Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:RBM4-DPP3

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: RBM4-DPP3
	FusionPDB ID: 72950
	FusionGDB2.0 ID: 72950
		Hgene	Tgene
	Gene symbol	RBM4	DPP3
	Gene ID	5936	10072
	Gene name	RNA binding motif protein 4	dipeptidyl peptidase 3
	Synonyms	LARK\|RBM4A\|ZCCHC21\|ZCRB3A	DPPIII
	Cytomap	11q13.2	11q13.2
	Type of gene	protein-coding	protein-coding
	Description	RNA-binding protein 4RNA-binding motif protein 4alark homologtranscriptional coactivator CoAZzinc finger CCHC-type and RNA binding motif 3A	dipeptidyl peptidase 3DPP IIIdipeptidyl aminopeptidase IIIdipeptidyl arylamidase IIIdipeptidyl peptidase IIIenkephalinase B
	Modification date	20200322	20200313
	UniProtAcc	.	Q9NY33 Main function of 5'-partner protein: FUNCTION: Cleaves and degrades bioactive peptides, including angiotensin, Leu-enkephalin and Met-enkephalin (PubMed:3233187, PubMed:1515063). Also cleaves Arg-Arg-beta-naphthylamide (in vitro) (PubMed:9425109, PubMed:3233187, PubMed:11209758). {ECO:0000269\|PubMed:11209758, ECO:0000269\|PubMed:1515063, ECO:0000269\|PubMed:3233187, ECO:0000269\|PubMed:9425109}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000310092, ENST00000396053, ENST00000398692, ENST00000408993, ENST00000409406, ENST00000483858, ENST00000503028, ENST00000506523, ENST00000530235, ENST00000532968, ENST00000578778, ENST00000514361, ENST00000515838,	ENST00000533799, ENST00000360510, ENST00000453114, ENST00000530165, ENST00000532677, ENST00000541961, ENST00000531863,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	10 X 10 X 7=700	10 X 9 X 4=360
	# samples	14	10
	** MAII score	log2(14/700*10)=-2.32192809488736 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(10/360*10)=-1.84799690655495 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: RBM4 [Title/Abstract] AND DPP3 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: RBM4 [Title/Abstract] AND DPP3 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	RBM4(66407594)-DPP3(66276550), # samples:1
Anticipated loss of major functional domain due to fusion event.	RBM4-DPP3 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. RBM4-DPP3 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. RBM4-DPP3 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. RBM4-DPP3 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. RBM4-DPP3 seems lost the major protein functional domain in Hgene partner, which is a essential gene due to the frame-shifted ORF. RBM4-DPP3 seems lost the major protein functional domain in Hgene partner, which is a tumor suppressor due to the frame-shifted ORF. RBM4-DPP3 seems lost the major protein functional domain in Tgene partner, which is a essential gene due to the frame-shifted ORF. RBM4-DPP3 seems lost the major protein functional domain in Tgene partner, which is a IUPHAR drug target due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	RBM4	GO:0000381	regulation of alternative mRNA splicing, via spliceosome	12628928\|16260624\|16777844\|16934801\|21518792
Hgene	RBM4	GO:0002190	cap-independent translational initiation	17284590
Hgene	RBM4	GO:0002192	IRES-dependent translational initiation of linear mRNA	17284590
Hgene	RBM4	GO:0017148	negative regulation of translation	17284590
Hgene	RBM4	GO:0032055	negative regulation of translation in response to stress	17284590
Hgene	RBM4	GO:0035278	miRNA mediated inhibition of translation	19801630
Hgene	RBM4	GO:0045947	negative regulation of translational initiation	19801630
Hgene	RBM4	GO:0046685	response to arsenic-containing substance	17284590
Hgene	RBM4	GO:0046822	regulation of nucleocytoplasmic transport	12628928\|17284590
Hgene	RBM4	GO:0051149	positive regulation of muscle cell differentiation	21518792
Tgene	DPP3	GO:0006508	proteolysis	9425109\|10387075

