Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:RAD50-LIPF

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: RAD50-LIPF
	FusionPDB ID: 71726
	FusionGDB2.0 ID: 71726
		Hgene	Tgene
	Gene symbol	RAD50	LIPF
	Gene ID	10111	8513
	Gene name	RAD50 double strand break repair protein	lipase F, gastric type
	Synonyms	NBSLD\|RAD502\|hRad50	GL\|HGL\|HLAL
	Cytomap	5q31.1	10q23.31
	Type of gene	protein-coding	protein-coding
	Description	DNA repair protein RAD50RAD50 homolog, double strand break repair protein	gastric triacylglycerol lipasegastric lipaselipase, gastric
	Modification date	20200320	20200313
	UniProtAcc	RINT1 Main function of 5'-partner protein: 792	P07098 Main function of 5'-partner protein: FUNCTION: Catalyzes the hydrolysis of triacylglycerols to yield free fatty acids, diacylglycerol, monoacylglycerol, and glycerol (PubMed:2243091, PubMed:10358049). Shows a preferential hydrolysis at the sn-3 position of triacylglycerol (PubMed:2243091). {ECO:0000269\|PubMed:10358049, ECO:0000269\|PubMed:2243091}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000265335, ENST00000378823, ENST00000487596,	ENST00000238983, ENST00000355843, ENST00000394375, ENST00000608620,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	9 X 7 X 7=441	17 X 18 X 7=2142
	# samples	10	18
	** MAII score	log2(10/441*10)=-2.1407786557828 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(18/2142*10)=-3.57288966842058 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: RAD50 [Title/Abstract] AND LIPF [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: RAD50 [Title/Abstract] AND LIPF [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	RAD50(131915194)-LIPF(90429593), # samples:1
Anticipated loss of major functional domain due to fusion event.	RAD50-LIPF seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. RAD50-LIPF seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	RAD50	GO:0000019	regulation of mitotic recombination	8756642
Hgene	RAD50	GO:0006281	DNA repair	9705271
Hgene	RAD50	GO:0006310	DNA recombination	9705271
Hgene	RAD50	GO:0006974	cellular response to DNA damage stimulus	17500065
Hgene	RAD50	GO:0007004	telomere maintenance via telomerase	9705271
Hgene	RAD50	GO:0031954	positive regulation of protein autophosphorylation	15790808
Hgene	RAD50	GO:0033674	positive regulation of kinase activity	15790808
Hgene	RAD50	GO:1904354	negative regulation of telomere capping	17694070

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr5:131915194/chr10:90429593)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across RAD50 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across LIPF (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000378823	RAD50	chr5	131915194	+	ENST00000394375	LIPF	chr10	90429593	+	1857	952	374	1726	450
ENST00000378823	RAD50	chr5	131915194	+	ENST00000608620	LIPF	chr10	90429593	+	1857	952	374	1726	450
ENST00000378823	RAD50	chr5	131915194	+	ENST00000238983	LIPF	chr10	90429593	+	1860	952	374	1726	450
ENST00000378823	RAD50	chr5	131915194	+	ENST00000355843	LIPF	chr10	90429593	+	1860	952	374	1726	450
ENST00000265335	RAD50	chr5	131915194	+	ENST00000394375	LIPF	chr10	90429593	+	1843	938	360	1712	450
ENST00000265335	RAD50	chr5	131915194	+	ENST00000608620	LIPF	chr10	90429593	+	1843	938	360	1712	450
ENST00000265335	RAD50	chr5	131915194	+	ENST00000238983	LIPF	chr10	90429593	+	1846	938	360	1712	450
ENST00000265335	RAD50	chr5	131915194	+	ENST00000355843	LIPF	chr10	90429593	+	1846	938	360	1712	450

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000378823	ENST00000394375	RAD50	chr5	131915194	+	LIPF	chr10	90429593	+	0.000358167	0.9996418
ENST00000378823	ENST00000608620	RAD50	chr5	131915194	+	LIPF	chr10	90429593	+	0.000358167	0.9996418
ENST00000378823	ENST00000238983	RAD50	chr5	131915194	+	LIPF	chr10	90429593	+	0.000352192	0.99964786
ENST00000378823	ENST00000355843	RAD50	chr5	131915194	+	LIPF	chr10	90429593	+	0.000352192	0.99964786
ENST00000265335	ENST00000394375	RAD50	chr5	131915194	+	LIPF	chr10	90429593	+	0.000354206	0.9996458
ENST00000265335	ENST00000608620	RAD50	chr5	131915194	+	LIPF	chr10	90429593	+	0.000354206	0.9996458
ENST00000265335	ENST00000238983	RAD50	chr5	131915194	+	LIPF	chr10	90429593	+	0.000348644	0.9996513
ENST00000265335	ENST00000355843	RAD50	chr5	131915194	+	LIPF	chr10	90429593	+	0.000348644	0.9996513

