Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:REV3L-ASCC3

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: REV3L-ASCC3
	FusionPDB ID: 73583
	FusionGDB2.0 ID: 73583
		Hgene	Tgene
	Gene symbol	REV3L	ASCC3
	Gene ID	5980	10973
	Gene name	REV3 like, DNA directed polymerase zeta catalytic subunit	activating signal cointegrator 1 complex subunit 3
	Synonyms	POLZ\|REV3	ASC1p200\|HELIC1\|RNAH
	Cytomap	6q21	6q16.3
	Type of gene	protein-coding	protein-coding
	Description	DNA polymerase zeta catalytic subunitREV3-like, polymerase (DNA directed), zeta, catalytic subunitRev-3, yeast, homolog-like (polymerase, DNA, zeta)	activating signal cointegrator 1 complex subunit 3ASC-1 complex subunit P200RNA helicase familyhelicase, ATP binding 1trip4 complex subunit p200
	Modification date	20200313	20200313
	UniProtAcc	.	Q8N3C0 Main function of 5'-partner protein: FUNCTION: 3'-5' DNA helicase involved in repair of alkylated DNA. Promotes DNA unwinding to generate single-stranded substrate needed for ALKBH3, enabling ALKBH3 to process alkylated N3-methylcytosine (3mC) within double-stranded regions (PubMed:22055184). Part of the ASC-1 complex that enhances NF-kappa-B, SRF and AP1 transactivation (PubMed:12077347). {ECO:0000269\|PubMed:12077347, ECO:0000269\|PubMed:22055184}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000358835, ENST00000368802, ENST00000368805, ENST00000435970, ENST00000462119,	ENST00000369143, ENST00000369162, ENST00000522650,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	17 X 20 X 10=3400	14 X 10 X 11=1540
	# samples	26	18
	** MAII score	log2(26/3400*10)=-3.70895121799661 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(18/1540*10)=-3.09686153925259 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: REV3L [Title/Abstract] AND ASCC3 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: REV3L [Title/Abstract] AND ASCC3 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	REV3L(111803952)-ASCC3(101253756), # samples:1
Anticipated loss of major functional domain due to fusion event.	REV3L-ASCC3 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. REV3L-ASCC3 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. REV3L-ASCC3 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. REV3L-ASCC3 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. REV3L-ASCC3 seems lost the major protein functional domain in Tgene partner, which is a essential gene due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Tgene	ASCC3	GO:0006307	DNA dealkylation involved in DNA repair	22055184
Tgene	ASCC3	GO:0032508	DNA duplex unwinding	22055184

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr6:111803952/chr6:101253756)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across REV3L (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across ASCC3 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000368802	REV3L	chr6	111803952	-	ENST00000369162	ASCC3	chr6	101253756	-	7462	462	345	6269	1974
ENST00000368802	REV3L	chr6	111803952	-	ENST00000522650	ASCC3	chr6	101253756	-	2144	462	345	1856	503

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000368802	ENST00000369162	REV3L	chr6	111803952	-	ASCC3	chr6	101253756	-	0.000936159	0.9990639
ENST00000368802	ENST00000522650	REV3L	chr6	111803952	-	ASCC3	chr6	101253756	-	0.00144238	0.9985576

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for REV3L-ASCC3

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
REV3L	chr6	111803952	ASCC3	chr6	101253756	462	39	RCRWCESSERPRQLFELLGPEGLELI

Top

Potential FusionNeoAntigen Information of REV3L-ASCC3 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

