Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:ASH1L-YY1AP1

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: ASH1L-YY1AP1
	FusionPDB ID: 7117
	FusionGDB2.0 ID: 7117
		Hgene	Tgene
	Gene symbol	ASH1L	YY1AP1
	Gene ID	55870	55249
	Gene name	ASH1 like histone lysine methyltransferase	YY1 associated protein 1
	Synonyms	ASH1\|ASH1L1\|KMT2H\|MRD52	GRNG\|HCCA1\|HCCA2\|YY1AP
	Cytomap	1q22	1q22
	Type of gene	protein-coding	protein-coding
	Description	histone-lysine N-methyltransferase ASH1LASH1-like proteinabsent small and homeotic disks protein 1 homologash1 (absent, small, or homeotic)-likelysine N-methyltransferase 2Hprobable histone-lysine N-methyltransferase ASH1L	YY1-associated protein 1hepatocellular carcinoma susceptibility proteinhepatocellular carcinoma-associated protein 2
	Modification date	20200313	20200313
	UniProtAcc	Q9NR48 Main function of 5'-partner protein: FUNCTION: Histone methyltransferase specifically trimethylating 'Lys-36' of histone H3 forming H3K36me3 (PubMed:21239497). Also monomethylates 'Lys-9' of histone H3 (H3K9me1) in vitro (By similarity). The physiological significance of the H3K9me1 activity is unclear (By similarity). {ECO:0000250\|UniProtKB:Q99MY8, ECO:0000269\|PubMed:21239497}.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000368346, ENST00000392403, ENST00000548830,	ENST00000438245, ENST00000476093, ENST00000295566, ENST00000311573, ENST00000347088, ENST00000355499, ENST00000359205, ENST00000361831, ENST00000368330, ENST00000368339, ENST00000368340, ENST00000404643, ENST00000405763, ENST00000407221, ENST00000535662,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	36 X 20 X 14=10080	8 X 10 X 5=400
	# samples	44	11
	** MAII score	log2(44/10080*10)=-4.51784830486262 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(11/400*10)=-1.86249647625006 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: ASH1L [Title/Abstract] AND YY1AP1 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: ASH1L [Title/Abstract] AND YY1AP1 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	ASH1L(155531943)-YY1AP1(155640255), # samples:1 ASH1L(155531944)-YY1AP1(155638508), # samples:1 ASH1L(155531944)-YY1AP1(155638568), # samples:1 ASH1L(155531944)-YY1AP1(155642522), # samples:1 ASH1L(155531944)-YY1AP1(155640255), # samples:1 ASH1L(155490891)-YY1AP1(155631214), # samples:1
Anticipated loss of major functional domain due to fusion event.	ASH1L-YY1AP1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ASH1L-YY1AP1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. ASH1L-YY1AP1 seems lost the major protein functional domain in Hgene partner, which is a epigenetic factor due to the frame-shifted ORF. ASH1L-YY1AP1 seems lost the major protein functional domain in Hgene partner, which is a essential gene due to the frame-shifted ORF. ASH1L-YY1AP1 seems lost the major protein functional domain in Hgene partner, which is a IUPHAR drug target due to the frame-shifted ORF. ASH1L-YY1AP1 seems lost the major protein functional domain in Hgene partner, which is a transcription factor due to the frame-shifted ORF. ASH1L-YY1AP1 seems lost the major protein functional domain in Tgene partner, which is a essential gene due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	ASH1L	GO:0097676	histone H3-K36 dimethylation	26002201
Tgene	YY1AP1	GO:0051726	regulation of cell cycle	17541814

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr1:155531943/chr1:155640255)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across ASH1L (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across YY1AP1 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000368346	ASH1L	chr1	155490891	-	ENST00000405763	YY1AP1	chr1	155631214	-	1767	1060	640	1254	204
ENST00000392403	ASH1L	chr1	155490891	-	ENST00000405763	YY1AP1	chr1	155631214	-	1606	899	479	1093	204
ENST00000548830	ASH1L	chr1	155490891	-	ENST00000405763	YY1AP1	chr1	155631214	-	1398	691	271	885	204

