	chr6	133782252	+	3455	1162	0	2729	909
ENST00000368215	PTPRK	chr6	128505577	-	ENST00000525849	EYA4	chr6	133782252	+	4133	1162	0	2711	903
ENST00000368215	PTPRK	chr6	128505577	-	ENST00000431403	EYA4	chr6	133782252	+	2946	1162	0	2711	903
ENST00000368207	PTPRK	chr6	128505577	-	ENST00000452339	EYA4	chr6	133782252	+	3034	1387	18	2936	972
ENST00000368207	PTPRK	chr6	128505577	-	ENST00000430974	EYA4	chr6	133782252	+	3079	1387	18	2891	957
ENST00000368207	PTPRK	chr6	128505577	-	ENST00000367895	EYA4	chr6	133782252	+	6252	1387	18	2936	972
ENST00000368207	PTPRK	chr6	128505577	-	ENST00000355167	EYA4	chr6	133782252	+	6251	1387	18	2936	972
ENST00000368207	PTPRK	chr6	128505577	-	ENST00000355286	EYA4	chr6	133782252	+	5006	1387	18	2936	972
ENST00000368207	PTPRK	chr6	128505577	-	ENST00000531901	EYA4	chr6	133782252	+	3680	1387	18	2954	978
ENST00000368207	PTPRK	chr6	128505577	-	ENST00000525849	EYA4	chr6	133782252	+	4358	1387	18	2936	972
ENST00000368207	PTPRK	chr6	128505577	-	ENST00000431403	EYA4	chr6	133782252	+	3171	1387	18	2936	972