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr11:66407594/chr11:66276550)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across RBM4 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across DPP3 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000503028	RBM4	chr11	66407594	+	ENST00000531863	DPP3	chr11	66276550	+	1323	851	439	1023	194
ENST00000310092	RBM4	chr11	66407594	+	ENST00000531863	DPP3	chr11	66276550	+	1032	560	118	732	204
ENST00000396053	RBM4	chr11	66407594	+	ENST00000531863	DPP3	chr11	66276550	+	982	510	68	682	204
ENST00000408993	RBM4	chr11	66407594	+	ENST00000531863	DPP3	chr11	66276550	+	1118	646	63	818	251
ENST00000578778	RBM4	chr11	66407594	+	ENST00000531863	DPP3	chr11	66276550	+	958	486	44	658	204
ENST00000483858	RBM4	chr11	66407594	+	ENST00000532677	DPP3	chr11	66276550	+	1703	1124	1160	1576	138
ENST00000483858	RBM4	chr11	66407594	+	ENST00000541961	DPP3	chr11	66276550	+	1703	1124	1160	1576	138
ENST00000483858	RBM4	chr11	66407594	+	ENST00000530165	DPP3	chr11	66276550	+	1391	1124	332	616	94
ENST00000398692	RBM4	chr11	66407594	+	ENST00000531863	DPP3	chr11	66276550	+	951	479	37	651	204
ENST00000506523	RBM4	chr11	66407594	+	ENST00000531863	DPP3	chr11	66276550	+	931	459	17	631	204
ENST00000530235	RBM4	chr11	66407594	+	ENST00000531863	DPP3	chr11	66276550	+	1070	598	15	770	251
ENST00000532968	RBM4	chr11	66407594	+	ENST00000532677	DPP3	chr11	66276550	+	912	333	369	785	138
ENST00000532968	RBM4	chr11	66407594	+	ENST00000541961	DPP3	chr11	66276550	+	912	333	369	785	138
ENST00000532968	RBM4	chr11	66407594	+	ENST00000530165	DPP3	chr11	66276550	+	600	333	369	599	77
ENST00000409406	RBM4	chr11	66407594	+	ENST00000531863	DPP3	chr11	66276550	+	1661	1189	726	1361	211

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000503028	ENST00000531863	RBM4	chr11	66407594	+	DPP3	chr11	66276550	+	0.004753386	0.9952466
ENST00000310092	ENST00000531863	RBM4	chr11	66407594	+	DPP3	chr11	66276550	+	0.002743802	0.9972562
ENST00000396053	ENST00000531863	RBM4	chr11	66407594	+	DPP3	chr11	66276550	+	0.003358335	0.99664164
ENST00000408993	ENST00000531863	RBM4	chr11	66407594	+	DPP3	chr11	66276550	+	0.003505212	0.9964948
ENST00000578778	ENST00000531863	RBM4	chr11	66407594	+	DPP3	chr11	66276550	+	0.003208936	0.99679106
ENST00000483858	ENST00000532677	RBM4	chr11	66407594	+	DPP3	chr11	66276550	+	0.91961515	0.08038485
ENST00000483858	ENST00000541961	RBM4	chr11	66407594	+	DPP3	chr11	66276550	+	0.91961515	0.08038485
ENST00000483858	ENST00000530165	RBM4	chr11	66407594	+	DPP3	chr11	66276550	+	0.9406466	0.059353475
ENST00000398692	ENST00000531863	RBM4	chr11	66407594	+	DPP3	chr11	66276550	+	0.003247871	0.99675214
ENST00000506523	ENST00000531863	RBM4	chr11	66407594	+	DPP3	chr11	66276550	+	0.003181607	0.9968184
ENST00000530235	ENST00000531863	RBM4	chr11	66407594	+	DPP3	chr11	66276550	+	0.003587751	0.9964122
ENST00000532968	ENST00000532677	RBM4	chr11	66407594	+	DPP3	chr11	66276550	+	0.8579948	0.14200525
ENST00000532968	ENST00000541961	RBM4	chr11	66407594	+	DPP3	chr11	66276550	+	0.8579948	0.14200525
ENST00000532968	ENST00000530165	RBM4	chr11	66407594	+	DPP3	chr11	66276550	+	0.3376439	0.66235614
ENST00000409406	ENST00000531863	RBM4	chr11	66407594	+	DPP3	chr11	66276550	+	0.003353112	0.9966468

