Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:RERE-CYP4A11

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: RERE-CYP4A11
	FusionPDB ID: 73492
	FusionGDB2.0 ID: 73492
		Hgene	Tgene
	Gene symbol	RERE	CYP4A11
	Gene ID	473	1579
	Gene name	arginine-glutamic acid dipeptide repeats	cytochrome P450 family 4 subfamily A member 11
	Synonyms	ARG\|ARP\|ATN1L\|DNB1\|NEDBEH	CP4Y\|CYP4A2\|CYP4AII\|CYPIVA11
	Cytomap	1p36.23	1p33
	Type of gene	protein-coding	protein-coding
	Description	arginine-glutamic acid dipeptide repeats proteinarginine-glutamic acid dipeptide (RE) repeatsatrophin 2atrophin-1 like proteinatrophin-1 related protein	cytochrome P450 4A1120-HETE synthase20-hydroxyeicosatetraenoic acid synthaseP450HL-omegaalkane-1 monooxygenasecytochrome P-450HK-omegacytochrome P450, family 4, subfamily A, polypeptide 11cytochrome P450, subfamily IVA, polypeptide 11cytochrome P4
	Modification date	20200313	20200313
	UniProtAcc	.	Q02928 Main function of 5'-partner protein: FUNCTION: A cytochrome P450 monooxygenase involved in the metabolism of fatty acids and their oxygenated derivatives (oxylipins) (PubMed:7679927, PubMed:1739747, PubMed:8914854, PubMed:10553002, PubMed:10660572, PubMed:15611369). Mechanistically, uses molecular oxygen inserting one oxygen atom into a substrate, and reducing the second into a water molecule, with two electrons provided by NADPH via cytochrome P450 reductase (CPR; NADPH-ferrihemoprotein reductase) (PubMed:7679927, PubMed:1739747, PubMed:8914854, PubMed:10553002, PubMed:10660572, PubMed:15611369). Catalyzes predominantly the oxidation of the terminal carbon (omega-oxidation) of saturated and unsaturated fatty acids, the catalytic efficiency decreasing in the following order: dodecanoic > tetradecanoic > (9Z)-octadecenoic > (9Z,12Z)-octadecadienoic > hexadecanoic acid (PubMed:10553002, PubMed:10660572). Acts as a major omega-hydroxylase for dodecanoic (lauric) acid in liver (PubMed:7679927, PubMed:1739747, PubMed:8914854, PubMed:15611369). Participates in omega-hydroxylation of (5Z,8Z,11Z,14Z)-eicosatetraenoic acid (arachidonate) to 20-hydroxyeicosatetraenoic acid (20-HETE), a signaling molecule acting both as vasoconstrictive and natriuretic with overall effect on arterial blood pressure (PubMed:10620324, PubMed:10660572, PubMed:15611369). Can also catalyze the oxidation of the penultimate carbon (omega-1 oxidation) of fatty acids with lower efficiency (PubMed:7679927). May contribute to the degradation of saturated very long-chain fatty acids (VLCFAs) such as docosanoic acid, by catalyzing successive omega-oxidations to the corresponding dicarboxylic acid, thereby initiating chain shortening (PubMed:18182499). Omega-hydroxylates (9R,10S)-epoxy-octadecanoate stereoisomer (PubMed:15145985). Plays a minor role in omega-oxidation of long-chain 3-hydroxy fatty acids (PubMed:18065749). Has little activity toward prostaglandins A1 and E1 (PubMed:7679927). {ECO:0000269\|PubMed:10553002, ECO:0000269\|PubMed:10620324, ECO:0000269\|PubMed:10660572, ECO:0000269\|PubMed:15145985, ECO:0000269\|PubMed:15611369, ECO:0000269\|PubMed:1739747, ECO:0000269\|PubMed:18065749, ECO:0000269\|PubMed:18182499, ECO:0000269\|PubMed:7679927, ECO:0000269\|PubMed:8914854}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000337907, ENST00000377464, ENST00000400907, ENST00000400908, ENST00000460659, ENST00000476556,	ENST00000457840, ENST00000496519, ENST00000310638, ENST00000371904, ENST00000371905, ENST00000462347,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	27 X 28 X 11=8316	1 X 1 X 1=1
	# samples	43	1
	** MAII score	log2(43/8316*10)=-4.27348119326891 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(1/1*10)=3.32192809488736
Fusion gene context	PubMed: RERE [Title/Abstract] AND CYP4A11 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: RERE [Title/Abstract] AND CYP4A11 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	RERE(8525985)-CYP4A11(47403809), # samples:3
Anticipated loss of major functional domain due to fusion event.	RERE-CYP4A11 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. RERE-CYP4A11 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. RERE-CYP4A11 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. RERE-CYP4A11 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. RERE-CYP4A11 seems lost the major protein functional domain in Tgene partner, which is a IUPHAR drug target due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Tgene	CYP4A11	GO:0001676	long-chain fatty acid metabolic process	18433732
Tgene	CYP4A11	GO:0006691	leukotriene metabolic process	9799565
Tgene	CYP4A11	GO:0019369	arachidonic acid metabolic process	10660572
Tgene	CYP4A11	GO:0019373	epoxygenase P450 pathway	9618440
Tgene	CYP4A11	GO:0055114	oxidation-reduction process	9618440\|9799565\|18433732

