Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:RBM10-WWP2

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: RBM10-WWP2
	FusionPDB ID: 72754
	FusionGDB2.0 ID: 72754
		Hgene	Tgene
	Gene symbol	RBM10	WWP2
	Gene ID	8241	11060
	Gene name	RNA binding motif protein 10	WW domain containing E3 ubiquitin protein ligase 2
	Synonyms	DXS8237E\|GPATC9\|GPATCH9\|S1-1\|TARPS\|ZRANB5	AIP2\|WWp2-like
	Cytomap	Xp11.3	16q22.1
	Type of gene	protein-coding	protein-coding
	Description	RNA-binding protein 10RNA-binding protein S1-1epididymis secretory sperm binding proteing patch domain-containing protein 9	NEDD4-like E3 ubiquitin-protein ligase WWP2HECT-type E3 ubiquitin transferase WWP2atrophin-1 interacting protein 2
	Modification date	20200313	20200327
	UniProtAcc	.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000329236, ENST00000345781, ENST00000377604, ENST00000478410,	ENST00000542271, ENST00000544162, ENST00000568684, ENST00000356003, ENST00000569174, ENST00000359154, ENST00000448661,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	17 X 8 X 9=1224	13 X 14 X 9=1638
	# samples	18	16
	** MAII score	log2(18/1224*10)=-2.76553474636298 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(16/1638*10)=-3.35579154675365 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: RBM10 [Title/Abstract] AND WWP2 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: RBM10 [Title/Abstract] AND WWP2 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	RBM10(47006897)-WWP2(69967872), # samples:1
Anticipated loss of major functional domain due to fusion event.	RBM10-WWP2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. RBM10-WWP2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. RBM10-WWP2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. RBM10-WWP2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Tgene	WWP2	GO:0016567	protein ubiquitination	18776082\|26280536
Tgene	WWP2	GO:0032410	negative regulation of transporter activity	18776082
Tgene	WWP2	GO:0034765	regulation of ion transmembrane transport	17289006
Tgene	WWP2	GO:0042391	regulation of membrane potential	17289006
Tgene	WWP2	GO:0051865	protein autoubiquitination	24105792
Tgene	WWP2	GO:1901016	regulation of potassium ion transmembrane transporter activity	17289006

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chrX:47006897/chr16:69967872)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across RBM10 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across WWP2 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000377604	RBM10	chrX	47006897	+	ENST00000359154	WWP2	chr16	69967872	+	3491	759	424	1689	421
ENST00000377604	RBM10	chrX	47006897	+	ENST00000448661	WWP2	chr16	69967872	+	3490	759	424	1689	421
ENST00000329236	RBM10	chrX	47006897	+	ENST00000359154	WWP2	chr16	69967872	+	3128	396	61	1326	421
ENST00000329236	RBM10	chrX	47006897	+	ENST00000448661	WWP2	chr16	69967872	+	3127	396	61	1326	421
ENST00000345781	RBM10	chrX	47006897	+	ENST00000359154	WWP2	chr16	69967872	+	3081	349	14	1279	421
ENST00000345781	RBM10	chrX	47006897	+	ENST00000448661	WWP2	chr16	69967872	+	3080	349	14	1279	421

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000377604	ENST00000359154	RBM10	chrX	47006897	+	WWP2	chr16	69967872	+	0.008452863	0.99154717
ENST00000377604	ENST00000448661	RBM10	chrX	47006897	+	WWP2	chr16	69967872	+	0.008529192	0.99147075
ENST00000329236	ENST00000359154	RBM10	chrX	47006897	+	WWP2	chr16	69967872	+	0.008924786	0.99107516
ENST00000329236	ENST00000448661	RBM10	chrX	47006897	+	WWP2	chr16	69967872	+	0.008990437	0.9910096
ENST00000345781	ENST00000359154	RBM10	chrX	47006897	+	WWP2	chr16	69967872	+	0.008738863	0.9912612
ENST00000345781	ENST00000448661	RBM10	chrX	47006897	+	WWP2	chr16	69967872	+	0.008816578	0.9911834

