Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:PTPRN2-GTF2IRD1

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: PTPRN2-GTF2IRD1
	FusionPDB ID: 70491
	FusionGDB2.0 ID: 70491
		Hgene	Tgene
	Gene symbol	PTPRN2	GTF2IRD1
	Gene ID	5799	9569
	Gene name	protein tyrosine phosphatase receptor type N2	GTF2I repeat domain containing 1
	Synonyms	IA-2beta\|IAR\|ICAAR\|PTPRP\|R-PTP-N2	BEN\|CREAM1\|GTF3\|MUSTRD1\|RBAP2\|WBS\|WBSCR11\|WBSCR12\|hMusTRD1alpha1
	Cytomap	7q36.3	7q11.23
	Type of gene	protein-coding	protein-coding
	Description	receptor-type tyrosine-protein phosphatase N2IAR/receptor-like protein-tyrosine phosphataseislet cell autoantigen-related proteinphogrinprotein tyrosine phosphatase receptor piprotein tyrosine phosphatase, receptor type, N polypeptide 2tyrosine phos	general transcription factor II-I repeat domain-containing protein 1USE B1-binding proteinWilliams-Beuren syndrome chromosome region 11binding factor for early enhancergeneral transcription factor 3general transcription factor IIImuscle TFII-I repea
	Modification date	20200313	20200313
	UniProtAcc	.	Q9UHL9 Main function of 5'-partner protein: FUNCTION: May be a transcription regulator involved in cell-cycle progression and skeletal muscle differentiation. May repress GTF2I transcriptional functions, by preventing its nuclear residency, or by inhibiting its transcriptional activation. May contribute to slow-twitch fiber type specificity during myogenesis and in regenerating muscles. Binds troponin I slow-muscle fiber enhancer (USE B1). Binds specifically and with high affinity to the EFG sequences derived from the early enhancer of HOXC8 (By similarity). {ECO:0000250, ECO:0000269\|PubMed:11438732}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000389413, ENST00000389416, ENST00000389418, ENST00000404321, ENST00000409483,	ENST00000489094, ENST00000265755, ENST00000424337, ENST00000455841, ENST00000476977,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	20 X 17 X 7=2380	12 X 10 X 9=1080
	# samples	23	12
	** MAII score	log2(23/2380*10)=-3.37125580725093 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(12/1080*10)=-3.16992500144231 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: PTPRN2 [Title/Abstract] AND GTF2IRD1 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: PTPRN2 [Title/Abstract] AND GTF2IRD1 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	PTPRN2(157873990)-GTF2IRD1(74004180), # samples:1
Anticipated loss of major functional domain due to fusion event.	PTPRN2-GTF2IRD1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. PTPRN2-GTF2IRD1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. PTPRN2-GTF2IRD1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. PTPRN2-GTF2IRD1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner

Gene

GO ID

GO term

PubMed ID

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr7:157873990/chr7:74004180)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across PTPRN2 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across GTF2IRD1 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000389413	PTPRN2	chr7	157873990	-	ENST00000265755	GTF2IRD1	chr7	74004180	+	2412	1740	29	2254	741
ENST00000389413	PTPRN2	chr7	157873990	-	ENST00000455841	GTF2IRD1	chr7	74004180	+	2426	1740	29	2254	741
ENST00000389413	PTPRN2	chr7	157873990	-	ENST00000424337	GTF2IRD1	chr7	74004180	+	2423	1740	29	2254	741
ENST00000389413	PTPRN2	chr7	157873990	-	ENST00000476977	GTF2IRD1	chr7	74004180	+	3597	1740	29	2302	757
ENST00000409483	PTPRN2	chr7	157873990	-	ENST00000265755	GTF2IRD1	chr7	74004180	+	2400	1728	44	2242	732
ENST00000409483	PTPRN2	chr7	157873990	-	ENST00000455841	GTF2IRD1	chr7	74004180	+	2414	1728	44	2242	732
ENST00000409483	PTPRN2	chr7	157873990	-	ENST00000424337	GTF2IRD1	chr7	74004180	+	2411	1728	44	2242	732
ENST00000409483	PTPRN2	chr7	157873990	-	ENST00000476977	GTF2IRD1	chr7	74004180	+	3585	1728	44	2290	748
ENST00000389416	PTPRN2	chr7	157873990	-	ENST00000265755	GTF2IRD1	chr7	74004180	+	2386	1714	15	2228	737
ENST00000389416	PTPRN2	chr7	157873990	-	ENST00000455841	GTF2IRD1	chr7	74004180	+	2400	1714	15	2228	737
ENST00000389416	PTPRN2	chr7	157873990	-	ENST00000424337	GTF2IRD1	chr7	74004180	+	2397	1714	15	2228	737
ENST00000389416	PTPRN2	chr7	157873990	-	ENST00000476977	GTF2IRD1	chr7	74004180	+	3571	1714	15	2276	753
ENST00000389418	PTPRN2	chr7	157873990	-	ENST00000265755	GTF2IRD1	chr7	74004180	+	2405	1733	10	2247	745
ENST00000389418	PTPRN2	chr7	157873990	-	ENST00000455841	GTF2IRD1	chr7	74004180	+	2419	1733	10	2247	745
ENST00000389418	PTPRN2	chr7	157873990	-	ENST00000424337	GTF2IRD1	chr7	74004180	+	2416	1733	10	2247	745
ENST00000389418	PTPRN2	chr7	157873990	-	ENST00000476977	GTF2IRD1	chr7	74004180	+	3590	1733	10	2295	761
ENST00000404321	PTPRN2	chr7	157873990	-	ENST00000265755	GTF2IRD1	chr7	74004180	+	2464	1792	0	2306	768
ENST00000404321	PTPRN2	chr7	157873990	-	ENST00000455841	GTF2IRD1	chr7	74004180	+	2478	1792	0	2306	768
ENST00000404321	PTPRN2	chr7	157873990	-	ENST00000424337	GTF2IRD1	chr7	74004180	+	2475	1792	0	2306	768
ENST00000404321	PTPRN2	chr7	157873990	-	ENST00000476977	GTF2IRD1	chr7	74004180	+	3649	1792	0	2354	784