REV3L-ASCC3_111803952_101253756.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-B44:03	SERPRQLF	0.9985	0.7379	7	15
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-B18:01	SERPRQLF	0.9935	0.8205	7	15
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-B08:01	RPRQLFEL	0.9572	0.5596	9	17
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-B14:01	ERPRQLFEL	0.999	0.6066	8	17
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-B14:02	ERPRQLFEL	0.999	0.6066	8	17
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-B39:06	ERPRQLFEL	0.9963	0.6388	8	17
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-B39:01	ERPRQLFEL	0.9953	0.6289	8	17
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-B38:01	ERPRQLFEL	0.9857	0.7274	8	17
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-B38:02	ERPRQLFEL	0.9855	0.7487	8	17
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-B14:02	ESSERPRQL	0.9424	0.6	5	14
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-B14:01	ESSERPRQL	0.9424	0.6	5	14
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-B58:02	SSERPRQLF	0.9176	0.7949	6	15
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-B15:17	SSERPRQLF	0.9091	0.7585	6	15
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-B57:03	SSERPRQLF	0.8891	0.8957	6	15
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-B08:01	RPRQLFELL	0.7849	0.5286	9	18
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-B08:09	RPRQLFELL	0.6986	0.6553	9	18
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-A02:27	QLFELLGPEGL	0.9812	0.5504	12	23
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-A02:04	QLFELLGPEGL	0.9567	0.6764	12	23
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-A02:17	QLFELLGPEGL	0.9481	0.7044	12	23
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-A02:19	QLFELLGPEGL	0.8942	0.5356	12	23
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-B07:12	RPRQLFEL	0.9983	0.6544	9	17
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-B42:02	RPRQLFEL	0.9627	0.5484	9	17
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-B42:01	RPRQLFEL	0.9567	0.5372	9	17
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-B39:10	RPRQLFEL	0.5674	0.7804	9	17
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-C05:09	SSERPRQLF	0.999	0.8133	6	15
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-C03:08	ESSERPRQL	0.9982	0.7889	5	14
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-C15:06	ESSERPRQL	0.997	0.8491	5	14
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-C07:05	ERPRQLFEL	0.9965	0.8451	8	17
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-C08:15	SSERPRQLF	0.9956	0.9062	6	15
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-C07:27	ERPRQLFEL	0.9941	0.8154	8	17
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-B39:12	ERPRQLFEL	0.994	0.6345	8	17
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-C07:29	ERPRQLFEL	0.9884	0.7736	8	17
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-C07:13	ERPRQLFEL	0.9846	0.7868	8	17
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-B07:12	RPRQLFELL	0.9767	0.6037	9	18
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-C07:19	ERPRQLFEL	0.9628	0.5248	8	17
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-C07:46	ERPRQLFEL	0.9592	0.6436	8	17
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-C07:10	ERPRQLFEL	0.9555	0.7872	8	17
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-C07:67	ERPRQLFEL	0.9532	0.7841	8	17
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-C07:80	ERPRQLFEL	0.9532	0.7841	8	17
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-B14:03	ERPRQLFEL	0.9008	0.6963	8	17
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-B14:03	ESSERPRQL	0.8345	0.7157	5	14
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-C12:12	ESSERPRQL	0.8174	0.8045	5	14
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-B42:02	RPRQLFELL	0.8139	0.5256	9	18
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-B42:01	RPRQLFELL	0.7877	0.5149	9	18
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-C12:04	ESSERPRQL	0.7673	0.9751	5	14
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-C06:03	ESSERPRQL	0.76	0.9732	5	14
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-C12:16	ERPRQLFEL	0.478	0.8071	8	17
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-B39:10	RPRQLFELL	0.3049	0.7274	9	18
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-B44:07	SERPRQLF	0.9985	0.7379	7	15
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-B44:26	SERPRQLF	0.9985	0.7379	7	15
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-B44:13	SERPRQLF	0.9985	0.7379	7	15
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-C16:02	SSERPRQL	0.9966	0.9887	6	14
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-B18:06	SERPRQLF	0.9955	0.8164	7	15
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-B18:08	SERPRQLF	0.9943	0.7642	7	15
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-B18:05	SERPRQLF	0.9935	0.8205	7	15
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-B18:03	SERPRQLF	0.9928	0.8101	7	15
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-B18:11	SERPRQLF	0.9925	0.7057	7	15
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-B15:53	SERPRQLF	0.9876	0.735	7	15
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-C16:01	SSERPRQL	0.9651	0.9579	6	14
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-B08:18	RPRQLFEL	0.9572	0.5596	9	17
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-B67:01	RPRQLFEL	0.5498	0.717	9	17
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-C05:01	SSERPRQLF	0.999	0.8133	6	15
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-C03:17	ESSERPRQL	0.9975	0.8763	5	14
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-C15:05	ESSERPRQL	0.9961	0.8586	5	14
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-C08:02	SSERPRQLF	0.9956	0.9062	6	15
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-C03:67	ESSERPRQL	0.9955	0.9202	5	14
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-B39:31	ERPRQLFEL	0.9953	0.6296	8	17
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-C15:02	ESSERPRQL	0.9936	0.8026	5	14
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-C07:17	ERPRQLFEL	0.9913	0.8085	8	17
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-B38:05	ERPRQLFEL	0.9857	0.7274	8	17
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-C06:06	ESSERPRQL	0.9816	0.9768	5	14
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-C07:04	ERPRQLFEL	0.9617	0.8605	8	17
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-C07:22	ERPRQLFEL	0.9594	0.517	8	17
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-C07:02	ERPRQLFEL	0.9532	0.7841	8	17
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-C06:08	ERPRQLFEL	0.9395	0.9394	8	17
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-B58:06	SSERPRQLF	0.9383	0.6512	6	15
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-C07:04	ESSERPRQL	0.9308	0.8694	5	14
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-B57:04	SSERPRQLF	0.9286	0.6043	6	15
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-C16:04	ESSERPRQL	0.9149	0.9225	5	14
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-C07:22	ESSERPRQL	0.896	0.5412	5	14
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-B08:18	RPRQLFELL	0.7849	0.5286	9	18
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-C12:03	ESSERPRQL	0.7746	0.9349	5	14
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-B57:02	SSERPRQLF	0.7594	0.7773	6	15
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-C16:02	ESSERPRQL	0.7254	0.9854	5	14
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-C06:02	ESSERPRQL	0.7037	0.9737	5	14
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-C06:17	ESSERPRQL	0.7037	0.9737	5	14
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-C06:06	ERPRQLFEL	0.6995	0.9366	8	17
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-C16:01	ESSERPRQL	0.6618	0.9587	5	14
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-B35:13	RPRQLFELL	0.5779	0.6864	9	18
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-C16:01	SSERPRQLF	0.5422	0.9546	6	15
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-B08:12	RPRQLFELL	0.542	0.7144	9	18
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-C06:02	ERPRQLFEL	0.5293	0.8931	8	17
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-C06:17	ERPRQLFEL	0.5293	0.8931	8	17
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-C06:08	ESSERPRQL	0.5265	0.9564	5	14
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-C16:02	SSERPRQLF	0.4489	0.9865	6	15
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-B67:01	RPRQLFELL	0.3262	0.6647	9	18
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	HLA-A25:01	ESSERPRQLF	0.9634	0.7408	5	15