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for RBM4-DPP3

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
RBM4	chr11	66407594	DPP3	chr11	66276550	1189	154	VEAIRGLDNTEFQGSDVQLLEYEASA
RBM4	chr11	66407594	DPP3	chr11	66276550	459	147	VEAIRGLDNTEFQGSDVQLLEYEASA
RBM4	chr11	66407594	DPP3	chr11	66276550	479	147	VEAIRGLDNTEFQGSDVQLLEYEASA
RBM4	chr11	66407594	DPP3	chr11	66276550	486	147	VEAIRGLDNTEFQGSDVQLLEYEASA
RBM4	chr11	66407594	DPP3	chr11	66276550	510	147	VEAIRGLDNTEFQGSDVQLLEYEASA
RBM4	chr11	66407594	DPP3	chr11	66276550	560	147	VEAIRGLDNTEFQGSDVQLLEYEASA
RBM4	chr11	66407594	DPP3	chr11	66276550	598	194	VEAIRGLDNTEFQGSDVQLLEYEASA
RBM4	chr11	66407594	DPP3	chr11	66276550	646	194	VEAIRGLDNTEFQGSDVQLLEYEASA
RBM4	chr11	66407594	DPP3	chr11	66276550	851	137	VEAIRGLDNTEFQGSDVQLLEYEASA

Top

Potential FusionNeoAntigen Information of RBM4-DPP3 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