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000389413	ENST00000265755	PTPRN2	chr7	157873990	-	GTF2IRD1	chr7	74004180	+	0.02131799	0.978682
ENST00000389413	ENST00000455841	PTPRN2	chr7	157873990	-	GTF2IRD1	chr7	74004180	+	0.019739602	0.98026043
ENST00000389413	ENST00000424337	PTPRN2	chr7	157873990	-	GTF2IRD1	chr7	74004180	+	0.020214012	0.979786
ENST00000389413	ENST00000476977	PTPRN2	chr7	157873990	-	GTF2IRD1	chr7	74004180	+	0.018452762	0.98154724
ENST00000409483	ENST00000265755	PTPRN2	chr7	157873990	-	GTF2IRD1	chr7	74004180	+	0.015632462	0.98436755
ENST00000409483	ENST00000455841	PTPRN2	chr7	157873990	-	GTF2IRD1	chr7	74004180	+	0.01447314	0.9855269
ENST00000409483	ENST00000424337	PTPRN2	chr7	157873990	-	GTF2IRD1	chr7	74004180	+	0.014822784	0.9851773
ENST00000409483	ENST00000476977	PTPRN2	chr7	157873990	-	GTF2IRD1	chr7	74004180	+	0.012879755	0.9871202
ENST00000389416	ENST00000265755	PTPRN2	chr7	157873990	-	GTF2IRD1	chr7	74004180	+	0.012573659	0.9874263
ENST00000389416	ENST00000455841	PTPRN2	chr7	157873990	-	GTF2IRD1	chr7	74004180	+	0.011640096	0.9883599
ENST00000389416	ENST00000424337	PTPRN2	chr7	157873990	-	GTF2IRD1	chr7	74004180	+	0.011922839	0.98807716
ENST00000389416	ENST00000476977	PTPRN2	chr7	157873990	-	GTF2IRD1	chr7	74004180	+	0.009982741	0.99001724
ENST00000389418	ENST00000265755	PTPRN2	chr7	157873990	-	GTF2IRD1	chr7	74004180	+	0.020927504	0.9790725
ENST00000389418	ENST00000455841	PTPRN2	chr7	157873990	-	GTF2IRD1	chr7	74004180	+	0.019479899	0.98052007
ENST00000389418	ENST00000424337	PTPRN2	chr7	157873990	-	GTF2IRD1	chr7	74004180	+	0.01993974	0.9800602
ENST00000389418	ENST00000476977	PTPRN2	chr7	157873990	-	GTF2IRD1	chr7	74004180	+	0.015040411	0.98495954
ENST00000404321	ENST00000265755	PTPRN2	chr7	157873990	-	GTF2IRD1	chr7	74004180	+	0.007384499	0.9926156
ENST00000404321	ENST00000455841	PTPRN2	chr7	157873990	-	GTF2IRD1	chr7	74004180	+	0.006731279	0.99326867
ENST00000404321	ENST00000424337	PTPRN2	chr7	157873990	-	GTF2IRD1	chr7	74004180	+	0.006922193	0.9930779
ENST00000404321	ENST00000476977	PTPRN2	chr7	157873990	-	GTF2IRD1	chr7	74004180	+	0.005695445	0.9943045

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for PTPRN2-GTF2IRD1

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
PTPRN2	chr7	157873990	GTF2IRD1	chr7	74004180	1714	566	VQNVTTEDVEKATDEDDANRLGEKVI
PTPRN2	chr7	157873990	GTF2IRD1	chr7	74004180	1728	561	VQNVTTEDVEKATDEDDANRLGEKVI
PTPRN2	chr7	157873990	GTF2IRD1	chr7	74004180	1733	574	VQNVTTEDVEKATDEDDANRLGEKVI
PTPRN2	chr7	157873990	GTF2IRD1	chr7	74004180	1740	570	VQNVTTEDVEKATDEDDANRLGEKVI
PTPRN2	chr7	157873990	GTF2IRD1	chr7	74004180	1792	597	VQNVTTEDVEKATDEDDANRLGEKVI