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000368346	ENST00000405763	ASH1L	chr1	155490891	-	YY1AP1	chr1	155631214	-	0.005201067	0.9947989
ENST00000392403	ENST00000405763	ASH1L	chr1	155490891	-	YY1AP1	chr1	155631214	-	0.003649891	0.99635005
ENST00000548830	ENST00000405763	ASH1L	chr1	155490891	-	YY1AP1	chr1	155631214	-	0.00372459	0.9962754

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for ASH1L-YY1AP1

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
ASH1L	chr1	155490891	YY1AP1	chr1	155631214	1060	140	MTDEKNEHCPSKRFYKKTKQLPVLGK
ASH1L	chr1	155490891	YY1AP1	chr1	155631214	691	140	MTDEKNEHCPSKRFYKKTKQLPVLGK
ASH1L	chr1	155490891	YY1AP1	chr1	155631214	899	140	MTDEKNEHCPSKRFYKKTKQLPVLGK

Top

Potential FusionNeoAntigen Information of ASH1L-YY1AP1 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

ASH1L-YY1AP1_155490891_155631214.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	HLA-B44:03	NEHCPSKRF	0.9981	0.8732	5	14
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	HLA-B18:01	NEHCPSKRF	0.994	0.8566	5	14
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	HLA-B14:01	RFYKKTKQL	0.7654	0.5944	12	21
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	HLA-B14:02	RFYKKTKQL	0.7654	0.5944	12	21
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	HLA-B27:02	KRFYKKTKQL	0.9999	0.5362	11	21
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	HLA-B27:04	KRFYKKTKQL	0.9999	0.7085	11	21
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	HLA-B27:05	KRFYKKTKQL	0.9999	0.8473	11	21
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	HLA-B44:03	NEHCPSKRFY	0.9994	0.8233	5	15
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	HLA-B18:01	NEHCPSKRFY	0.9871	0.8244	5	15
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	HLA-B44:03	KNEHCPSKRF	0.4846	0.8923	4	14
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	HLA-B44:03	EKNEHCPSKRF	0.9609	0.8722	3	14
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	HLA-C07:19	RFYKKTKQL	0.6858	0.6816	12	21
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	HLA-C07:67	RFYKKTKQL	0.6135	0.9339	12	21
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	HLA-C07:80	RFYKKTKQL	0.6135	0.9339	12	21
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	HLA-C07:10	RFYKKTKQL	0.59	0.9466	12	21
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	HLA-C07:05	RFYKKTKQL	0.5865	0.9577	12	21
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	HLA-C07:29	RFYKKTKQL	0.5513	0.9346	12	21
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	HLA-C07:13	RFYKKTKQL	0.5372	0.926	12	21
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	HLA-C07:27	RFYKKTKQL	0.4868	0.9428	12	21
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	HLA-C07:46	RFYKKTKQL	0.4562	0.8704	12	21
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	HLA-C07:95	RFYKKTKQL	0.425	0.6577	12	21
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	HLA-B14:03	RFYKKTKQL	0.3282	0.6969	12	21
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	HLA-C12:16	RFYKKTKQL	0.2546	0.9496	12	21
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	HLA-C04:14	RFYKKTKQL	0.1746	0.8425	12	21
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	HLA-C01:30	RFYKKTKQL	0.0261	0.9252	12	21
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	HLA-B27:14	KRFYKKTKQL	0.9999	0.734	11	21
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	HLA-B27:03	KRFYKKTKQL	0.9937	0.866	11	21
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	HLA-B44:13	NEHCPSKRF	0.9981	0.8732	5	14
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	HLA-B44:07	NEHCPSKRF	0.9981	0.8732	5	14
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	HLA-B44:26	NEHCPSKRF	0.9981	0.8732	5	14