RBM4-DPP3_66407594_66276550.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
RBM4-DPP3	chr11	66407594	chr11	66276550	560	HLA-A02:22	FQGSDVQLL	0.8863	0.5507	11	20
RBM4-DPP3	chr11	66407594	chr11	66276550	560	HLA-A02:21	FQGSDVQLL	0.842	0.6758	11	20
RBM4-DPP3	chr11	66407594	chr11	66276550	560	HLA-B48:01	FQGSDVQLL	0.8108	0.751	11	20
RBM4-DPP3	chr11	66407594	chr11	66276550	560	HLA-B39:13	FQGSDVQLL	0.5755	0.9751	11	20
RBM4-DPP3	chr11	66407594	chr11	66276550	560	HLA-B38:01	FQGSDVQLL	0.5028	0.9849	11	20
RBM4-DPP3	chr11	66407594	chr11	66276550	560	HLA-B13:02	FQGSDVQLL	0.4441	0.8338	11	20
RBM4-DPP3	chr11	66407594	chr11	66276550	560	HLA-B13:01	FQGSDVQLL	0.3513	0.9919	11	20
RBM4-DPP3	chr11	66407594	chr11	66276550	560	HLA-A02:19	FQGSDVQLL	0.2241	0.6631	11	20
RBM4-DPP3	chr11	66407594	chr11	66276550	560	HLA-B40:01	TEFQGSDVQL	0.9958	0.5929	9	19
RBM4-DPP3	chr11	66407594	chr11	66276550	560	HLA-B48:01	TEFQGSDVQL	0.9842	0.8469	9	19
RBM4-DPP3	chr11	66407594	chr11	66276550	560	HLA-B44:03	TEFQGSDVQL	0.97	0.9719	9	19
RBM4-DPP3	chr11	66407594	chr11	66276550	560	HLA-B44:02	TEFQGSDVQL	0.9486	0.5113	9	19
RBM4-DPP3	chr11	66407594	chr11	66276550	560	HLA-B44:05	TEFQGSDVQL	0.9375	0.7359	9	19
RBM4-DPP3	chr11	66407594	chr11	66276550	560	HLA-B47:01	TEFQGSDVQL	0.9341	0.6224	9	19
RBM4-DPP3	chr11	66407594	chr11	66276550	560	HLA-B39:13	TEFQGSDVQL	0.8777	0.9716	9	19
RBM4-DPP3	chr11	66407594	chr11	66276550	560	HLA-B41:01	TEFQGSDVQL	0.6525	0.9722	9	19
RBM4-DPP3	chr11	66407594	chr11	66276550	560	HLA-B40:01	TEFQGSDVQLL	0.9987	0.5604	9	20
RBM4-DPP3	chr11	66407594	chr11	66276550	560	HLA-B44:02	TEFQGSDVQLL	0.9943	0.511	9	20
RBM4-DPP3	chr11	66407594	chr11	66276550	560	HLA-B44:03	TEFQGSDVQLL	0.9942	0.9874	9	20
RBM4-DPP3	chr11	66407594	chr11	66276550	560	HLA-B47:01	TEFQGSDVQLL	0.991	0.6475	9	20
RBM4-DPP3	chr11	66407594	chr11	66276550	560	HLA-B44:05	TEFQGSDVQLL	0.989	0.7053	9	20
RBM4-DPP3	chr11	66407594	chr11	66276550	560	HLA-B39:13	TEFQGSDVQLL	0.9735	0.9792	9	20
RBM4-DPP3	chr11	66407594	chr11	66276550	560	HLA-B48:03	FQGSDVQL	0.8912	0.7484	11	19
RBM4-DPP3	chr11	66407594	chr11	66276550	560	HLA-A02:05	FQGSDVQLL	0.905	0.5073	11	20
RBM4-DPP3	chr11	66407594	chr11	66276550	560	HLA-B39:08	FQGSDVQLL	0.603	0.9291	11	20
RBM4-DPP3	chr11	66407594	chr11	66276550	560	HLA-C02:06	FQGSDVQLL	0.5487	0.9714	11	20
RBM4-DPP3	chr11	66407594	chr11	66276550	560	HLA-B48:03	FQGSDVQLL	0.4669	0.6108	11	20
RBM4-DPP3	chr11	66407594	chr11	66276550	560	HLA-B40:06	TEFQGSDVQL	0.9989	0.8744	9	19
RBM4-DPP3	chr11	66407594	chr11	66276550	560	HLA-B48:03	TEFQGSDVQL	0.9943	0.6781	9	19
RBM4-DPP3	chr11	66407594	chr11	66276550	560	HLA-B40:03	TEFQGSDVQL	0.9835	0.5595	9	19
RBM4-DPP3	chr11	66407594	chr11	66276550	560	HLA-B44:10	TEFQGSDVQL	0.9831	0.745	9	19
RBM4-DPP3	chr11	66407594	chr11	66276550	560	HLA-B44:04	TEFQGSDVQL	0.9705	0.5031	9	19
RBM4-DPP3	chr11	66407594	chr11	66276550	560	HLA-B39:08	TEFQGSDVQL	0.9569	0.9619	9	19
RBM4-DPP3	chr11	66407594	chr11	66276550	560	HLA-B44:09	TEFQGSDVQL	0.9516	0.6954	9	19
RBM4-DPP3	chr11	66407594	chr11	66276550	560	HLA-B40:03	TEFQGSDVQLL	0.998	0.5344	9	20
RBM4-DPP3	chr11	66407594	chr11	66276550	560	HLA-B48:03	TEFQGSDVQLL	0.9974	0.6211	9	20
RBM4-DPP3	chr11	66407594	chr11	66276550	560	HLA-B44:10	TEFQGSDVQLL	0.9955	0.6815	9	20