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for RAD50-LIPF

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
RAD50	chr5	131915194	LIPF	chr10	90429593	938	192	ALKQKFDEIFSATSFDEMAKYDLPAT
RAD50	chr5	131915194	LIPF	chr10	90429593	952	192	ALKQKFDEIFSATSFDEMAKYDLPAT

Top

Potential FusionNeoAntigen Information of RAD50-LIPF in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

RAD50-LIPF_131915194_90429593.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-B18:01	DEIFSATSF	0.9989	0.8947	6	15
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-B15:25	TSFDEMAKY	0.9979	0.928	12	21
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-B44:03	DEIFSATSF	0.9946	0.9744	6	15
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-B35:08	TSFDEMAKY	0.9942	0.9087	12	21
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-B15:17	TSFDEMAKY	0.9929	0.8933	12	21
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-B15:02	TSFDEMAKY	0.9892	0.9455	12	21
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-B15:01	TSFDEMAKY	0.9876	0.921	12	21
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-B35:01	TSFDEMAKY	0.9847	0.9397	12	21
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-B15:16	TSFDEMAKY	0.8855	0.7401	12	21
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-B35:05	TSFDEMAKY	0.8668	0.6653	12	21
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-B58:02	TSFDEMAKY	0.8592	0.9355	12	21
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-B15:37	DEIFSATSF	0.6864	0.6029	6	15
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-B15:17	ATSFDEMAKY	0.9827	0.9344	11	21
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-B18:01	FDEIFSATSF	0.9509	0.939	5	15
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-B15:16	ATSFDEMAKY	0.8154	0.8507	11	21
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-B47:01	KFDEIFSATSF	0.9993	0.6902	4	15
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-B15:17	SATSFDEMAKY	0.9981	0.9298	10	21
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-A24:14	KFDEIFSATSF	0.9953	0.5374	4	15
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-C03:08	FSATSFDEM	0.9975	0.8669	9	18
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-B15:05	TSFDEMAKY	0.9959	0.9334	12	21
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-C03:19	FSATSFDEM	0.9947	0.9916	9	18
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-C03:07	FSATSFDEM	0.9944	0.9885	9	18
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-B15:21	TSFDEMAKY	0.991	0.9326	12	21
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-B15:31	TSFDEMAKY	0.9865	0.9384	12	21
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-C04:06	FSATSFDEM	0.9622	0.9188	9	18
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-C08:13	FSATSFDEM	0.9579	0.9794	9	18
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-C08:04	FSATSFDEM	0.9579	0.9794	9	18
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-C15:04	TSFDEMAKY	0.8937	0.9219	12	21
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-C08:03	FSATSFDEM	0.8762	0.9915	9	18
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-C03:14	FSATSFDEM	0.8698	0.9902	9	18
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-C12:12	FSATSFDEM	0.8161	0.9773	9	18
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-B15:31	DEIFSATSF	0.8141	0.8537	6	15
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-C07:19	TSFDEMAKY	0.7419	0.7457	12	21
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-C07:95	TSFDEMAKY	0.6703	0.7782	12	21
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-C02:06	FSATSFDEM	0.3332	0.987	9	18
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-C03:14	TSFDEMAKY	0.2328	0.9846	12	21
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-C12:04	TSFDEMAKY	0.1555	0.9956	12	21
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-B51:07	DEIFSATSF	0.1489	0.6765	6	15
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-C12:12	TSFDEMAKY	0.1477	0.9408	12	21
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-C06:03	TSFDEMAKY	0.1219	0.9951	12	21
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-C15:04	ATSFDEMAKY	0.9799	0.9342	11	21
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-C04:10	KFDEIFSATSF	1	0.8066	4	15
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-C04:07	KFDEIFSATSF	1	0.7942	4	15
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-C04:14	KFDEIFSATSF	0.9994	0.8171	4	15
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-B18:04	DEIFSATSF	0.9994	0.9052	6	15
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-B18:07	DEIFSATSF	0.9993	0.871	6	15
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-B18:06	DEIFSATSF	0.9989	0.8975	6	15
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-B18:08	DEIFSATSF	0.9989	0.7989	6	15
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-B18:05	DEIFSATSF	0.9989	0.8947	6	15
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-B18:03	DEIFSATSF	0.9984	0.8877	6	15
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-C03:03	FSATSFDEM	0.998	0.9915	9	18
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-C03:04	FSATSFDEM	0.998	0.9915	9	18
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-B15:39	TSFDEMAKY	0.9974	0.8665	12	21
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-C03:02	FSATSFDEM	0.997	0.9747	9	18
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-B15:20	TSFDEMAKY	0.9964	0.952	12	21
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-B44:13	DEIFSATSF	0.9946	0.9744	6	15
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-B44:26	DEIFSATSF	0.9946	0.9744	6	15
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-B44:07	DEIFSATSF	0.9946	0.9744	6	15
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-B35:28	TSFDEMAKY	0.9938	0.9506	12	21