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000368226	ENST00000452339	PTPRK	chr6	128505577	-	EYA4	chr6	133782252	+	0.001651366	0.9983486
ENST00000368226	ENST00000430974	PTPRK	chr6	128505577	-	EYA4	chr6	133782252	+	0.001759024	0.99824095
ENST00000368226	ENST00000367895	PTPRK	chr6	128505577	-	EYA4	chr6	133782252	+	0.000212726	0.9997873
ENST00000368226	ENST00000355167	PTPRK	chr6	128505577	-	EYA4	chr6	133782252	+	0.000214689	0.99978536
ENST00000368226	ENST00000355286	PTPRK	chr6	128505577	-	EYA4	chr6	133782252	+	0.000308595	0.9996915
ENST00000368226	ENST00000531901	PTPRK	chr6	128505577	-	EYA4	chr6	133782252	+	0.000568155	0.9994318
ENST00000368226	ENST00000525849	PTPRK	chr6	128505577	-	EYA4	chr6	133782252	+	0.000453521	0.99954647
ENST00000368226	ENST00000431403	PTPRK	chr6	128505577	-	EYA4	chr6	133782252	+	0.00131509	0.99868494
ENST00000368227	ENST00000452339	PTPRK	chr6	128505577	-	EYA4	chr6	133782252	+	0.001750228	0.9982497
ENST00000368227	ENST00000430974	PTPRK	chr6	128505577	-	EYA4	chr6	133782252	+	0.001833766	0.99816626
ENST00000368227	ENST00000367895	PTPRK	chr6	128505577	-	EYA4	chr6	133782252	+	0.000220482	0.9997795
ENST00000368227	ENST00000355167	PTPRK	chr6	128505577	-	EYA4	chr6	133782252	+	0.00022536	0.99977463
ENST00000368227	ENST00000355286	PTPRK	chr6	128505577	-	EYA4	chr6	133782252	+	0.000322353	0.99967766
ENST00000368227	ENST00000531901	PTPRK	chr6	128505577	-	EYA4	chr6	133782252	+	0.000605926	0.99939406
ENST00000368227	ENST00000525849	PTPRK	chr6	128505577	-	EYA4	chr6	133782252	+	0.000472227	0.9995278
ENST00000368227	ENST00000431403	PTPRK	chr6	128505577	-	EYA4	chr6	133782252	+	0.001390871	0.9986091
ENST00000532331	ENST00000452339	PTPRK	chr6	128505577	-	EYA4	chr6	133782252	+	0.001519606	0.9984804
ENST00000532331	ENST00000430974	PTPRK	chr6	128505577	-	EYA4	chr6	133782252	+	0.001658524	0.99834144
ENST00000532331	ENST00000367895	PTPRK	chr6	128505577	-	EYA4	chr6	133782252	+	0.000191429	0.9998086
ENST00000532331	ENST00000355167	PTPRK	chr6	128505577	-	EYA4	chr6	133782252	+	0.000192025	0.999808
ENST00000532331	ENST00000355286	PTPRK	chr6	128505577	-	EYA4	chr6	133782252	+	0.000271638	0.9997284
ENST00000532331	ENST00000531901	PTPRK	chr6	128505577	-	EYA4	chr6	133782252	+	0.000519021	0.999481
ENST00000532331	ENST00000525849	PTPRK	chr6	128505577	-	EYA4	chr6	133782252	+	0.000417791	0.99958223
ENST00000532331	ENST00000431403	PTPRK	chr6	128505577	-	EYA4	chr6	133782252	+	0.00120492	0.99879503
ENST00000368213	ENST00000452339	PTPRK	chr6	128505577	-	EYA4	chr6	133782252	+	0.001617955	0.9983821
ENST00000368213	ENST00000430974	PTPRK	chr6	128505577	-	EYA4	chr6	133782252	+	0.001733502	0.9982665
ENST00000368213	ENST00000367895	PTPRK	chr6	128505577	-	EYA4	chr6	133782252	+	0.000204258	0.99979573
ENST00000368213	ENST00000355167	PTPRK	chr6	128505577	-	EYA4	chr6	133782252	+	0.00020514	0.9997949
ENST00000368213	ENST00000355286	PTPRK	chr6	128505577	-	EYA4	chr6	133782252	+	0.000293412	0.99970657
ENST00000368213	ENST00000531901	PTPRK	chr6	128505577	-	EYA4	chr6	133782252	+	0.000556333	0.9994437
ENST00000368213	ENST00000525849	PTPRK	chr6	128505577	-	EYA4	chr6	133782252	+	0.000442663	0.9995573
ENST00000368213	ENST00000431403	PTPRK	chr6	128505577	-	EYA4	chr6	133782252	+	0.00127915	0.9987208
ENST00000368210	ENST00000452339	PTPRK	chr6	128505577	-	EYA4	chr6	133782252	+	0.0016609	0.99833906
ENST00000368210	ENST00000430974	PTPRK	chr6	128505577	-	EYA4	chr6	133782252	+	0.001780046	0.9982199
ENST00000368210	ENST00000367895	PTPRK	chr6	128505577	-	EYA4	chr6	133782252	+	0.000210449	0.99978954
ENST00000368210	ENST00000355167	PTPRK	chr6	128505577	-	EYA4	chr6	133782252	+	0.000211419	0.9997886
ENST00000368210	ENST00000355286	PTPRK	chr6	128505577	-	EYA4	chr6	133782252	+	0.000302022	0.99969804
ENST00000368210	ENST00000531901	PTPRK	chr6	128505577	-	EYA4	chr6	133782252	+	0.000569203	0.9994307
ENST00000368210	ENST00000525849	PTPRK	chr6	128505577	-	EYA4	chr6	133782252	+	0.000453889	0.9995461
ENST00000368210	ENST00000431403	PTPRK	chr6	128505577	-	EYA4	chr6	133782252	+	0.001309893	0.99869007
ENST00000368215	ENST00000452339	PTPRK	chr6	128505577	-	EYA4	chr6	133782252	+	0.00154657	0.9984534
ENST00000368215	ENST00000430974	PTPRK	chr6	128505577	-	EYA4	chr6	133782252	+	0.001616471	0.9983835
ENST00000368215	ENST00000367895	PTPRK	chr6	128505577	-	EYA4	chr6	133782252	+	0.000182733	0.9998173
ENST00000368215	ENST00000355167	PTPRK	chr6	128505577	-	EYA4	chr6	133782252	+	0.000183334	0.9998167
ENST00000368215	ENST00000355286	PTPRK	chr6	128505577	-	EYA4	chr6	133782252	+	0.000248077	0.99975187
ENST00000368215	ENST00000531901	PTPRK	chr6	128505577	-	EYA4	chr6	133782252	+	0.000482111	0.9995179
ENST00000368215	ENST00000525849	PTPRK	chr6	128505577	-	EYA4	chr6	133782252	+	0.000384394	0.99961555
ENST00000368215	ENST00000431403	PTPRK	chr6	128505577	-	EYA4	chr6	133782252	+	0.001190706	0.99880934
ENST00000368207	ENST00000452339	PTPRK	chr6	128505577	-	EYA4	chr6	133782252	+	0.001617955	0.9983821
ENST00000368207	ENST00000430974	PTPRK	chr6	128505577	-	EYA4	chr6	133782252	+	0.001733502	0.9982665
ENST00000368207	ENST00000367895	PTPRK	chr6	128505577	-	EYA4	chr6	133782252	+	0.000204258	0.99979573
ENST00000368207	ENST00000355167	PTPRK	chr6	128505577	-	EYA4	chr6	133782252	+	0.00020514	0.9997949
ENST00000368207	ENST00000355286	PTPRK	chr6	128505577	-	EYA4	chr6	133782252	+	0.000293412	0.99970657
ENST00000368207	ENST00000531901	PTPRK	chr6	128505577	-	EYA4	chr6	133782252	+	0.000556333	0.9994437
ENST00000368207	ENST00000525849	PTPRK	chr6	128505577	-	EYA4	chr6	133782252	+	0.000442663	0.9995573
ENST00000368207	ENST00000431403	PTPRK	chr6	128505577	-	EYA4	chr6	133782252	+	0.00127915	0.9987208