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for RBM10-WWP2

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
RBM10	chrX	47006897	WWP2	chr16	69967872	349	111	SPRRPYQDMEYERREWFFLLSHEVLN
RBM10	chrX	47006897	WWP2	chr16	69967872	396	111	SPRRPYQDMEYERREWFFLLSHEVLN
RBM10	chrX	47006897	WWP2	chr16	69967872	759	111	SPRRPYQDMEYERREWFFLLSHEVLN

Top

Potential FusionNeoAntigen Information of RBM10-WWP2 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

RBM10-WWP2_47006897_69967872.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-B44:03	MEYERREW	0.9997	0.919	8	16
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-B27:07	RREWFFLL	0.9995	0.6481	12	20
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-B18:01	MEYERREW	0.996	0.7451	8	16
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-B18:01	YERREWFF	0.9959	0.9004	10	18
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-B44:03	MEYERREWF	0.9961	0.8796	8	17
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-B14:01	ERREWFFLL	0.9954	0.812	11	20
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-B14:02	ERREWFFLL	0.9954	0.812	11	20
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-B18:01	MEYERREWF	0.9938	0.7485	8	17
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-B27:05	ERREWFFLL	0.9935	0.672	11	20
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-B27:04	ERREWFFLL	0.993	0.6354	11	20
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-B27:05	RREWFFLLSH	0.999	0.7411	12	22
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-B27:04	RREWFFLLSH	0.9987	0.7943	12	22
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-B44:03	QDMEYERREW	0.9955	0.9666	6	16
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-B18:01	MEYERREWFF	0.9858	0.7904	8	18
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-B27:14	RREWFFLL	0.9994	0.8347	12	20
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-B27:03	RREWFFLL	0.9801	0.9099	12	20
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-B27:14	ERREWFFLL	0.9946	0.6232	11	20
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-C07:27	ERREWFFLL	0.9857	0.9179	11	20
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-C07:95	ERREWFFLL	0.9845	0.5602	11	20
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-B39:12	ERREWFFLL	0.9818	0.9098	11	20
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-C07:05	ERREWFFLL	0.9775	0.9132	11	20
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-B73:01	ERREWFFLL	0.9218	0.7146	11	20
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-C07:19	ERREWFFLL	0.9126	0.6861	11	20
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-C07:10	ERREWFFLL	0.9025	0.9544	11	20
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-B27:03	ERREWFFLL	0.8075	0.714	11	20
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-B14:03	ERREWFFLL	0.5155	0.8375	11	20
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-B27:14	RREWFFLLSH	0.9988	0.7188	12	22
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-B44:08	QDMEYERREW	0.9915	0.6543	6	16
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-B27:03	RREWFFLLSH	0.9661	0.7644	12	22
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-B44:26	MEYERREW	0.9997	0.919	8	16
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-B44:13	MEYERREW	0.9997	0.919	8	16
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-B44:07	MEYERREW	0.9997	0.919	8	16
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-B27:09	RREWFFLL	0.9993	0.8877	12	20
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-B18:06	YERREWFF	0.9973	0.8693	10	18
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-B18:05	MEYERREW	0.996	0.7451	8	16
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-B18:05	YERREWFF	0.9959	0.9004	10	18
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-B18:08	MEYERREW	0.9958	0.7426	8	16