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	HLA-B27:10	KRFYKKTKQ	0.9966	0.7635	11	20
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	HLA-B18:07	NEHCPSKRF	0.9962	0.8146	5	14
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	HLA-B18:04	NEHCPSKRF	0.9946	0.8692	5	14
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	HLA-B18:08	NEHCPSKRF	0.9941	0.7863	5	14
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	HLA-B18:05	NEHCPSKRF	0.994	0.8566	5	14
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	HLA-B18:06	NEHCPSKRF	0.9912	0.8545	5	14
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	HLA-B18:03	NEHCPSKRF	0.9902	0.8478	5	14
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	HLA-B18:11	NEHCPSKRF	0.919	0.8182	5	14
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	HLA-A30:01	RFYKKTKQL	0.8657	0.8311	12	21
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	HLA-C07:22	RFYKKTKQL	0.7548	0.7481	12	21
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	HLA-C07:02	RFYKKTKQL	0.6135	0.9339	12	21
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	HLA-C07:01	RFYKKTKQL	0.5651	0.6172	12	21
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	HLA-C06:17	RFYKKTKQL	0.5195	0.991	12	21
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	HLA-C06:02	RFYKKTKQL	0.5195	0.991	12	21
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	HLA-C07:17	RFYKKTKQL	0.4521	0.9533	12	21
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	HLA-C07:04	RFYKKTKQL	0.4514	0.9298	12	21
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	HLA-C06:08	RFYKKTKQL	0.3713	0.9883	12	21
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	HLA-C14:03	RFYKKTKQL	0.2003	0.9495	12	21
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	HLA-C14:02	RFYKKTKQL	0.2003	0.9495	12	21
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	HLA-C06:06	RFYKKTKQL	0.1577	0.9864	12	21
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	HLA-C03:67	RFYKKTKQL	0.1319	0.9614	12	21
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	HLA-C04:04	RFYKKTKQL	0.0985	0.8545	12	21
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	HLA-B27:10	KRFYKKTKQL	0.9999	0.8319	11	21
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	HLA-B27:08	KRFYKKTKQL	0.9999	0.7174	11	21
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	HLA-B27:06	KRFYKKTKQL	0.9998	0.7241	11	21
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	HLA-B27:09	KRFYKKTKQL	0.9996	0.8017	11	21
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	HLA-B44:13	NEHCPSKRFY	0.9994	0.8233	5	15
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	HLA-B44:26	NEHCPSKRFY	0.9994	0.8233	5	15
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	HLA-B44:07	NEHCPSKRFY	0.9994	0.8233	5	15
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	HLA-B18:08	NEHCPSKRFY	0.9895	0.7072	5	15
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	HLA-B18:05	NEHCPSKRFY	0.9871	0.8244	5	15
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	HLA-B18:06	NEHCPSKRFY	0.9857	0.8085	5	15
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	HLA-B18:03	NEHCPSKRFY	0.985	0.8109	5	15
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	HLA-B18:11	NEHCPSKRFY	0.962	0.7644	5	15
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	HLA-B44:13	KNEHCPSKRF	0.4846	0.8923	4	14
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	HLA-B44:07	KNEHCPSKRF	0.4846	0.8923	4	14
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	HLA-B44:26	KNEHCPSKRF	0.4846	0.8923	4	14
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	HLA-B44:07	EKNEHCPSKRF	0.9609	0.8722	3	14
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	HLA-B44:26	EKNEHCPSKRF	0.9609	0.8722	3	14
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	HLA-B44:13	EKNEHCPSKRF	0.9609	0.8722	3	14

