![]() |
|||||||
|
Fusion Protein:RFWD2-DDR2 |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: RFWD2-DDR2 | FusionPDB ID: 73669 | FusionGDB2.0 ID: 73669 | Hgene | Tgene | Gene symbol | RFWD2 | DDR2 | Gene ID | 64326 | 4921 |
Gene name | COP1 E3 ubiquitin ligase | discoidin domain receptor tyrosine kinase 2 | |
Synonyms | CFAP78|FAP78|RFWD2|RNF200 | MIG20a|NTRKR3|TKT|TYRO10|WRCN | |
Cytomap | 1q25.1-q25.2 | 1q23.3 | |
Type of gene | protein-coding | protein-coding | |
Description | E3 ubiquitin-protein ligase COP1E3 ubiquitin-protein ligase RFWD2RING finger protein 200RING-type E3 ubiquitin transferase RFWD2constitutive photomorphogenesis protein 1 homologconstitutive photomorphogenic protein 1putative ubiquitin ligase COP1ri | discoidin domain-containing receptor 2CD167 antigen-like family member Bcell migration-inducing protein 20discoidin domain receptor 2discoidin domain receptor family, member 2discoidin domain-containing receptor tyrosine kinase 2hydroxyaryl-protein | |
Modification date | 20200313 | 20200313 | |
UniProtAcc | . | Q16832 Main function of 5'-partner protein: FUNCTION: Tyrosine kinase involved in the regulation of tissues remodeling (PubMed:30449416). It functions as cell surface receptor for fibrillar collagen and regulates cell differentiation, remodeling of the extracellular matrix, cell migration and cell proliferation. Required for normal bone development. Regulates osteoblast differentiation and chondrocyte maturation via a signaling pathway that involves MAP kinases and leads to the activation of the transcription factor RUNX2. Regulates remodeling of the extracellular matrix by up-regulation of the collagenases MMP1, MMP2 and MMP13, and thereby facilitates cell migration and tumor cell invasion. Promotes fibroblast migration and proliferation, and thereby contributes to cutaneous wound healing. {ECO:0000269|PubMed:16186104, ECO:0000269|PubMed:16186108, ECO:0000269|PubMed:17665456, ECO:0000269|PubMed:18201965, ECO:0000269|PubMed:20004161, ECO:0000269|PubMed:20564243, ECO:0000269|PubMed:20734453, ECO:0000269|PubMed:30449416, ECO:0000269|PubMed:9659899}. | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000308769, ENST00000367669, | ENST00000367921, ENST00000367922, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 17 X 15 X 10=2550 | 9 X 8 X 6=432 |
# samples | 20 | 11 | |
** MAII score | log2(20/2550*10)=-3.6724253419715 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(11/432*10)=-1.97352778863881 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: RFWD2 [Title/Abstract] AND DDR2 [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: RFWD2 [Title/Abstract] AND DDR2 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | RFWD2(175996708)-DDR2(162722885), # samples:1 | ||
Anticipated loss of major functional domain due to fusion event. | RFWD2-DDR2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. RFWD2-DDR2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. RFWD2-DDR2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. RFWD2-DDR2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Hgene | RFWD2 | GO:0010212 | response to ionizing radiation | 19805145 |
Tgene | DDR2 | GO:0018108 | peptidyl-tyrosine phosphorylation | 20004161 |
Tgene | DDR2 | GO:0038063 | collagen-activated tyrosine kinase receptor signaling pathway | 16186108 |
Tgene | DDR2 | GO:0046777 | protein autophosphorylation | 16186108 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr1:175996708/chr1:162722885) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000367669 | RFWD2 | chr1 | 175996708 | - | ENST00000367922 | DDR2 | chr1 | 162722885 | + | 11884 | 2244 | 515 | 4729 | 1404 |
ENST00000367669 | RFWD2 | chr1 | 175996708 | - | ENST00000367921 | DDR2 | chr1 | 162722885 | + | 4905 | 2244 | 515 | 4729 | 1404 |