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-B18:08	YERREWFF	0.9956	0.8189	10	18
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-B18:03	MEYERREW	0.9953	0.7187	8	16
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-B18:06	MEYERREW	0.995	0.7387	8	16
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-B18:03	YERREWFF	0.9945	0.8857	10	18
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-B18:11	MEYERREW	0.9944	0.7878	8	16
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-B27:06	ERREWFFLL	0.9978	0.6144	11	20
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-B44:13	MEYERREWF	0.9961	0.8796	8	17
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-B44:26	MEYERREWF	0.9961	0.8796	8	17
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-B44:07	MEYERREWF	0.9961	0.8796	8	17
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-B18:04	MEYERREWF	0.9953	0.7582	8	17
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-B18:07	MEYERREWF	0.9949	0.7107	8	17
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-B18:06	MEYERREWF	0.9943	0.7364	8	17
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-B18:05	MEYERREWF	0.9938	0.7485	8	17
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-B18:08	MEYERREWF	0.9937	0.6897	8	17
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-B27:08	ERREWFFLL	0.9937	0.5802	11	20
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-B27:10	ERREWFFLL	0.9928	0.7335	11	20
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-B18:03	MEYERREWF	0.9915	0.7302	8	17
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-B27:09	ERREWFFLL	0.9894	0.6463	11	20
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-B40:04	YERREWFFL	0.9868	0.6827	10	19
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-C07:01	ERREWFFLL	0.9862	0.5584	11	20
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-B39:31	ERREWFFLL	0.9822	0.9031	11	20
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-B18:11	MEYERREWF	0.9797	0.7807	8	17
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-B40:04	MEYERREWF	0.9741	0.6282	8	17
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-C07:22	ERREWFFLL	0.7611	0.5832	11	20
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-C06:08	ERREWFFLL	0.7036	0.9838	11	20
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-B41:03	MEYERREWF	0.5846	0.5394	8	17
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-B15:13	DMEYERREW	0.4396	0.6761	7	16
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-C06:17	ERREWFFLL	0.3542	0.9917	11	20
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-C06:02	ERREWFFLL	0.3542	0.9917	11	20
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-B48:02	MEYERREWF	0.3233	0.7941	8	17
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-B15:53	MEYERREWF	0.2786	0.8353	8	17
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-B15:54	MEYERREWF	0.2155	0.7806	8	17
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-B27:08	RREWFFLLSH	0.9989	0.6699	12	22
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-B27:10	RREWFFLLSH	0.9987	0.8617	12	22
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-B44:07	QDMEYERREW	0.9955	0.9666	6	16
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-B44:13	QDMEYERREW	0.9955	0.9666	6	16
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-B44:26	QDMEYERREW	0.9955	0.9666	6	16
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-B18:08	MEYERREWFF	0.9878	0.7225	8	18
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-B18:05	MEYERREWFF	0.9858	0.7904	8	18
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-B18:03	MEYERREWFF	0.9767	0.7728	8	18
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-B18:11	MEYERREWFF	0.9718	0.8005	8	18
RBM10-WWP2	chrX	47006897	chr16	69967872	396	HLA-B18:03	DMEYERREWF	0.6635	0.8829	7	17