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr1:8525985/chr1:47403809)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across RERE (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across CYP4A11 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000337907	RERE	chr1	8525985	-	ENST00000310638	CYP4A11	chr1	47403809	-	4141	1838	533	3202	889
ENST00000337907	RERE	chr1	8525985	-	ENST00000371904	CYP4A11	chr1	47403809	-	3380	1838	533	3205	890
ENST00000337907	RERE	chr1	8525985	-	ENST00000462347	CYP4A11	chr1	47403809	-	3387	1838	533	2908	791
ENST00000337907	RERE	chr1	8525985	-	ENST00000371905	CYP4A11	chr1	47403809	-	3337	1838	533	3010	825
ENST00000377464	RERE	chr1	8525985	-	ENST00000310638	CYP4A11	chr1	47403809	-	2857	554	155	1918	587
ENST00000377464	RERE	chr1	8525985	-	ENST00000371904	CYP4A11	chr1	47403809	-	2096	554	155	1921	588
ENST00000377464	RERE	chr1	8525985	-	ENST00000462347	CYP4A11	chr1	47403809	-	2103	554	155	1624	489
ENST00000377464	RERE	chr1	8525985	-	ENST00000371905	CYP4A11	chr1	47403809	-	2053	554	155	1726	523
ENST00000400907	RERE	chr1	8525985	-	ENST00000310638	CYP4A11	chr1	47403809	-	3580	1277	74	2641	855
ENST00000400907	RERE	chr1	8525985	-	ENST00000371904	CYP4A11	chr1	47403809	-	2819	1277	74	2644	856
ENST00000400907	RERE	chr1	8525985	-	ENST00000462347	CYP4A11	chr1	47403809	-	2826	1277	74	2347	757
ENST00000400907	RERE	chr1	8525985	-	ENST00000371905	CYP4A11	chr1	47403809	-	2776	1277	74	2449	791

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000337907	ENST00000310638	RERE	chr1	8525985	-	CYP4A11	chr1	47403809	-	0.001417378	0.9985826
ENST00000337907	ENST00000371904	RERE	chr1	8525985	-	CYP4A11	chr1	47403809	-	0.002346561	0.9976534
ENST00000337907	ENST00000462347	RERE	chr1	8525985	-	CYP4A11	chr1	47403809	-	0.003002701	0.99699736
ENST00000337907	ENST00000371905	RERE	chr1	8525985	-	CYP4A11	chr1	47403809	-	0.001988069	0.99801195
ENST00000377464	ENST00000310638	RERE	chr1	8525985	-	CYP4A11	chr1	47403809	-	0.010778805	0.9892212
ENST00000377464	ENST00000371904	RERE	chr1	8525985	-	CYP4A11	chr1	47403809	-	0.012364891	0.9876351
ENST00000377464	ENST00000462347	RERE	chr1	8525985	-	CYP4A11	chr1	47403809	-	0.033593964	0.966406
ENST00000377464	ENST00000371905	RERE	chr1	8525985	-	CYP4A11	chr1	47403809	-	0.011682247	0.9883178
ENST00000400907	ENST00000310638	RERE	chr1	8525985	-	CYP4A11	chr1	47403809	-	0.001610611	0.99838936
ENST00000400907	ENST00000371904	RERE	chr1	8525985	-	CYP4A11	chr1	47403809	-	0.00280792	0.9971921
ENST00000400907	ENST00000462347	RERE	chr1	8525985	-	CYP4A11	chr1	47403809	-	0.00355919	0.9964408
ENST00000400907	ENST00000371905	RERE	chr1	8525985	-	CYP4A11	chr1	47403809	-	0.002334131	0.9976659