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for PTPRK-EYA4

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
PTPRK	chr6	128505577	EYA4	chr6	133782252	1162	387	LPGPPLITRTKCAVITSSGYSPRSAH
PTPRK	chr6	128505577	EYA4	chr6	133782252	1162	836	LLYSLGGAFPIENIYSATKIGKESCF
PTPRK	chr6	128505577	EYA4	chr6	133782252	1162	842	LLYSLGGAFPIENIYSATKIGKESCF
PTPRK	chr6	128505577	EYA4	chr6	133782252	1280	396	LPGPPLITRTKCAVITSSGYSPRSAH
PTPRK	chr6	128505577	EYA4	chr6	133782252	1280	845	LLYSLGGAFPIENIYSATKIGKESCF
PTPRK	chr6	128505577	EYA4	chr6	133782252	1280	851	LLYSLGGAFPIENIYSATKIGKESCF
PTPRK	chr6	128505577	EYA4	chr6	133782252	1387	456	LPGPPLITRTKCAVITSSGYSPRSAH
PTPRK	chr6	128505577	EYA4	chr6	133782252	1387	905	LLYSLGGAFPIENIYSATKIGKESCF
PTPRK	chr6	128505577	EYA4	chr6	133782252	1387	911	LLYSLGGAFPIENIYSATKIGKESCF
PTPRK	chr6	128505577	EYA4	chr6	133782252	1420	456	LPGPPLITRTKCAVITSSGYSPRSAH
PTPRK	chr6	128505577	EYA4	chr6	133782252	1420	905	LLYSLGGAFPIENIYSATKIGKESCF
PTPRK	chr6	128505577	EYA4	chr6	133782252	1420	911	LLYSLGGAFPIENIYSATKIGKESCF
PTPRK	chr6	128505577	EYA4	chr6	133782252	1478	456	LPGPPLITRTKCAVITSSGYSPRSAH
PTPRK	chr6	128505577	EYA4	chr6	133782252	1478	905	LLYSLGGAFPIENIYSATKIGKESCF
PTPRK	chr6	128505577	EYA4	chr6	133782252	1478	911	LLYSLGGAFPIENIYSATKIGKESCF
PTPRK	chr6	128505577	EYA4	chr6	133782252	1529	456	LPGPPLITRTKCAVITSSGYSPRSAH
PTPRK	chr6	128505577	EYA4	chr6	133782252	1529	905	LLYSLGGAFPIENIYSATKIGKESCF
PTPRK	chr6	128505577	EYA4	chr6	133782252	1529	911	LLYSLGGAFPIENIYSATKIGKESCF

Top

Potential FusionNeoAntigen Information of PTPRK-EYA4 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

