Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:ASH2L-CASS4

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: ASH2L-CASS4
	FusionPDB ID: 7125
	FusionGDB2.0 ID: 7125
		Hgene	Tgene
	Gene symbol	ASH2L	CASS4
	Gene ID	9070	57091
	Gene name	ASH2 like, histone lysine methyltransferase complex subunit	Cas scaffold protein family member 4
	Synonyms	ASH2\|ASH2L1\|ASH2L2\|Bre2	C20orf32\|CAS4\|HEFL\|HEPL
	Cytomap	8p11.23	20q13.31
	Type of gene	protein-coding	protein-coding
	Description	set1/Ash2 histone methyltransferase complex subunit ASH2ASH2-like proteinash2 (absent, small, or homeotic)-like	cas scaffolding protein family member 4HEF-like proteinHEF1-EFS-p130Cas-like protein
	Modification date	20200313	20200313
	UniProtAcc	Q9UBL3 Main function of 5'-partner protein: FUNCTION: Transcriptional regulator (PubMed:12670868). Component or associated component of some histone methyltransferase complexes which regulates transcription through recruitment of those complexes to gene promoters (PubMed:19131338). Component of the Set1/Ash2 histone methyltransferase (HMT) complex, a complex that specifically methylates 'Lys-4' of histone H3, but not if the neighboring 'Lys-9' residue is already methylated (PubMed:19556245). As part of the MLL1/MLL complex it is involved in methylation and dimethylation at 'Lys-4' of histone H3 (PubMed:19556245). May play a role in hematopoiesis (PubMed:12670868). In association with RBBP5 and WDR5, stimulates the histone methyltransferase activities of KMT2A, KMT2B, KMT2C, KMT2D, SETD1A and SETD1B (PubMed:21220120, PubMed:22266653). {ECO:0000269\|PubMed:12670868, ECO:0000269\|PubMed:19131338, ECO:0000269\|PubMed:19556245, ECO:0000269\|PubMed:21220120, ECO:0000269\|PubMed:22266653}.	Q9NQ75 Main function of 5'-partner protein: FUNCTION: Docking protein that plays a role in tyrosine kinase-based signaling related to cell adhesion and cell spreading. Regulates PTK2/FAK1 activity, focal adhesion integrity, and cell spreading. {ECO:0000269\|PubMed:18256281}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000250635, ENST00000343823, ENST00000428278, ENST00000521652, ENST00000545394, ENST00000524263,	ENST00000360314, ENST00000371336, ENST00000434344,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	13 X 10 X 6=780	7 X 5 X 4=140
	# samples	14	8
	** MAII score	log2(14/780*10)=-2.47804729680464 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(8/140*10)=-0.807354922057604 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: ASH2L [Title/Abstract] AND CASS4 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: ASH2L [Title/Abstract] AND CASS4 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	ASH2L(37991064)-CASS4(55020956), # samples:3
Anticipated loss of major functional domain due to fusion event.	ASH2L-CASS4 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ASH2L-CASS4 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ASH2L-CASS4 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. ASH2L-CASS4 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	ASH2L	GO:0006974	cellular response to DNA damage stimulus	17500065
Hgene	ASH2L	GO:0043627	response to estrogen	16603732
Hgene	ASH2L	GO:0051568	histone H3-K4 methylation	17355966\|19556245
Tgene	CASS4	GO:0061098	positive regulation of protein tyrosine kinase activity	18256281