Top

Potential FusionNeoAntigen Information of ASH1L-YY1AP1 in HLA II

ASH1L-YY1AP1_155490891_155631214.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-0701	KRFYKKTKQLPVLGK	11	26
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-0701	SKRFYKKTKQLPVLG	10	25
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-0701	PSKRFYKKTKQLPVL	9	24
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-0703	KRFYKKTKQLPVLGK	11	26
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-0703	SKRFYKKTKQLPVLG	10	25
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-0703	PSKRFYKKTKQLPVL	9	24
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-0704	KRFYKKTKQLPVLGK	11	26
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-0704	SKRFYKKTKQLPVLG	10	25
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-0705	KRFYKKTKQLPVLGK	11	26
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-0705	SKRFYKKTKQLPVLG	10	25
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-0705	PSKRFYKKTKQLPVL	9	24
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-0706	KRFYKKTKQLPVLGK	11	26
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-0706	SKRFYKKTKQLPVLG	10	25
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-0706	PSKRFYKKTKQLPVL	9	24
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-0707	KRFYKKTKQLPVLGK	11	26
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-0707	SKRFYKKTKQLPVLG	10	25
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-0707	PSKRFYKKTKQLPVL	9	24
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-0708	KRFYKKTKQLPVLGK	11	26
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-0708	SKRFYKKTKQLPVLG	10	25
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-0708	PSKRFYKKTKQLPVL	9	24
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-0709	KRFYKKTKQLPVLGK	11	26
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-0709	SKRFYKKTKQLPVLG	10	25
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-0709	PSKRFYKKTKQLPVL	9	24
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-0711	KRFYKKTKQLPVLGK	11	26
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-0711	SKRFYKKTKQLPVLG	10	25
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-0712	KRFYKKTKQLPVLGK	11	26
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-0712	SKRFYKKTKQLPVLG	10	25
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-0713	KRFYKKTKQLPVLGK	11	26
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-0713	SKRFYKKTKQLPVLG	10	25
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-0713	PSKRFYKKTKQLPVL	9	24
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-0714	KRFYKKTKQLPVLGK	11	26
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-0714	SKRFYKKTKQLPVLG	10	25
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-0714	PSKRFYKKTKQLPVL	9	24
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-0715	KRFYKKTKQLPVLGK	11	26
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-0715	SKRFYKKTKQLPVLG	10	25
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-0715	PSKRFYKKTKQLPVL	9	24
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-0716	KRFYKKTKQLPVLGK	11	26
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-0716	SKRFYKKTKQLPVLG	10	25
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-0716	PSKRFYKKTKQLPVL	9	24
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-0717	KRFYKKTKQLPVLGK	11	26
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-0717	SKRFYKKTKQLPVLG	10	25
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-0717	PSKRFYKKTKQLPVL	9	24
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-0719	KRFYKKTKQLPVLGK	11	26
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-0719	SKRFYKKTKQLPVLG	10	25
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-0719	PSKRFYKKTKQLPVL	9	24
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-0807	KRFYKKTKQLPVLGK	11	26
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-0807	SKRFYKKTKQLPVLG	10	25
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-0819	KRFYKKTKQLPVLGK	11	26
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-0819	SKRFYKKTKQLPVLG	10	25
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-0825	KRFYKKTKQLPVLGK	11	26
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-0825	SKRFYKKTKQLPVLG	10	25
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-0834	KRFYKKTKQLPVLGK	11	26
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-0834	SKRFYKKTKQLPVLG	10	25
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-0901	KRFYKKTKQLPVLGK	11	26
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-0901	SKRFYKKTKQLPVLG	10	25
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-0902	KRFYKKTKQLPVLGK	11	26
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-0903	KRFYKKTKQLPVLGK	11	26
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-0903	SKRFYKKTKQLPVLG	10	25
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-0904	KRFYKKTKQLPVLGK	11	26
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-0904	SKRFYKKTKQLPVLG	10	25
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-0905	KRFYKKTKQLPVLGK	11	26
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-0905	SKRFYKKTKQLPVLG	10	25
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-0907	KRFYKKTKQLPVLGK	11	26
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-0908	KRFYKKTKQLPVLGK	11	26
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-0909	KRFYKKTKQLPVLGK	11	26
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-0909	SKRFYKKTKQLPVLG	10	25
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-1111	SKRFYKKTKQLPVLG	10	25
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-1216	KRFYKKTKQLPVLGK	11	26
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-13100	KRFYKKTKQLPVLGK	11	26
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-13100	SKRFYKKTKQLPVLG	10	25
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-1331	KRFYKKTKQLPVLGK	11	26
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-1331	SKRFYKKTKQLPVLG	10	25
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-1336	SKRFYKKTKQLPVLG	10	25
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-1346	KRFYKKTKQLPVLGK	11	26
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-1346	SKRFYKKTKQLPVLG	10	25
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-1363	SKRFYKKTKQLPVLG	10	25
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-1407	KRFYKKTKQLPVLGK	11	26
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-1448	KRFYKKTKQLPVLGK	11	26
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-1468	KRFYKKTKQLPVLGK	11	26
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-1468	SKRFYKKTKQLPVLG	10	25
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB1-1493	KRFYKKTKQLPVLGK	11	26
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	1060	DRB5-0112	KRFYKKTKQLPVLGK	11	26