RBM4-DPP3	chr11	66407594	chr11	66276550	560	HLA-B44:09	TEFQGSDVQLL	0.9943	0.7157	9	20
RBM4-DPP3	chr11	66407594	chr11	66276550	560	HLA-B39:08	TEFQGSDVQLL	0.9847	0.963	9	20
RBM4-DPP3	chr11	66407594	chr11	66276550	560	HLA-B15:05	FQGSDVQLLEY	0.9798	0.7179	11	22
RBM4-DPP3	chr11	66407594	chr11	66276550	560	HLA-B40:12	FQGSDVQL	0.8912	0.7484	11	19
RBM4-DPP3	chr11	66407594	chr11	66276550	560	HLA-A02:14	FQGSDVQLL	0.8462	0.6447	11	20
RBM4-DPP3	chr11	66407594	chr11	66276550	560	HLA-A02:06	FQGSDVQLL	0.842	0.6758	11	20
RBM4-DPP3	chr11	66407594	chr11	66276550	560	HLA-B39:02	FQGSDVQLL	0.6985	0.9741	11	20
RBM4-DPP3	chr11	66407594	chr11	66276550	560	HLA-B15:73	FQGSDVQLL	0.5846	0.9592	11	20
RBM4-DPP3	chr11	66407594	chr11	66276550	560	HLA-B39:11	FQGSDVQLL	0.53	0.9019	11	20
RBM4-DPP3	chr11	66407594	chr11	66276550	560	HLA-B15:30	FQGSDVQLL	0.5146	0.9481	11	20
RBM4-DPP3	chr11	66407594	chr11	66276550	560	HLA-B38:05	FQGSDVQLL	0.5028	0.9849	11	20
RBM4-DPP3	chr11	66407594	chr11	66276550	560	HLA-B40:12	FQGSDVQLL	0.4669	0.6108	11	20
RBM4-DPP3	chr11	66407594	chr11	66276550	560	HLA-B40:49	FQGSDVQLL	0.3838	0.5348	11	20
RBM4-DPP3	chr11	66407594	chr11	66276550	560	HLA-B40:21	FQGSDVQLL	0.3515	0.6761	11	20
RBM4-DPP3	chr11	66407594	chr11	66276550	560	HLA-B40:04	TEFQGSDVQL	0.9976	0.8188	9	19
RBM4-DPP3	chr11	66407594	chr11	66276550	560	HLA-B40:36	TEFQGSDVQL	0.9956	0.6119	9	19
RBM4-DPP3	chr11	66407594	chr11	66276550	560	HLA-B40:49	TEFQGSDVQL	0.9949	0.6053	9	19
RBM4-DPP3	chr11	66407594	chr11	66276550	560	HLA-B40:12	TEFQGSDVQL	0.9943	0.6781	9	19
RBM4-DPP3	chr11	66407594	chr11	66276550	560	HLA-B44:07	TEFQGSDVQL	0.97	0.9719	9	19
RBM4-DPP3	chr11	66407594	chr11	66276550	560	HLA-B44:13	TEFQGSDVQL	0.97	0.9719	9	19
RBM4-DPP3	chr11	66407594	chr11	66276550	560	HLA-B44:26	TEFQGSDVQL	0.97	0.9719	9	19
RBM4-DPP3	chr11	66407594	chr11	66276550	560	HLA-B44:22	TEFQGSDVQL	0.9486	0.5113	9	19
RBM4-DPP3	chr11	66407594	chr11	66276550	560	HLA-B39:02	TEFQGSDVQL	0.9084	0.972	9	19
RBM4-DPP3	chr11	66407594	chr11	66276550	560	HLA-B18:11	TEFQGSDVQL	0.8125	0.8798	9	19
RBM4-DPP3	chr11	66407594	chr11	66276550	560	HLA-B41:03	TEFQGSDVQL	0.74	0.679	9	19
RBM4-DPP3	chr11	66407594	chr11	66276550	560	HLA-B40:04	TEFQGSDVQLL	0.9992	0.7835	9	20
RBM4-DPP3	chr11	66407594	chr11	66276550	560	HLA-B40:49	TEFQGSDVQLL	0.9986	0.5766	9	20
RBM4-DPP3	chr11	66407594	chr11	66276550	560	HLA-B40:36	TEFQGSDVQLL	0.9986	0.5702	9	20
RBM4-DPP3	chr11	66407594	chr11	66276550	560	HLA-B40:12	TEFQGSDVQLL	0.9974	0.6211	9	20
RBM4-DPP3	chr11	66407594	chr11	66276550	560	HLA-B44:22	TEFQGSDVQLL	0.9943	0.511	9	20
RBM4-DPP3	chr11	66407594	chr11	66276550	560	HLA-B44:07	TEFQGSDVQLL	0.9942	0.9874	9	20
RBM4-DPP3	chr11	66407594	chr11	66276550	560	HLA-B44:26	TEFQGSDVQLL	0.9942	0.9874	9	20
RBM4-DPP3	chr11	66407594	chr11	66276550	560	HLA-B44:13	TEFQGSDVQLL	0.9942	0.9874	9	20
RBM4-DPP3	chr11	66407594	chr11	66276550	560	HLA-B39:02	TEFQGSDVQLL	0.9806	0.9799	9	20
RBM4-DPP3	chr11	66407594	chr11	66276550	560	HLA-B15:20	FQGSDVQLLEY	0.9798	0.7884	11	22
RBM4-DPP3	chr11	66407594	chr11	66276550	560	HLA-B35:28	FQGSDVQLLEY	0.972	0.8075	11	22
RBM4-DPP3	chr11	66407594	chr11	66276550	560	HLA-B41:03	TEFQGSDVQLL	0.9596	0.7362	9	20