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr8:37991064/chr20:55020956)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across ASH2L (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across CASS4 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000343823	ASH2L	chr8	37991064	+	ENST00000360314	CASS4	chr20	55020956	+	3864	1929	309	3830	1173
ENST00000343823	ASH2L	chr8	37991064	+	ENST00000371336	CASS4	chr20	55020956	+	4424	1929	309	3830	1173
ENST00000343823	ASH2L	chr8	37991064	+	ENST00000434344	CASS4	chr20	55020956	+	3112	1929	309	2519	736
ENST00000250635	ASH2L	chr8	37991064	+	ENST00000360314	CASS4	chr20	55020956	+	3613	1678	58	3579	1173
ENST00000250635	ASH2L	chr8	37991064	+	ENST00000371336	CASS4	chr20	55020956	+	4173	1678	58	3579	1173
ENST00000250635	ASH2L	chr8	37991064	+	ENST00000434344	CASS4	chr20	55020956	+	2861	1678	58	2268	736
ENST00000545394	ASH2L	chr8	37991064	+	ENST00000360314	CASS4	chr20	55020956	+	3410	1475	272	3376	1034
ENST00000545394	ASH2L	chr8	37991064	+	ENST00000371336	CASS4	chr20	55020956	+	3970	1475	272	3376	1034
ENST00000545394	ASH2L	chr8	37991064	+	ENST00000434344	CASS4	chr20	55020956	+	2658	1475	272	2065	597
ENST00000428278	ASH2L	chr8	37991064	+	ENST00000360314	CASS4	chr20	55020956	+	3714	1779	357	3680	1107
ENST00000428278	ASH2L	chr8	37991064	+	ENST00000371336	CASS4	chr20	55020956	+	4274	1779	357	3680	1107
ENST00000428278	ASH2L	chr8	37991064	+	ENST00000434344	CASS4	chr20	55020956	+	2962	1779	357	2369	670
ENST00000521652	ASH2L	chr8	37991064	+	ENST00000360314	CASS4	chr20	55020956	+	3568	1633	211	3534	1107
ENST00000521652	ASH2L	chr8	37991064	+	ENST00000371336	CASS4	chr20	55020956	+	4128	1633	211	3534	1107
ENST00000521652	ASH2L	chr8	37991064	+	ENST00000434344	CASS4	chr20	55020956	+	2816	1633	211	2223	670

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000343823	ENST00000360314	ASH2L	chr8	37991064	+	CASS4	chr20	55020956	+	0.001158774	0.9988412
ENST00000343823	ENST00000371336	ASH2L	chr8	37991064	+	CASS4	chr20	55020956	+	0.000888876	0.9991111
ENST00000343823	ENST00000434344	ASH2L	chr8	37991064	+	CASS4	chr20	55020956	+	0.005177649	0.9948224
ENST00000250635	ENST00000360314	ASH2L	chr8	37991064	+	CASS4	chr20	55020956	+	0.000885526	0.99911445
ENST00000250635	ENST00000371336	ASH2L	chr8	37991064	+	CASS4	chr20	55020956	+	0.000668422	0.9993316
ENST00000250635	ENST00000434344	ASH2L	chr8	37991064	+	CASS4	chr20	55020956	+	0.005203725	0.99479634
ENST00000545394	ENST00000360314	ASH2L	chr8	37991064	+	CASS4	chr20	55020956	+	0.001160101	0.9988399
ENST00000545394	ENST00000371336	ASH2L	chr8	37991064	+	CASS4	chr20	55020956	+	0.000861284	0.9991387
ENST00000545394	ENST00000434344	ASH2L	chr8	37991064	+	CASS4	chr20	55020956	+	0.003019933	0.99698
ENST00000428278	ENST00000360314	ASH2L	chr8	37991064	+	CASS4	chr20	55020956	+	0.001229387	0.99877053
ENST00000428278	ENST00000371336	ASH2L	chr8	37991064	+	CASS4	chr20	55020956	+	0.00096697	0.9990331
ENST00000428278	ENST00000434344	ASH2L	chr8	37991064	+	CASS4	chr20	55020956	+	0.005401626	0.9945984
ENST00000521652	ENST00000360314	ASH2L	chr8	37991064	+	CASS4	chr20	55020956	+	0.000935717	0.99906427
ENST00000521652	ENST00000371336	ASH2L	chr8	37991064	+	CASS4	chr20	55020956	+	0.00074694	0.9992531
ENST00000521652	ENST00000434344	ASH2L	chr8	37991064	+	CASS4	chr20	55020956	+	0.004800474	0.99519944

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for ASH2L-CASS4

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
ASH2L	chr8	37991064	CASS4	chr20	55020956	1475	399	VDKAEKSLKQTPHSEAILTLPRPVRA
ASH2L	chr8	37991064	CASS4	chr20	55020956	1633	472	VDKAEKSLKQTPHSEAILTLPRPVRA
ASH2L	chr8	37991064	CASS4	chr20	55020956	1678	538	VDKAEKSLKQTPHSEAILTLPRPVRA
ASH2L	chr8	37991064	CASS4	chr20	55020956	1779	472	VDKAEKSLKQTPHSEAILTLPRPVRA
ASH2L	chr8	37991064	CASS4	chr20	55020956	1929	538	VDKAEKSLKQTPHSEAILTLPRPVRA