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for RERE-CYP4A11

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
RERE	chr1	8525985	CYP4A11	chr1	47403809	1277	401	PKLIEKCWTEDEVLQQDQELQRIQKW
RERE	chr1	8525985	CYP4A11	chr1	47403809	1277	463	KSHGSYRFLAPWIGYGLLLLNGQTWF
RERE	chr1	8525985	CYP4A11	chr1	47403809	1277	692	QHSHAFLPFSGGSRNCIGKQFAMNEL
RERE	chr1	8525985	CYP4A11	chr1	47403809	1277	790	QHSHAFLPFSGGSRNCIGKQFAMNEL
RERE	chr1	8525985	CYP4A11	chr1	47403809	1277	791	QHSHAFLPFSGGSRNCIGKQFAMNEL
RERE	chr1	8525985	CYP4A11	chr1	47403809	1838	435	PKLIEKCWTEDEVLQQDQELQRIQKW
RERE	chr1	8525985	CYP4A11	chr1	47403809	1838	497	KSHGSYRFLAPWIGYGLLLLNGQTWF
RERE	chr1	8525985	CYP4A11	chr1	47403809	1838	726	QHSHAFLPFSGGSRNCIGKQFAMNEL
RERE	chr1	8525985	CYP4A11	chr1	47403809	1838	824	QHSHAFLPFSGGSRNCIGKQFAMNEL
RERE	chr1	8525985	CYP4A11	chr1	47403809	1838	825	QHSHAFLPFSGGSRNCIGKQFAMNEL
RERE	chr1	8525985	CYP4A11	chr1	47403809	554	133	PKLIEKCWTEDEVLQQDQELQRIQKW
RERE	chr1	8525985	CYP4A11	chr1	47403809	554	195	KSHGSYRFLAPWIGYGLLLLNGQTWF
RERE	chr1	8525985	CYP4A11	chr1	47403809	554	424	QHSHAFLPFSGGSRNCIGKQFAMNEL
RERE	chr1	8525985	CYP4A11	chr1	47403809	554	522	QHSHAFLPFSGGSRNCIGKQFAMNEL
RERE	chr1	8525985	CYP4A11	chr1	47403809	554	523	QHSHAFLPFSGGSRNCIGKQFAMNEL

Top

Potential FusionNeoAntigen Information of RERE-CYP4A11 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