Top

Potential FusionNeoAntigen Information of RBM4-DPP3 in HLA II

RBM4-DPP3_66407594_66276550.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
RBM4-DPP3	chr11	66407594	chr11	66276550	560	DRB1-0901	NTEFQGSDVQLLEYE	8	23
RBM4-DPP3	chr11	66407594	chr11	66276550	560	DRB1-0901	DNTEFQGSDVQLLEY	7	22
RBM4-DPP3	chr11	66407594	chr11	66276550	560	DRB1-0902	NTEFQGSDVQLLEYE	8	23
RBM4-DPP3	chr11	66407594	chr11	66276550	560	DRB1-0903	NTEFQGSDVQLLEYE	8	23
RBM4-DPP3	chr11	66407594	chr11	66276550	560	DRB1-0904	NTEFQGSDVQLLEYE	8	23
RBM4-DPP3	chr11	66407594	chr11	66276550	560	DRB1-0904	DNTEFQGSDVQLLEY	7	22
RBM4-DPP3	chr11	66407594	chr11	66276550	560	DRB1-0904	LDNTEFQGSDVQLLE	6	21
RBM4-DPP3	chr11	66407594	chr11	66276550	560	DRB1-0905	NTEFQGSDVQLLEYE	8	23
RBM4-DPP3	chr11	66407594	chr11	66276550	560	DRB1-0905	DNTEFQGSDVQLLEY	7	22
RBM4-DPP3	chr11	66407594	chr11	66276550	560	DRB1-0907	NTEFQGSDVQLLEYE	8	23
RBM4-DPP3	chr11	66407594	chr11	66276550	560	DRB1-0907	DNTEFQGSDVQLLEY	7	22
RBM4-DPP3	chr11	66407594	chr11	66276550	560	DRB1-0907	LDNTEFQGSDVQLLE	6	21
RBM4-DPP3	chr11	66407594	chr11	66276550	560	DRB1-0908	NTEFQGSDVQLLEYE	8	23
RBM4-DPP3	chr11	66407594	chr11	66276550	560	DRB1-0909	NTEFQGSDVQLLEYE	8	23
RBM4-DPP3	chr11	66407594	chr11	66276550	560	DRB1-0909	DNTEFQGSDVQLLEY	7	22
RBM4-DPP3	chr11	66407594	chr11	66276550	560	DRB1-1201	VEAIRGLDNTEFQGS	0	15
RBM4-DPP3	chr11	66407594	chr11	66276550	560	DRB1-1203	VEAIRGLDNTEFQGS	0	15
RBM4-DPP3	chr11	66407594	chr11	66276550	560	DRB1-1205	VEAIRGLDNTEFQGS	0	15
RBM4-DPP3	chr11	66407594	chr11	66276550	560	DRB1-1206	VEAIRGLDNTEFQGS	0	15
RBM4-DPP3	chr11	66407594	chr11	66276550	560	DRB1-1207	VEAIRGLDNTEFQGS	0	15
RBM4-DPP3	chr11	66407594	chr11	66276550	560	DRB1-1208	VEAIRGLDNTEFQGS	0	15
RBM4-DPP3	chr11	66407594	chr11	66276550	560	DRB1-1210	VEAIRGLDNTEFQGS	0	15
RBM4-DPP3	chr11	66407594	chr11	66276550	560	DRB1-1211	VEAIRGLDNTEFQGS	0	15
RBM4-DPP3	chr11	66407594	chr11	66276550	560	DRB1-1212	VEAIRGLDNTEFQGS	0	15
RBM4-DPP3	chr11	66407594	chr11	66276550	560	DRB1-1212	EAIRGLDNTEFQGSD	1	16
RBM4-DPP3	chr11	66407594	chr11	66276550	560	DRB1-1213	VEAIRGLDNTEFQGS	0	15
RBM4-DPP3	chr11	66407594	chr11	66276550	560	DRB1-1214	VEAIRGLDNTEFQGS	0	15
RBM4-DPP3	chr11	66407594	chr11	66276550	560	DRB1-1215	VEAIRGLDNTEFQGS	0	15
RBM4-DPP3	chr11	66407594	chr11	66276550	560	DRB1-1217	VEAIRGLDNTEFQGS	0	15
RBM4-DPP3	chr11	66407594	chr11	66276550	560	DRB1-1218	VEAIRGLDNTEFQGS	0	15
RBM4-DPP3	chr11	66407594	chr11	66276550	560	DRB1-1219	VEAIRGLDNTEFQGS	0	15
RBM4-DPP3	chr11	66407594	chr11	66276550	560	DRB1-1220	VEAIRGLDNTEFQGS	0	15
RBM4-DPP3	chr11	66407594	chr11	66276550	560	DRB1-1221	VEAIRGLDNTEFQGS	0	15
RBM4-DPP3	chr11	66407594	chr11	66276550	560	DRB1-1221	EAIRGLDNTEFQGSD	1	16
RBM4-DPP3	chr11	66407594	chr11	66276550	560	DRB1-1222	VEAIRGLDNTEFQGS	0	15
RBM4-DPP3	chr11	66407594	chr11	66276550	560	DRB1-1223	VEAIRGLDNTEFQGS	0	15