Top

Potential FusionNeoAntigen Information of ASH2L-CASS4 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

ASH2L-CASS4_37991064_55020956.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B39:24	HSEAILTL	0.9763	0.5926	12	20
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B15:10	HSEAILTL	0.9718	0.6876	12	20
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B35:03	TPHSEAIL	0.9189	0.8835	10	18
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B39:01	HSEAILTL	0.9043	0.9573	12	20
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B15:37	HSEAILTL	0.8567	0.7795	12	20
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B35:02	TPHSEAIL	0.8082	0.9493	10	18
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B35:04	TPHSEAIL	0.8082	0.9493	10	18
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B38:02	HSEAILTL	0.8017	0.9869	12	20
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B38:01	HSEAILTL	0.795	0.9875	12	20
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B39:01	PHSEAILTL	0.994	0.9365	11	20
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B38:02	PHSEAILTL	0.9828	0.9671	11	20
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B38:01	PHSEAILTL	0.9824	0.9643	11	20
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B39:06	PHSEAILTL	0.9679	0.8266	11	20
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B48:01	KQTPHSEAI	0.9598	0.7314	8	17
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B15:10	PHSEAILTL	0.8372	0.5189	11	20
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B13:02	KQTPHSEAI	0.8204	0.7735	8	17
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B13:01	KQTPHSEAI	0.6567	0.9609	8	17
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B15:03	KQTPHSEAI	0.5848	0.7693	8	17
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B15:18	PHSEAILTL	0.5415	0.6573	11	20
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B39:13	KQTPHSEAI	0.5223	0.8378	8	17
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B38:01	KQTPHSEAI	0.4755	0.9355	8	17
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B52:01	KQTPHSEAI	0.0108	0.9779	8	17
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B48:01	KQTPHSEAIL	0.9698	0.5336	8	18
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B39:24	TPHSEAILTL	0.9585	0.5786	10	20
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B35:03	TPHSEAILTL	0.9444	0.7911	10	20
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B39:06	TPHSEAILTL	0.8584	0.7859	10	20
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B35:04	TPHSEAILTL	0.8508	0.933	10	20
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B35:02	TPHSEAILTL	0.8508	0.933	10	20
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B15:18	TPHSEAILTL	0.8404	0.7164	10	20
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B35:05	TPHSEAILTL	0.8373	0.531	10	20
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B39:01	TPHSEAILTL	0.7981	0.8999	10	20
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B39:13	KQTPHSEAIL	0.6565	0.7667	8	18
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B38:02	TPHSEAILTL	0.5539	0.9659	10	20
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B38:01	TPHSEAILTL	0.5023	0.9629	10	20
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B39:24	QTPHSEAILTL	0.9319	0.6279	9	20
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B15:10	QTPHSEAILTL	0.8244	0.547	9	20
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B39:01	QTPHSEAILTL	0.7801	0.9169	9	20
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B38:01	QTPHSEAILTL	0.5833	0.9647	9	20
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B38:02	QTPHSEAILTL	0.5766	0.9691	9	20
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-C08:15	HSEAILTL	1	0.9914	12	20
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-C08:13	HSEAILTL	0.9987	0.9869	12	20
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-C08:04	HSEAILTL	0.9987	0.9869	12	20
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-C08:03	HSEAILTL	0.9923	0.9935	12	20
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B39:10	TPHSEAIL	0.8358	0.9066	10	18
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B35:12	TPHSEAIL	0.8082	0.9493	10	18
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B39:05	HSEAILTL	0.7968	0.9489	12	20
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B39:09	PHSEAILTL	0.9946	0.686	11	20
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B39:12	PHSEAILTL	0.991	0.9433	11	20
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B39:05	PHSEAILTL	0.9868	0.9227	11	20
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-C01:17	QTPHSEAIL	0.8492	0.9647	9	18
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B15:04	KQTPHSEAI	0.8365	0.8716	8	17
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B48:03	KQTPHSEAI	0.7497	0.5293	8	17
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B39:08	KQTPHSEAI	0.7	0.8527	8	17