Top

Potential FusionNeoAntigen Information of PTPRN2-GTF2IRD1 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

PTPRN2-GTF2IRD1_157873990_74004180.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
PTPRN2-GTF2IRD1	chr7	157873990	chr7	74004180	1740	HLA-C05:09	ATDEDDANRL	1	0.9215	11	21
PTPRN2-GTF2IRD1	chr7	157873990	chr7	74004180	1740	HLA-C08:15	ATDEDDANRL	0.9999	0.9537	11	21
PTPRN2-GTF2IRD1	chr7	157873990	chr7	74004180	1740	HLA-C04:03	ATDEDDANRL	1	0.7267	11	21
PTPRN2-GTF2IRD1	chr7	157873990	chr7	74004180	1740	HLA-C05:01	ATDEDDANRL	1	0.9215	11	21
PTPRN2-GTF2IRD1	chr7	157873990	chr7	74004180	1740	HLA-C08:02	ATDEDDANRL	0.9999	0.9537	11	21

Top

Potential FusionNeoAntigen Information of PTPRN2-GTF2IRD1 in HLA II

PTPRN2-GTF2IRD1_157873990_74004180.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
PTPRN2-GTF2IRD1	chr7	157873990	chr7	74004180	1740	DRB1-0413	VQNVTTEDVEKATDE	0	15
PTPRN2-GTF2IRD1	chr7	157873990	chr7	74004180	1740	DRB1-0422	VQNVTTEDVEKATDE	0	15
PTPRN2-GTF2IRD1	chr7	157873990	chr7	74004180	1740	DRB4-0101	VQNVTTEDVEKATDE	0	15
PTPRN2-GTF2IRD1	chr7	157873990	chr7	74004180	1740	DRB4-0103	VQNVTTEDVEKATDE	0	15
PTPRN2-GTF2IRD1	chr7	157873990	chr7	74004180	1740	DRB4-0104	VQNVTTEDVEKATDE	0	15
PTPRN2-GTF2IRD1	chr7	157873990	chr7	74004180	1740	DRB4-0106	VQNVTTEDVEKATDE	0	15
PTPRN2-GTF2IRD1	chr7	157873990	chr7	74004180	1740	DRB4-0107	VQNVTTEDVEKATDE	0	15
PTPRN2-GTF2IRD1	chr7	157873990	chr7	74004180	1740	DRB4-0108	VQNVTTEDVEKATDE	0	15

Top

Fusion breakpoint peptide structures of PTPRN2-GTF2IRD1

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
1622	EDVEKATDEDDANR	PTPRN2	GTF2IRD1	chr7	157873990	chr7	74004180	1740

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of PTPRN2-GTF2IRD1

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	1622	EDVEKATDEDDANR	-6.73939	-6.85279
HLA-B14:02	3BVN	1622	EDVEKATDEDDANR	-5.8572	-6.8925
HLA-B52:01	3W39	1622	EDVEKATDEDDANR	-6.06811	-6.18151
HLA-B52:01	3W39	1622	EDVEKATDEDDANR	-4.01521	-5.05051
HLA-A24:02	5HGA	1622	EDVEKATDEDDANR	-6.11611	-7.15141
HLA-A24:02	5HGA	1622	EDVEKATDEDDANR	-5.72969	-5.84309
HLA-B27:05	6PYJ	1622	EDVEKATDEDDANR	-6.42433	-7.45963
HLA-B44:05	3DX8	1622	EDVEKATDEDDANR	-5.79012	-5.90352
HLA-B44:05	3DX8	1622	EDVEKATDEDDANR	-3.82099	-4.85629

Top

Vaccine Design for the FusionNeoAntigens of PTPRN2-GTF2IRD1

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
PTPRN2-GTF2IRD1	chr7	157873990	chr7	74004180	11	21	ATDEDDANRL	CCACAGATGAAGATGACGCCAACAGACTCG

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
PTPRN2-GTF2IRD1	chr7	157873990	chr7	74004180	0	15	VQNVTTEDVEKATDE	TCCAAAACGTGACCACTGAGGATGTGGAGAAGGCCACAGATGAAG

Top

Information of the samples that have these potential fusion neoantigens of PTPRN2-GTF2IRD1

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
STAD	PTPRN2-GTF2IRD1	chr7	157873990	ENST00000389413	chr7	74004180	ENST00000265755	TCGA-EQ-8122-01A

Top

Potential target of CAR-T therapy development for PTPRN2-GTF2IRD1

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to PTPRN2-GTF2IRD1

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to PTPRN2-GTF2IRD1

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)