Top

Potential FusionNeoAntigen Information of REV3L-ASCC3 in HLA II

REV3L-ASCC3_111803952_101253756.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
REV3L-ASCC3	chr6	111803952	chr6	101253756	462	DRB1-0117	PRQLFELLGPEGLEL	10	25

Top

Fusion breakpoint peptide structures of REV3L-ASCC3

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
9002	SSERPRQLFELLGP	REV3L	ASCC3	chr6	111803952	chr6	101253756	462

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of REV3L-ASCC3

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	9002	SSERPRQLFELLGP	-7.28656	-7.39996
HLA-B14:02	3BVN	9002	SSERPRQLFELLGP	-5.68504	-6.72034
HLA-B52:01	3W39	9002	SSERPRQLFELLGP	-7.45611	-7.56951
HLA-B52:01	3W39	9002	SSERPRQLFELLGP	-4.23128	-5.26658
HLA-A24:02	5HGA	9002	SSERPRQLFELLGP	-5.90012	-6.01352
HLA-A24:02	5HGA	9002	SSERPRQLFELLGP	-5.24438	-6.27968
HLA-B44:05	3DX8	9002	SSERPRQLFELLGP	-6.74318	-6.85658
HLA-B44:05	3DX8	9002	SSERPRQLFELLGP	-3.24185	-4.27715
HLA-A02:01	6TDR	9002	SSERPRQLFELLGP	-7.43467	-7.54807

Top

Vaccine Design for the FusionNeoAntigens of REV3L-ASCC3

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
REV3L-ASCC3	chr6	111803952	chr6	101253756	12	23	QLFELLGPEGL	CAGCTATTTGAACTGCTGGGACCTGAAGGACTT
REV3L-ASCC3	chr6	111803952	chr6	101253756	5	14	ESSERPRQL	GAGTCTTCGGAGCGACCCCGGCAGCTA
REV3L-ASCC3	chr6	111803952	chr6	101253756	5	15	ESSERPRQLF	GAGTCTTCGGAGCGACCCCGGCAGCTATTT
REV3L-ASCC3	chr6	111803952	chr6	101253756	6	14	SSERPRQL	TCTTCGGAGCGACCCCGGCAGCTA
REV3L-ASCC3	chr6	111803952	chr6	101253756	6	15	SSERPRQLF	TCTTCGGAGCGACCCCGGCAGCTATTT
REV3L-ASCC3	chr6	111803952	chr6	101253756	7	15	SERPRQLF	TCGGAGCGACCCCGGCAGCTATTT
REV3L-ASCC3	chr6	111803952	chr6	101253756	8	17	ERPRQLFEL	GAGCGACCCCGGCAGCTATTTGAACTG
REV3L-ASCC3	chr6	111803952	chr6	101253756	9	17	RPRQLFEL	CGACCCCGGCAGCTATTTGAACTG
REV3L-ASCC3	chr6	111803952	chr6	101253756	9	18	RPRQLFELL	CGACCCCGGCAGCTATTTGAACTGCTG

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
REV3L-ASCC3	chr6	111803952	chr6	101253756	10	25	PRQLFELLGPEGLEL	CCCCGGCAGCTATTTGAACTGCTGGGACCTGAAGGACTTGAACTT

Top

Information of the samples that have these potential fusion neoantigens of REV3L-ASCC3

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
STAD	REV3L-ASCC3	chr6	111803952	ENST00000368802	chr6	101253756	ENST00000369162	TCGA-HU-A4G2

Top

Potential target of CAR-T therapy development for REV3L-ASCC3

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to REV3L-ASCC3

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to REV3L-ASCC3

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)