PTPRK-EYA4_128505577_133782252.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-B52:01	GAFPIENI	0.9917	0.8818	6	14
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-B15:25	GAFPIENIY	0.9974	0.9377	6	15
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-B15:02	GAFPIENIY	0.9954	0.9464	6	15
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-B35:03	FPIENIYSA	0.9946	0.8707	8	17
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-B35:01	FPIENIYSA	0.9913	0.9071	8	17
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-B35:08	FPIENIYSA	0.9911	0.8308	8	17
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-B35:04	FPIENIYSA	0.99	0.8856	8	17
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-B35:02	FPIENIYSA	0.99	0.8856	8	17
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-B35:01	GAFPIENIY	0.9899	0.9135	6	15
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-B35:08	GAFPIENIY	0.989	0.8838	6	15
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-B35:05	FPIENIYSA	0.9848	0.5163	8	17
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-B15:17	GAFPIENIY	0.9848	0.9256	6	15
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-B15:01	GAFPIENIY	0.9832	0.9426	6	15
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-B39:06	FPIENIYSA	0.9804	0.68	8	17
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-B15:16	GAFPIENIY	0.8981	0.8377	6	15
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-B15:03	GAFPIENIY	0.8824	0.8691	6	15
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-B35:05	GAFPIENIY	0.8484	0.7177	6	15
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-B08:09	FPIENIYSA	0.7319	0.6457	8	17
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-B58:02	GAFPIENIY	0.6645	0.9594	6	15
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-B15:21	GAFPIENIY	0.9953	0.9267	6	15
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-B15:05	GAFPIENIY	0.9952	0.8988	6	15
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-B15:31	GAFPIENIY	0.9918	0.9071	6	15
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-B35:12	FPIENIYSA	0.99	0.8856	8	17
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-B15:07	GAFPIENIY	0.9476	0.7513	6	15
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-B39:10	FPIENIYSA	0.8519	0.8892	8	17
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-B42:02	FPIENIYSA	0.8258	0.5719	8	17
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-C15:04	GAFPIENIY	0.8029	0.8872	6	15
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-B42:01	FPIENIYSA	0.7878	0.5697	8	17
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-B15:04	GAFPIENIY	0.6175	0.9663	6	15
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-C12:12	GAFPIENIY	0.259	0.8811	6	15
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-C03:14	GAFPIENIY	0.1572	0.9699	6	15
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-C06:03	GAFPIENIY	0.125	0.9919	6	15
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-C12:04	GAFPIENIY	0.1247	0.9941	6	15
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-B15:39	GAFPIENIY	0.9966	0.8973	6	15
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-B15:20	GAFPIENIY	0.9951	0.9247	6	15
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-B35:11	GAFPIENIY	0.995	0.9333	6	15
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-B35:13	FPIENIYSA	0.993	0.8745	8	17
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-B35:28	GAFPIENIY	0.993	0.9278	6	15
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-B35:23	FPIENIYSA	0.9923	0.8566	8	17
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-B35:77	FPIENIYSA	0.9913	0.9071	8	17
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-B35:09	FPIENIYSA	0.99	0.8856	8	17
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-B35:77	GAFPIENIY	0.9899	0.9135	6	15
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-B35:23	GAFPIENIY	0.9897	0.9208	6	15
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-B35:20	GAFPIENIY	0.9896	0.9338	6	15
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-B35:17	FPIENIYSA	0.9858	0.7638	8	17
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-B35:30	FPIENIYSA	0.9858	0.7638	8	17
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-B15:27	GAFPIENIY	0.9842	0.9533	6	15
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-B15:33	GAFPIENIY	0.9832	0.9426	6	15
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-B15:125	GAFPIENIY	0.9832	0.9426	6	15
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-B15:34	GAFPIENIY	0.9832	0.9426	6	15
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-B15:135	GAFPIENIY	0.9825	0.9535	6	15
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-B15:11	GAFPIENIY	0.9765	0.9139	6	15
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-B15:50	GAFPIENIY	0.9725	0.939	6	15
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-B15:08	GAFPIENIY	0.97	0.9239	6	15
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-B35:11	FPIENIYSA	0.9653	0.8972	8	17
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-B15:13	GAFPIENIY	0.962	0.7014	6	15
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-C03:02	GAFPIENIY	0.9619	0.9674	6	15
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-B35:43	GAFPIENIY	0.9607	0.9254	6	15
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-B35:24	FPIENIYSA	0.9585	0.9421	8	17
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-B15:53	GAFPIENIY	0.9436	0.9291	6	15
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-B35:30	GAFPIENIY	0.9248	0.8498	6	15
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-B35:17	GAFPIENIY	0.9248	0.8498	6	15
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-B67:01	FPIENIYSA	0.9187	0.7406	8	17
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-B15:35	GAFPIENIY	0.8937	0.9547	6	15
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-B58:06	GAFPIENIY	0.8343	0.8991	6	15
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-B35:24	GAFPIENIY	0.8333	0.9268	6	15
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-B15:12	GAFPIENIY	0.8329	0.9012	6	15
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-C15:09	GAFPIENIY	0.8029	0.8872	6	15
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-B48:02	GAFPIENIY	0.721	0.9126	6	15
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-B15:54	GAFPIENIY	0.6357	0.9173	6	15
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-C12:02	GAFPIENIY	0.6161	0.9679	6	15
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-B18:07	FPIENIYSA	0.4956	0.9256	8	17
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-C16:04	GAFPIENIY	0.3337	0.9782	6	15
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-B15:68	GAFPIENIY	0.3004	0.6385	6	15
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-C12:03	GAFPIENIY	0.2909	0.9742	6	15
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-B18:04	GAFPIENIY	0.2684	0.9187	6	15
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-C16:01	GAFPIENIY	0.2289	0.9697	6	15
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-C16:02	GAFPIENIY	0.1286	0.9903	6	15
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-B18:07	GAFPIENIY	0.0754	0.8824	6	15
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-B15:08	FPIENIYSA	0.0345	0.8977	8	17
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-B35:43	FPIENIYSA	0.0315	0.9013	8	17
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-B15:11	FPIENIYSA	0.0301	0.9075	8	17
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-C02:02	GAFPIENIY	0.0258	0.9817	6	15
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	HLA-C02:10	GAFPIENIY	0.0258	0.9817	6	15