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B14:03	PHSEAILTL	0.521	0.8729	11	20
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-C01:30	QTPHSEAIL	0.4638	0.9607	9	18
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B07:12	TPHSEAILTL	0.9852	0.532	10	20
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B14:03	TPHSEAILTL	0.9609	0.86	10	20
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B39:08	KQTPHSEAIL	0.8543	0.7416	8	18
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B35:12	TPHSEAILTL	0.8508	0.933	10	20
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B42:02	TPHSEAILTL	0.8388	0.6906	10	20
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B39:10	TPHSEAILTL	0.8067	0.9104	10	20
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B42:01	TPHSEAILTL	0.7985	0.684	10	20
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B39:09	TPHSEAILTL	0.7967	0.6734	10	20
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B39:12	TPHSEAILTL	0.7737	0.9002	10	20
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B39:05	TPHSEAILTL	0.5695	0.8907	10	20
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B39:09	QTPHSEAILTL	0.8025	0.6798	9	20
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B39:05	QTPHSEAILTL	0.594	0.9098	9	20
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-C08:02	HSEAILTL	1	0.9914	12	20
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-C15:05	HSEAILTL	0.9997	0.952	12	20
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-C08:01	HSEAILTL	0.9923	0.9935	12	20
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B39:11	HSEAILTL	0.9058	0.8928	12	20
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B35:09	TPHSEAIL	0.8082	0.9493	10	18
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B15:09	HSEAILTL	0.8051	0.6528	12	20
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B38:05	HSEAILTL	0.795	0.9875	12	20
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B67:01	TPHSEAIL	0.7881	0.8247	10	18
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B39:31	PHSEAILTL	0.9936	0.9372	11	20
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B38:05	PHSEAILTL	0.9824	0.9643	11	20
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B15:09	PHSEAILTL	0.9368	0.5631	11	20
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B15:73	KQTPHSEAI	0.9318	0.89	8	17
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-C01:03	QTPHSEAIL	0.8961	0.9488	9	18
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-C01:02	QTPHSEAIL	0.8682	0.9633	9	18
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B15:30	KQTPHSEAI	0.7708	0.7865	8	17
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B40:12	KQTPHSEAI	0.7497	0.5293	8	17
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B15:53	KQTPHSEAI	0.7156	0.803	8	17
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B15:54	KQTPHSEAI	0.6968	0.7666	8	17
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B15:68	KQTPHSEAI	0.6784	0.6208	8	17
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B40:21	KQTPHSEAI	0.6172	0.5365	8	17
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B39:02	KQTPHSEAI	0.5903	0.8385	8	17
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B39:11	KQTPHSEAI	0.5865	0.8008	8	17
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B39:11	PHSEAILTL	0.504	0.8028	11	20
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B38:05	KQTPHSEAI	0.4755	0.9355	8	17
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B48:02	KQTPHSEAI	0.2843	0.8689	8	17
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B15:73	KQTPHSEAIL	0.9757	0.8652	8	18
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B15:30	KQTPHSEAIL	0.9509	0.7707	8	18
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B35:13	TPHSEAILTL	0.9285	0.8043	10	20
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B35:17	TPHSEAILTL	0.8525	0.6718	10	20
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B35:30	TPHSEAILTL	0.8525	0.6718	10	20
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B35:09	TPHSEAILTL	0.8508	0.933	10	20
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B67:01	TPHSEAILTL	0.8207	0.85	10	20
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B39:02	KQTPHSEAIL	0.7999	0.7645	8	18
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B39:31	TPHSEAILTL	0.7986	0.9	10	20
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B39:11	TPHSEAILTL	0.6326	0.7808	10	20
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B15:09	TPHSEAILTL	0.5965	0.7206	10	20
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B38:05	TPHSEAILTL	0.5023	0.9629	10	20
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B39:31	QTPHSEAILTL	0.7906	0.9159	9	20
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B39:11	QTPHSEAILTL	0.7384	0.8023	9	20
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B15:09	QTPHSEAILTL	0.5956	0.9188	9	20
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	HLA-B38:05	QTPHSEAILTL	0.5833	0.9647	9	20