RERE-CYP4A11_8525985_47403809.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
RERE-CYP4A11	chr1	8525985	chr1	47403809	1838	HLA-B27:05	SRNCIGKQF	0.9986	0.6624	12	21
RERE-CYP4A11	chr1	8525985	chr1	47403809	1838	HLA-A31:02	AFLPFSGGSR	0.9727	0.8615	4	14
RERE-CYP4A11	chr1	8525985	chr1	47403809	1838	HLA-B27:05	SRNCIGKQFAM	1	0.6806	12	23
RERE-CYP4A11	chr1	8525985	chr1	47403809	1838	HLA-B27:04	SRNCIGKQFAM	1	0.5261	12	23
RERE-CYP4A11	chr1	8525985	chr1	47403809	1838	HLA-A68:24	HAFLPFSGGSR	0.9985	0.5883	3	14
RERE-CYP4A11	chr1	8525985	chr1	47403809	1838	HLA-A68:03	HAFLPFSGGSR	0.9978	0.5745	3	14
RERE-CYP4A11	chr1	8525985	chr1	47403809	1838	HLA-A68:05	HAFLPFSGGSR	0.9965	0.5886	3	14
RERE-CYP4A11	chr1	8525985	chr1	47403809	1838	HLA-A33:05	HAFLPFSGGSR	0.996	0.502	3	14
RERE-CYP4A11	chr1	8525985	chr1	47403809	1838	HLA-A33:01	HAFLPFSGGSR	0.996	0.502	3	14
RERE-CYP4A11	chr1	8525985	chr1	47403809	1838	HLA-B27:14	SRNCIGKQF	0.9983	0.5584	12	21
RERE-CYP4A11	chr1	8525985	chr1	47403809	1838	HLA-C07:95	SRNCIGKQF	0.9965	0.5267	12	21
RERE-CYP4A11	chr1	8525985	chr1	47403809	1838	HLA-C07:05	SRNCIGKQF	0.9958	0.8585	12	21
RERE-CYP4A11	chr1	8525985	chr1	47403809	1838	HLA-C07:27	SRNCIGKQF	0.9884	0.867	12	21
RERE-CYP4A11	chr1	8525985	chr1	47403809	1838	HLA-B27:03	SRNCIGKQF	0.9725	0.6868	12	21
RERE-CYP4A11	chr1	8525985	chr1	47403809	1838	HLA-B39:12	SRNCIGKQF	0.821	0.855	12	21
RERE-CYP4A11	chr1	8525985	chr1	47403809	1838	HLA-C07:19	SRNCIGKQF	0.8029	0.5706	12	21
RERE-CYP4A11	chr1	8525985	chr1	47403809	1838	HLA-C07:10	SRNCIGKQF	0.8005	0.8804	12	21
RERE-CYP4A11	chr1	8525985	chr1	47403809	1838	HLA-C07:67	SRNCIGKQF	0.7997	0.8915	12	21
RERE-CYP4A11	chr1	8525985	chr1	47403809	1838	HLA-C07:80	SRNCIGKQF	0.7997	0.8915	12	21
RERE-CYP4A11	chr1	8525985	chr1	47403809	1838	HLA-C07:46	SRNCIGKQF	0.7987	0.7498	12	21
RERE-CYP4A11	chr1	8525985	chr1	47403809	1838	HLA-C12:16	SRNCIGKQF	0.0485	0.9099	12	21
RERE-CYP4A11	chr1	8525985	chr1	47403809	1838	HLA-B27:03	SRNCIGKQFAM	0.9996	0.6969	12	23
RERE-CYP4A11	chr1	8525985	chr1	47403809	1838	HLA-A68:01	HAFLPFSGGSR	0.9985	0.5883	3	14
RERE-CYP4A11	chr1	8525985	chr1	47403809	1838	HLA-A33:03	HAFLPFSGGSR	0.9934	0.5429	3	14
RERE-CYP4A11	chr1	8525985	chr1	47403809	1838	HLA-B27:10	SRNCIGKQF	0.9985	0.6604	12	21
RERE-CYP4A11	chr1	8525985	chr1	47403809	1838	HLA-C07:01	SRNCIGKQF	0.9964	0.5166	12	21
RERE-CYP4A11	chr1	8525985	chr1	47403809	1838	HLA-B27:09	SRNCIGKQF	0.9905	0.5509	12	21
RERE-CYP4A11	chr1	8525985	chr1	47403809	1838	HLA-C07:17	SRNCIGKQF	0.935	0.9244	12	21
RERE-CYP4A11	chr1	8525985	chr1	47403809	1838	HLA-C07:02	SRNCIGKQF	0.7997	0.8915	12	21
RERE-CYP4A11	chr1	8525985	chr1	47403809	1838	HLA-C07:22	SRNCIGKQF	0.797	0.5054	12	21
RERE-CYP4A11	chr1	8525985	chr1	47403809	1838	HLA-C06:08	SRNCIGKQF	0.7682	0.9645	12	21
RERE-CYP4A11	chr1	8525985	chr1	47403809	1838	HLA-C06:06	SRNCIGKQF	0.2211	0.9824	12	21
RERE-CYP4A11	chr1	8525985	chr1	47403809	1838	HLA-C06:17	SRNCIGKQF	0.0348	0.9846	12	21
RERE-CYP4A11	chr1	8525985	chr1	47403809	1838	HLA-C06:02	SRNCIGKQF	0.0348	0.9846	12	21
RERE-CYP4A11	chr1	8525985	chr1	47403809	1838	HLA-B27:10	SRNCIGKQFAM	1	0.6915	12	23
RERE-CYP4A11	chr1	8525985	chr1	47403809	1838	HLA-B27:06	SRNCIGKQFAM	1	0.5017	12	23
RERE-CYP4A11	chr1	8525985	chr1	47403809	1838	HLA-B27:09	SRNCIGKQFAM	0.9999	0.5724	12	23