Top

Fusion breakpoint peptide structures of ASH1L-YY1AP1

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
1774	EHCPSKRFYKKTKQ	ASH1L	YY1AP1	chr1	155490891	chr1	155631214	1060

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of ASH1L-YY1AP1

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	1774	EHCPSKRFYKKTKQ	-7.9962	-8.1096
HLA-B14:02	3BVN	1774	EHCPSKRFYKKTKQ	-5.70842	-6.74372
HLA-B52:01	3W39	1774	EHCPSKRFYKKTKQ	-6.83737	-6.95077
HLA-B52:01	3W39	1774	EHCPSKRFYKKTKQ	-4.4836	-5.5189
HLA-A11:01	4UQ2	1774	EHCPSKRFYKKTKQ	-10.0067	-10.1201
HLA-A11:01	4UQ2	1774	EHCPSKRFYKKTKQ	-9.03915	-10.0745
HLA-A24:02	5HGA	1774	EHCPSKRFYKKTKQ	-6.56204	-6.67544
HLA-A24:02	5HGA	1774	EHCPSKRFYKKTKQ	-5.42271	-6.45801
HLA-B44:05	3DX8	1774	EHCPSKRFYKKTKQ	-7.85648	-8.89178
HLA-B44:05	3DX8	1774	EHCPSKRFYKKTKQ	-5.3978	-5.5112
HLA-A02:01	6TDR	1774	EHCPSKRFYKKTKQ	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of ASH1L-YY1AP1

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	11	20	KRFYKKTKQ	AAACGATTTTATAAGAAGACCAAACAG
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	11	21	KRFYKKTKQL	AAACGATTTTATAAGAAGACCAAACAGCTG
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	12	21	RFYKKTKQL	CGATTTTATAAGAAGACCAAACAGCTG
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	3	14	EKNEHCPSKRF	GAAAAGAATGAACACTGTCCTTCAAAACGATTT
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	4	14	KNEHCPSKRF	AAGAATGAACACTGTCCTTCAAAACGATTT
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	5	14	NEHCPSKRF	AATGAACACTGTCCTTCAAAACGATTT
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	5	15	NEHCPSKRFY	AATGAACACTGTCCTTCAAAACGATTTTAT

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	10	25	SKRFYKKTKQLPVLG	TCAAAACGATTTTATAAGAAGACCAAACAGCTGCCAGTCCTAGGA
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	11	26	KRFYKKTKQLPVLGK	AAACGATTTTATAAGAAGACCAAACAGCTGCCAGTCCTAGGAAAA
ASH1L-YY1AP1	chr1	155490891	chr1	155631214	9	24	PSKRFYKKTKQLPVL	CCTTCAAAACGATTTTATAAGAAGACCAAACAGCTGCCAGTCCTA

Top

Information of the samples that have these potential fusion neoantigens of ASH1L-YY1AP1

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
LUAD	ASH1L-YY1AP1	chr1	155490891	ENST00000368346	chr1	155631214	ENST00000405763	TCGA-55-7903-01A

Top

Potential target of CAR-T therapy development for ASH1L-YY1AP1

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to ASH1L-YY1AP1

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to ASH1L-YY1AP1

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)