Top

Potential FusionNeoAntigen Information of RBM10-WWP2 in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of RBM10-WWP2

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
7189	QDMEYERREWFFLL	RBM10	WWP2	chrX	47006897	chr16	69967872	396

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of RBM10-WWP2

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	7189	QDMEYERREWFFLL	-6.88453	-7.02263
HLA-B14:02	3BVN	7189	QDMEYERREWFFLL	-6.57082	-6.70892
HLA-B14:02	3BVN	7189	QDMEYERREWFFLL	-6.17025	-7.23025
HLA-B14:02	3BVN	7189	QDMEYERREWFFLL	-6.15289	-8.56159
HLA-B14:02	3BVN	7189	QDMEYERREWFFLL	-5.74138	-6.80138
HLA-B14:02	3BVN	7189	QDMEYERREWFFLL	-5.60275	-7.82175
HLA-B14:02	3BVN	7189	QDMEYERREWFFLL	-5.38146	-7.60046
HLA-B14:02	3BVN	7189	QDMEYERREWFFLL	-3.88187	-6.29057
HLA-B52:01	3W39	7189	QDMEYERREWFFLL	-6.47364	-6.61174
HLA-B52:01	3W39	7189	QDMEYERREWFFLL	-5.97114	-6.10924
HLA-B52:01	3W39	7189	QDMEYERREWFFLL	-5.18843	-7.40743
HLA-B52:01	3W39	7189	QDMEYERREWFFLL	-4.88623	-7.29493
HLA-B52:01	3W39	7189	QDMEYERREWFFLL	-4.87911	-5.93911
HLA-B52:01	3W39	7189	QDMEYERREWFFLL	-4.68426	-6.90326
HLA-B52:01	3W39	7189	QDMEYERREWFFLL	-4.54817	-5.60817
HLA-B52:01	3W39	7189	QDMEYERREWFFLL	-4.4269	-6.8356
HLA-A11:01	4UQ2	7189	QDMEYERREWFFLL	-7.76733	-7.90543
HLA-A11:01	4UQ2	7189	QDMEYERREWFFLL	-7.61697	-7.75507
HLA-A24:02	5HGA	7189	QDMEYERREWFFLL	-7.19593	-7.33403
HLA-A24:02	5HGA	7189	QDMEYERREWFFLL	-6.90061	-7.03871
HLA-A24:02	5HGA	7189	QDMEYERREWFFLL	-6.35856	-7.41856
HLA-A24:02	5HGA	7189	QDMEYERREWFFLL	-5.41946	-7.63846
HLA-A24:02	5HGA	7189	QDMEYERREWFFLL	-5.15874	-6.21874
HLA-A24:02	5HGA	7189	QDMEYERREWFFLL	-4.71874	-6.93774
HLA-A24:02	5HGA	7189	QDMEYERREWFFLL	-4.08464	-6.49334
HLA-A24:02	5HGA	7189	QDMEYERREWFFLL	-4.08463	-6.49333
HLA-B27:05	6PYJ	7189	QDMEYERREWFFLL	-6.10349	-6.24159
HLA-B27:05	6PYJ	7189	QDMEYERREWFFLL	-4.85194	-4.99004
HLA-B44:05	3DX8	7189	QDMEYERREWFFLL	-5.68398	-5.82208
HLA-B44:05	3DX8	7189	QDMEYERREWFFLL	-5.56071	-5.69881
HLA-B44:05	3DX8	7189	QDMEYERREWFFLL	-4.9012	-7.3099
HLA-B44:05	3DX8	7189	QDMEYERREWFFLL	-4.6205	-5.6805
HLA-B44:05	3DX8	7189	QDMEYERREWFFLL	-4.13943	-5.19943
HLA-B44:05	3DX8	7189	QDMEYERREWFFLL	-3.42881	-5.64781
HLA-B44:05	3DX8	7189	QDMEYERREWFFLL	-2.87114	-5.27984
HLA-B44:05	3DX8	7189	QDMEYERREWFFLL	-2.55572	-4.77472
HLA-A02:01	6TDR	7189	QDMEYERREWFFLL	-2.83544	-2.97354
HLA-A02:01	6TDR	7189	QDMEYERREWFFLL	-2.67108	-2.80918

Top

Vaccine Design for the FusionNeoAntigens of RBM10-WWP2

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
RBM10-WWP2	chrX	47006897	chr16	69967872	10	18	YERREWFF	TGAAAGACGAGAGTGGTTTTTCCT
RBM10-WWP2	chrX	47006897	chr16	69967872	10	19	YERREWFFL	TGAAAGACGAGAGTGGTTTTTCCTCCT
RBM10-WWP2	chrX	47006897	chr16	69967872	11	20	ERREWFFLL	AAGACGAGAGTGGTTTTTCCTCCTGTC
RBM10-WWP2	chrX	47006897	chr16	69967872	12	20	RREWFFLL	ACGAGAGTGGTTTTTCCTCCTGTC
RBM10-WWP2	chrX	47006897	chr16	69967872	12	22	RREWFFLLSH	ACGAGAGTGGTTTTTCCTCCTGTCTCATGA
RBM10-WWP2	chrX	47006897	chr16	69967872	6	16	QDMEYERREW	GGACATGGAGTATGAAAGACGAGAGTGGTT
RBM10-WWP2	chrX	47006897	chr16	69967872	7	16	DMEYERREW	CATGGAGTATGAAAGACGAGAGTGGTT
RBM10-WWP2	chrX	47006897	chr16	69967872	7	17	DMEYERREWF	CATGGAGTATGAAAGACGAGAGTGGTTTTT
RBM10-WWP2	chrX	47006897	chr16	69967872	8	16	MEYERREW	GGAGTATGAAAGACGAGAGTGGTT
RBM10-WWP2	chrX	47006897	chr16	69967872	8	17	MEYERREWF	GGAGTATGAAAGACGAGAGTGGTTTTT
RBM10-WWP2	chrX	47006897	chr16	69967872	8	18	MEYERREWFF	GGAGTATGAAAGACGAGAGTGGTTTTTCCT

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of RBM10-WWP2

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
N/A	RBM10-WWP2	chrX	47006897	ENST00000329236	chr16	69967872	ENST00000359154	DA936538

Top

Potential target of CAR-T therapy development for RBM10-WWP2

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to RBM10-WWP2

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to RBM10-WWP2

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)