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-B35:11	TSFDEMAKY	0.9912	0.9265	12	21
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-C03:17	FSATSFDEM	0.9901	0.9759	9	18
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-C03:05	FSATSFDEM	0.9892	0.9354	9	18
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-B57:04	TSFDEMAKY	0.9889	0.6688	12	21
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-B15:125	TSFDEMAKY	0.9876	0.921	12	21
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-B15:33	TSFDEMAKY	0.9876	0.921	12	21
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-B15:34	TSFDEMAKY	0.9876	0.921	12	21
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-B35:20	TSFDEMAKY	0.9865	0.9577	12	21
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-B15:27	TSFDEMAKY	0.986	0.9137	12	21
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-B15:135	TSFDEMAKY	0.9851	0.9133	12	21
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-B35:77	TSFDEMAKY	0.9847	0.9397	12	21
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-B35:23	TSFDEMAKY	0.9832	0.9373	12	21
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-B35:24	DEIFSATSF	0.9809	0.9089	6	15
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-B15:50	TSFDEMAKY	0.9775	0.9427	12	21
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-C16:04	FSATSFDEM	0.9751	0.9931	9	18
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-B15:11	TSFDEMAKY	0.9719	0.8924	12	21
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-B15:08	TSFDEMAKY	0.9604	0.9015	12	21
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-B35:30	TSFDEMAKY	0.9587	0.844	12	21
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-B35:17	TSFDEMAKY	0.9587	0.844	12	21
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-B15:24	TSFDEMAKY	0.9566	0.8798	12	21
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-C03:02	TSFDEMAKY	0.9553	0.9658	12	21
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-B18:11	DEIFSATSF	0.9552	0.831	6	15
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-B35:43	TSFDEMAKY	0.9492	0.9025	12	21
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-B15:13	TSFDEMAKY	0.9484	0.6305	12	21
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-C12:02	FSATSFDEM	0.9317	0.9857	9	18
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-B35:24	TSFDEMAKY	0.9239	0.9472	12	21
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-B58:06	TSFDEMAKY	0.9188	0.7793	12	21
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-B15:12	TSFDEMAKY	0.9023	0.9078	12	21
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-C03:06	FSATSFDEM	0.8998	0.9914	9	18
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-C15:09	TSFDEMAKY	0.8937	0.9219	12	21
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-B35:13	FSATSFDEM	0.8922	0.943	9	18
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-C08:01	FSATSFDEM	0.8762	0.9915	9	18
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-C12:03	FSATSFDEM	0.872	0.9915	9	18
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-B15:53	TSFDEMAKY	0.8481	0.9116	12	21
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-A25:01	TSFDEMAKY	0.7902	0.7587	12	21
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-B35:20	DEIFSATSF	0.7875	0.9117	6	15
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-C16:01	FSATSFDEM	0.7726	0.9877	9	18
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-C07:01	TSFDEMAKY	0.6612	0.7503	12	21
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-C16:02	FSATSFDEM	0.6467	0.9939	9	18
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-C12:02	TSFDEMAKY	0.5677	0.9758	12	21
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-C16:04	TSFDEMAKY	0.5147	0.9862	12	21
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-B18:04	TSFDEMAKY	0.3407	0.9571	12	21
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-C12:03	TSFDEMAKY	0.3004	0.9861	12	21
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-B39:31	DEIFSATSF	0.2988	0.9379	6	15
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-B18:07	TSFDEMAKY	0.219	0.9341	12	21
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-C02:10	FSATSFDEM	0.2122	0.9881	9	18
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-C02:02	FSATSFDEM	0.2122	0.9881	9	18
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-C16:01	TSFDEMAKY	0.2062	0.9814	12	21
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-B07:13	FSATSFDEM	0.2019	0.8497	9	18
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-C17:01	FSATSFDEM	0.1011	0.935	9	18
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-C16:02	TSFDEMAKY	0.0686	0.9933	12	21
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-C02:10	TSFDEMAKY	0.006	0.9857	12	21
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-C02:02	TSFDEMAKY	0.006	0.9857	12	21
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-C15:09	ATSFDEMAKY	0.9799	0.9342	11	21
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-B18:11	FDEIFSATSF	0.9682	0.9248	5	15
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-B18:08	FDEIFSATSF	0.9574	0.8453	5	15
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-B18:05	FDEIFSATSF	0.9509	0.939	5	15
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-B18:03	FDEIFSATSF	0.9291	0.9337	5	15
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-A25:01	ATSFDEMAKY	0.7002	0.8288	11	21
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-C04:03	KFDEIFSATSF	1	0.8033	4	15
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-C04:01	KFDEIFSATSF	1	0.7942	4	15
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-C18:01	KFDEIFSATSF	1	0.8101	4	15
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-C04:04	KFDEIFSATSF	0.9969	0.8713	4	15
RAD50-LIPF	chr5	131915194	chr10	90429593	938	HLA-B15:53	KFDEIFSATSF	0.9956	0.954	4	15