Top

Potential FusionNeoAntigen Information of PTPRK-EYA4 in HLA II

PTPRK-EYA4_128505577_133782252.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	DRB1-1327	PIENIYSATKIGKES	9	24
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	DRB1-1371	PIENIYSATKIGKES	9	24
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	DRB1-1412	PIENIYSATKIGKES	9	24
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	DRB1-1421	PIENIYSATKIGKES	9	24
PTPRK-EYA4	chr6	128505577	chr6	133782252	1387	DRB1-1433	PIENIYSATKIGKES	9	24

Top

Fusion breakpoint peptide structures of PTPRK-EYA4

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
2647	GAFPIENIYSATKI	PTPRK	EYA4	chr6	128505577	chr6	133782252	1387

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of PTPRK-EYA4

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	2647	GAFPIENIYSATKI	-4.6399	-4.7533
HLA-B14:02	3BVN	2647	GAFPIENIYSATKI	-3.07499	-4.11029
HLA-B52:01	3W39	2647	GAFPIENIYSATKI	-5.4302	-5.5436
HLA-B52:01	3W39	2647	GAFPIENIYSATKI	-1.43817	-2.47347
HLA-A24:02	5HGA	2647	GAFPIENIYSATKI	-9.56215	-9.67555
HLA-A24:02	5HGA	2647	GAFPIENIYSATKI	-6.57158	-7.60688
HLA-B44:05	3DX8	2647	GAFPIENIYSATKI	-7.1898	-7.3032
HLA-B44:05	3DX8	2647	GAFPIENIYSATKI	-5.49669	-6.53199
HLA-A02:01	6TDR	2647	GAFPIENIYSATKI	-6.78343	-6.89683

Top

Vaccine Design for the FusionNeoAntigens of PTPRK-EYA4

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
PTPRK-EYA4	chr6	128505577	chr6	133782252	6	14	GAFPIENI	TCACCAGAACAAAATGTGCAGTAA
PTPRK-EYA4	chr6	128505577	chr6	133782252	6	15	GAFPIENIY	TCACCAGAACAAAATGTGCAGTAATTA
PTPRK-EYA4	chr6	128505577	chr6	133782252	8	17	FPIENIYSA	GAACAAAATGTGCAGTAATTACAAGTA

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
PTPRK-EYA4	chr6	128505577	chr6	133782252	9	24	PIENIYSATKIGKES	CAAAATGTGCAGTAATTACAAGTAGTGGCTACAGCCCCAGATCAG

Top

Information of the samples that have these potential fusion neoantigens of PTPRK-EYA4

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
SKCM	PTPRK-EYA4	chr6	128505577	ENST00000368207	chr6	133782252	ENST00000355167	TCGA-EB-A5KH-06A

Top

Potential target of CAR-T therapy development for PTPRK-EYA4

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to PTPRK-EYA4

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to PTPRK-EYA4

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)