Top

Potential FusionNeoAntigen Information of ASH2L-CASS4 in HLA II

ASH2L-CASS4_37991064_55020956.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	DRB1-1134	PHSEAILTLPRPVRA	11	26
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	DRB1-1204	PHSEAILTLPRPVRA	11	26
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	DRB1-1209	PHSEAILTLPRPVRA	11	26
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	DRB1-1344	PHSEAILTLPRPVRA	11	26
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	DRB1-1371	PHSEAILTLPRPVRA	11	26
ASH2L-CASS4	chr8	37991064	chr20	55020956	1678	DRB1-1417	PHSEAILTLPRPVRA	11	26

Top

Fusion breakpoint peptide structures of ASH2L-CASS4

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
8757	SLKQTPHSEAILTL	ASH2L	CASS4	chr8	37991064	chr20	55020956	1678

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of ASH2L-CASS4

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	8757	SLKQTPHSEAILTL	-7.15543	-7.26883
HLA-B14:02	3BVN	8757	SLKQTPHSEAILTL	-4.77435	-5.80965
HLA-B52:01	3W39	8757	SLKQTPHSEAILTL	-6.80875	-6.92215
HLA-B52:01	3W39	8757	SLKQTPHSEAILTL	-4.20386	-5.23916
HLA-A11:01	4UQ2	8757	SLKQTPHSEAILTL	-7.5194	-8.5547
HLA-A11:01	4UQ2	8757	SLKQTPHSEAILTL	-6.9601	-7.0735
HLA-A24:02	5HGA	8757	SLKQTPHSEAILTL	-7.52403	-7.63743
HLA-A24:02	5HGA	8757	SLKQTPHSEAILTL	-5.82433	-6.85963
HLA-B27:05	6PYJ	8757	SLKQTPHSEAILTL	-3.28285	-4.31815
HLA-B44:05	3DX8	8757	SLKQTPHSEAILTL	-5.91172	-6.94702
HLA-B44:05	3DX8	8757	SLKQTPHSEAILTL	-4.24346	-4.35686

Top

Vaccine Design for the FusionNeoAntigens of ASH2L-CASS4

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
ASH2L-CASS4	chr8	37991064	chr20	55020956	10	18	TPHSEAIL	CATAGTGAGGCCATCCTCACGCTT
ASH2L-CASS4	chr8	37991064	chr20	55020956	10	20	TPHSEAILTL	CATAGTGAGGCCATCCTCACGCTTCCCAGA
ASH2L-CASS4	chr8	37991064	chr20	55020956	11	20	PHSEAILTL	AGTGAGGCCATCCTCACGCTTCCCAGA
ASH2L-CASS4	chr8	37991064	chr20	55020956	12	20	HSEAILTL	GAGGCCATCCTCACGCTTCCCAGA
ASH2L-CASS4	chr8	37991064	chr20	55020956	8	17	KQTPHSEAI	ACTCCCCATAGTGAGGCCATCCTCACG
ASH2L-CASS4	chr8	37991064	chr20	55020956	8	18	KQTPHSEAIL	ACTCCCCATAGTGAGGCCATCCTCACGCTT
ASH2L-CASS4	chr8	37991064	chr20	55020956	9	18	QTPHSEAIL	CCCCATAGTGAGGCCATCCTCACGCTT
ASH2L-CASS4	chr8	37991064	chr20	55020956	9	20	QTPHSEAILTL	CCCCATAGTGAGGCCATCCTCACGCTTCCCAGA

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
ASH2L-CASS4	chr8	37991064	chr20	55020956	11	26	PHSEAILTLPRPVRA	AGTGAGGCCATCCTCACGCTTCCCAGACCTGTCCGGGCCTCACTG

Top

Information of the samples that have these potential fusion neoantigens of ASH2L-CASS4

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
SARC	ASH2L-CASS4	chr8	37991064	ENST00000250635	chr20	55020956	ENST00000360314	TCGA-DX-A3LS-01A

Top

Potential target of CAR-T therapy development for ASH2L-CASS4

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to ASH2L-CASS4

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to ASH2L-CASS4

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)