Top

Potential FusionNeoAntigen Information of RAD50-LIPF in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of RAD50-LIPF

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
1065	DEIFSATSFDEMAK	RAD50	LIPF	chr5	131915194	chr10	90429593	938

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of RAD50-LIPF

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	1065	DEIFSATSFDEMAK	-8.07193	-9.10723
HLA-B14:02	3BVN	1065	DEIFSATSFDEMAK	-5.6717	-5.7851
HLA-B52:01	3W39	1065	DEIFSATSFDEMAK	-6.80111	-6.91451
HLA-B52:01	3W39	1065	DEIFSATSFDEMAK	-5.33901	-6.37431
HLA-A11:01	4UQ2	1065	DEIFSATSFDEMAK	0.826127	-0.209173
HLA-A24:02	5HGA	1065	DEIFSATSFDEMAK	-7.35218	-7.46558
HLA-A24:02	5HGA	1065	DEIFSATSFDEMAK	-5.67477	-6.71007
HLA-B27:05	6PYJ	1065	DEIFSATSFDEMAK	-4.09359	-5.12889
HLA-B44:05	3DX8	1065	DEIFSATSFDEMAK	-9.22453	-9.33793
HLA-B44:05	3DX8	1065	DEIFSATSFDEMAK	-3.65976	-4.69506

Top

Vaccine Design for the FusionNeoAntigens of RAD50-LIPF

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
RAD50-LIPF	chr5	131915194	chr10	90429593	10	21	SATSFDEMAKY	AGCAACAAGCTTTGATGAAATGGCTAAATATGA
RAD50-LIPF	chr5	131915194	chr10	90429593	11	21	ATSFDEMAKY	AACAAGCTTTGATGAAATGGCTAAATATGA
RAD50-LIPF	chr5	131915194	chr10	90429593	12	21	TSFDEMAKY	AAGCTTTGATGAAATGGCTAAATATGA
RAD50-LIPF	chr5	131915194	chr10	90429593	4	15	KFDEIFSATSF	GTTTGATGAGATTTTTTCAGCAACAAGCTTTGA
RAD50-LIPF	chr5	131915194	chr10	90429593	5	15	FDEIFSATSF	TGATGAGATTTTTTCAGCAACAAGCTTTGA
RAD50-LIPF	chr5	131915194	chr10	90429593	6	15	DEIFSATSF	TGAGATTTTTTCAGCAACAAGCTTTGA
RAD50-LIPF	chr5	131915194	chr10	90429593	9	18	FSATSFDEM	TTCAGCAACAAGCTTTGATGAAATGGC

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of RAD50-LIPF

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
Non-Cancer	RAD50-LIPF	chr5	131915194	ENST00000265335	chr10	90429593	ENST00000238983	131Nd

Top

Potential target of CAR-T therapy development for RAD50-LIPF

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to RAD50-LIPF

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to RAD50-LIPF

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)