Top

Fusion breakpoint peptide structures of RBM4-DPP3

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
4853	LDNTEFQGSDVQLL	RBM4	DPP3	chr11	66407594	chr11	66276550	560

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of RBM4-DPP3

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	4853	LDNTEFQGSDVQLL	-7.9962	-8.1096
HLA-B14:02	3BVN	4853	LDNTEFQGSDVQLL	-5.70842	-6.74372
HLA-B52:01	3W39	4853	LDNTEFQGSDVQLL	-6.83737	-6.95077
HLA-B52:01	3W39	4853	LDNTEFQGSDVQLL	-4.4836	-5.5189
HLA-A11:01	4UQ2	4853	LDNTEFQGSDVQLL	-10.0067	-10.1201
HLA-A11:01	4UQ2	4853	LDNTEFQGSDVQLL	-9.03915	-10.0745
HLA-A24:02	5HGA	4853	LDNTEFQGSDVQLL	-6.56204	-6.67544
HLA-A24:02	5HGA	4853	LDNTEFQGSDVQLL	-5.42271	-6.45801
HLA-B44:05	3DX8	4853	LDNTEFQGSDVQLL	-7.85648	-8.89178
HLA-B44:05	3DX8	4853	LDNTEFQGSDVQLL	-5.3978	-5.5112
HLA-A02:01	6TDR	4853	LDNTEFQGSDVQLL	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of RBM4-DPP3

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
RBM4-DPP3	chr11	66407594	chr11	66276550	11	19	FQGSDVQL	TTCAAGGCTCAGACGTGCAGCTTC
RBM4-DPP3	chr11	66407594	chr11	66276550	11	20	FQGSDVQLL	TTCAAGGCTCAGACGTGCAGCTTCTGG
RBM4-DPP3	chr11	66407594	chr11	66276550	11	22	FQGSDVQLLEY	TTCAAGGCTCAGACGTGCAGCTTCTGGAATACG
RBM4-DPP3	chr11	66407594	chr11	66276550	9	19	TEFQGSDVQL	CAGAGTTTCAAGGCTCAGACGTGCAGCTTC
RBM4-DPP3	chr11	66407594	chr11	66276550	9	20	TEFQGSDVQLL	CAGAGTTTCAAGGCTCAGACGTGCAGCTTCTGG

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
RBM4-DPP3	chr11	66407594	chr11	66276550	0	15	VEAIRGLDNTEFQGS	TGGAGGCCATCAGGGGCCTTGATAACACAGAGTTTCAAGGCTCAG
RBM4-DPP3	chr11	66407594	chr11	66276550	1	16	EAIRGLDNTEFQGSD	AGGCCATCAGGGGCCTTGATAACACAGAGTTTCAAGGCTCAGACG
RBM4-DPP3	chr11	66407594	chr11	66276550	6	21	LDNTEFQGSDVQLLE	TTGATAACACAGAGTTTCAAGGCTCAGACGTGCAGCTTCTGGAAT
RBM4-DPP3	chr11	66407594	chr11	66276550	7	22	DNTEFQGSDVQLLEY	ATAACACAGAGTTTCAAGGCTCAGACGTGCAGCTTCTGGAATACG
RBM4-DPP3	chr11	66407594	chr11	66276550	8	23	NTEFQGSDVQLLEYE	ACACAGAGTTTCAAGGCTCAGACGTGCAGCTTCTGGAATACGAGG

Top

Information of the samples that have these potential fusion neoantigens of RBM4-DPP3

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
LUAD	RBM4-DPP3	chr11	66407594	ENST00000310092	chr11	66276550	ENST00000531863	TCGA-49-AAQV

Top

Potential target of CAR-T therapy development for RBM4-DPP3

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to RBM4-DPP3

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to RBM4-DPP3

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)