Top

Potential FusionNeoAntigen Information of RERE-CYP4A11 in HLA II

RERE-CYP4A11_8525985_47403809.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
RERE-CYP4A11	chr1	8525985	chr1	47403809	1838	DRB5-0103	QHSHAFLPFSGGSRN	0	15
RERE-CYP4A11	chr1	8525985	chr1	47403809	1838	DRB5-0103	HSHAFLPFSGGSRNC	1	16
RERE-CYP4A11	chr1	8525985	chr1	47403809	1838	DRB5-0103	SHAFLPFSGGSRNCI	2	17
RERE-CYP4A11	chr1	8525985	chr1	47403809	1838	DRB5-0111	QHSHAFLPFSGGSRN	0	15
RERE-CYP4A11	chr1	8525985	chr1	47403809	1838	DRB5-0203	QHSHAFLPFSGGSRN	0	15
RERE-CYP4A11	chr1	8525985	chr1	47403809	1838	DRB5-0203	HSHAFLPFSGGSRNC	1	16
RERE-CYP4A11	chr1	8525985	chr1	47403809	1838	DRB5-0203	SHAFLPFSGGSRNCI	2	17

Top

Fusion breakpoint peptide structures of RERE-CYP4A11

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
5382	LPFSGGSRNCIGKQ	RERE	CYP4A11	chr1	8525985	chr1	47403809	1838

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of RERE-CYP4A11

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	5382	LPFSGGSRNCIGKQ	-8.31227	-8.42567
HLA-B14:02	3BVN	5382	LPFSGGSRNCIGKQ	-5.57336	-6.60866
HLA-B52:01	3W39	5382	LPFSGGSRNCIGKQ	-6.32748	-6.44088
HLA-B52:01	3W39	5382	LPFSGGSRNCIGKQ	-5.21657	-6.25187
HLA-A24:02	5HGA	5382	LPFSGGSRNCIGKQ	-6.95203	-7.06543
HLA-A24:02	5HGA	5382	LPFSGGSRNCIGKQ	-5.804	-6.8393
HLA-B44:05	3DX8	5382	LPFSGGSRNCIGKQ	-6.02771	-6.14111
HLA-B44:05	3DX8	5382	LPFSGGSRNCIGKQ	-3.1424	-4.1777

Top

Vaccine Design for the FusionNeoAntigens of RERE-CYP4A11

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
RERE-CYP4A11	chr1	8525985	chr1	47403809	12	21	SRNCIGKQF	GTGCTCCAACAGGACCAGGAGCTACAA
RERE-CYP4A11	chr1	8525985	chr1	47403809	12	23	SRNCIGKQFAM	GTGCTCCAACAGGACCAGGAGCTACAACGGATT
RERE-CYP4A11	chr1	8525985	chr1	47403809	3	14	HAFLPFSGGSR	ATCGAGAAGTGCTGGACCGAGGACGAAGTGCTC
RERE-CYP4A11	chr1	8525985	chr1	47403809	4	14	AFLPFSGGSR	GAGAAGTGCTGGACCGAGGACGAAGTGCTC

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
RERE-CYP4A11	chr1	8525985	chr1	47403809	0	15	QHSHAFLPFSGGSRN	CCCAAGCTCATCGAGAAGTGCTGGACCGAGGACGAAGTGCTCCAA
RERE-CYP4A11	chr1	8525985	chr1	47403809	1	16	HSHAFLPFSGGSRNC	AAGCTCATCGAGAAGTGCTGGACCGAGGACGAAGTGCTCCAACAG
RERE-CYP4A11	chr1	8525985	chr1	47403809	2	17	SHAFLPFSGGSRNCI	CTCATCGAGAAGTGCTGGACCGAGGACGAAGTGCTCCAACAGGAC

Top

Information of the samples that have these potential fusion neoantigens of RERE-CYP4A11

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
BRCA	RERE-CYP4A11	chr1	8525985	ENST00000337907	chr1	47403809	ENST00000310638	TCGA-D8-A1XZ-01A

Top

Potential target of CAR-T therapy development for RERE-CYP4A11

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to RERE-CYP4A11

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to RERE-CYP4A11

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)