ENST00000308769 | RFWD2 | chr1 | 175996708 | - | ENST00000367922 | DDR2 | chr1 | 162722885 | + | 11297 | 1657 | 0 | 4142 | 1380 |
ENST00000308769 | RFWD2 | chr1 | 175996708 | - | ENST00000367921 | DDR2 | chr1 | 162722885 | + | 4318 | 1657 | 0 | 4142 | 1380 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000367669 | ENST00000367922 | RFWD2 | chr1 | 175996708 | - | DDR2 | chr1 | 162722885 | + | 0.000328645 | 0.99967134 |
ENST00000367669 | ENST00000367921 | RFWD2 | chr1 | 175996708 | - | DDR2 | chr1 | 162722885 | + | 0.001815553 | 0.9981844 |
ENST00000308769 | ENST00000367922 | RFWD2 | chr1 | 175996708 | - | DDR2 | chr1 | 162722885 | + | 0.000184144 | 0.9998159 |
ENST00000308769 | ENST00000367921 | RFWD2 | chr1 | 175996708 | - | DDR2 | chr1 | 162722885 | + | 0.001240208 | 0.99875975 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for RFWD2-DDR2 |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
RFWD2 | chr1 | 175996708 | DDR2 | chr1 | 162722885 | 1657 | 552 | SPSSRYHLAFGCAAICRYPLGMSGGQ |
RFWD2 | chr1 | 175996708 | DDR2 | chr1 | 162722885 | 2244 | 576 | SPSSRYHLAFGCAAICRYPLGMSGGQ |
Top |
Potential FusionNeoAntigen Information of RFWD2-DDR2 in HLA I |
![]() |
RFWD2-DDR2_175996708_162722885.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
RFWD2-DDR2 | chr1 | 175996708 | chr1 | 162722885 | 1657 | HLA-B39:06 | YHLAFGCAA | 0.9982 | 0.9805 | 5 | 14 |
RFWD2-DDR2 | chr1 | 175996708 | chr1 | 162722885 | 1657 | HLA-B39:01 | YHLAFGCAA | 0.9967 | 0.9772 | 5 | 14 |
RFWD2-DDR2 | chr1 | 175996708 | chr1 | 162722885 | 1657 | HLA-B39:05 | YHLAFGCAA | 0.9931 | 0.973 | 5 | 14 |
RFWD2-DDR2 | chr1 | 175996708 | chr1 | 162722885 | 1657 | HLA-B73:01 | YHLAFGCAA | 0.0401 | 0.9764 | 5 | 14 |
RFWD2-DDR2 | chr1 | 175996708 | chr1 | 162722885 | 1657 | HLA-B73:01 | SRYHLAFGCAA | 0.998 | 0.9655 | 3 | 14 |
Top |
Potential FusionNeoAntigen Information of RFWD2-DDR2 in HLA II |
![]() |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of RFWD2-DDR2 |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
3393 | HLAFGCAAICRYPL | RFWD2 | DDR2 | chr1 | 175996708 | chr1 | 162722885 | 1657 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of RFWD2-DDR2 |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 3393 | HLAFGCAAICRYPL | -6.77781 | -6.89121 |
HLA-B14:02 | 3BVN | 3393 | HLAFGCAAICRYPL | -3.08719 | -4.12249 |
HLA-B52:01 | 3W39 | 3393 | HLAFGCAAICRYPL | -6.66315 | -6.77655 |
HLA-B52:01 | 3W39 | 3393 | HLAFGCAAICRYPL | -2.65785 | -3.69315 |
HLA-A24:02 | 5HGA | 3393 | HLAFGCAAICRYPL | -7.20627 | -7.31967 |
HLA-A24:02 | 5HGA | 3393 | HLAFGCAAICRYPL | -6.50211 | -7.53741 |
HLA-B44:05 | 3DX8 | 3393 | HLAFGCAAICRYPL | -7.75024 | -7.86364 |
HLA-B44:05 | 3DX8 | 3393 | HLAFGCAAICRYPL | -6.53073 | -7.56603 |
HLA-A02:01 | 6TDR | 3393 | HLAFGCAAICRYPL | -4.4528 | -5.4881 |
Top |
Vaccine Design for the FusionNeoAntigens of RFWD2-DDR2 |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
RFWD2-DDR2 | chr1 | 175996708 | chr1 | 162722885 | 3 | 14 | SRYHLAFGCAA | CCAGATACCATTTGGCTTTCGGCTGTGCAGCTA |
RFWD2-DDR2 | chr1 | 175996708 | chr1 | 162722885 | 5 | 14 | YHLAFGCAA | ACCATTTGGCTTTCGGCTGTGCAGCTA |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of RFWD2-DDR2 |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
SKCM | RFWD2-DDR2 | chr1 | 175996708 | ENST00000308769 | chr1 | 162722885 | ENST00000367921 | TCGA-BF-AAP4-01A |
Top |
Potential target of CAR-T therapy development for RFWD2-DDR2 |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
Tgene | DDR2 | chr1:175996708 | chr1:162722885 | ENST00000367921 | 2 | 18 | 400_421 | 0 | 856.0 | Transmembrane | Helical | |
Tgene | DDR2 | chr1:175996708 | chr1:162722885 | ENST00000367922 | 3 | 19 | 400_421 | 0 | 856.0 | Transmembrane | Helical |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to RFWD2-DDR2 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to RFWD2-DDR2 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |