Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:RFWD2-RASAL2

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: RFWD2-RASAL2
	FusionPDB ID: 73680
	FusionGDB2.0 ID: 73680
		Hgene	Tgene
	Gene symbol	RFWD2	RASAL2
	Gene ID	64326	9462
	Gene name	COP1 E3 ubiquitin ligase	RAS protein activator like 2
	Synonyms	CFAP78\|FAP78\|RFWD2\|RNF200	NGAP
	Cytomap	1q25.1-q25.2	1q25.2
	Type of gene	protein-coding	protein-coding
	Description	E3 ubiquitin-protein ligase COP1E3 ubiquitin-protein ligase RFWD2RING finger protein 200RING-type E3 ubiquitin transferase RFWD2constitutive photomorphogenesis protein 1 homologconstitutive photomorphogenic protein 1putative ubiquitin ligase COP1ri	ras GTPase-activating protein nGAPRASAL2/ACVR1 fusionRas protein activator like 1
	Modification date	20200313	20200313
	UniProtAcc	.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000308769, ENST00000367669,	ENST00000462775, ENST00000465723, ENST00000367649, ENST00000448150,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	17 X 15 X 10=2550	15 X 14 X 7=1470
	# samples	20	19
	** MAII score	log2(20/2550*10)=-3.6724253419715 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(19/1470*10)=-2.95174483139278 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: RFWD2 [Title/Abstract] AND RASAL2 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: RFWD2 [Title/Abstract] AND RASAL2 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	RFWD2(176118141)-RASAL2(178389645), # samples:1
Anticipated loss of major functional domain due to fusion event.	RFWD2-RASAL2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. RFWD2-RASAL2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. RFWD2-RASAL2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. RFWD2-RASAL2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	RFWD2	GO:0010212	response to ionizing radiation	19805145

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr1:176118141/chr1:178389645)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across RFWD2 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across RASAL2 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000367669	RFWD2	chr1	176118141	-	ENST00000448150	RASAL2	chr1	178389645	+	10916	1346	515	4645	1376
ENST00000367669	RFWD2	chr1	176118141	-	ENST00000367649	RASAL2	chr1	178389645	+	4808	1346	515	4624	1369
ENST00000308769	RFWD2	chr1	176118141	-	ENST00000448150	RASAL2	chr1	178389645	+	10389	819	0	4118	1372
ENST00000308769	RFWD2	chr1	176118141	-	ENST00000367649	RASAL2	chr1	178389645	+	4281	819	0	4097	1365

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000367669	ENST00000448150	RFWD2	chr1	176118141	-	RASAL2	chr1	178389645	+	0.000360993	0.99963903
ENST00000367669	ENST00000367649	RFWD2	chr1	176118141	-	RASAL2	chr1	178389645	+	0.002552967	0.997447
ENST00000308769	ENST00000448150	RFWD2	chr1	176118141	-	RASAL2	chr1	178389645	+	0.000201602	0.9997985
ENST00000308769	ENST00000367649	RFWD2	chr1	176118141	-	RASAL2	chr1	178389645	+	0.001704819	0.99829525

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for RFWD2-RASAL2

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
RFWD2	chr1	176118141	RASAL2	chr1	178389645	1346	277	MEFLKVARRNKREGFFSKRLKGSIKR
RFWD2	chr1	176118141	RASAL2	chr1	178389645	819	273	MEFLKVARRNKREGFFSKRLKGSIKR

Top

Potential FusionNeoAntigen Information of RFWD2-RASAL2 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

RFWD2-RASAL2_176118141_178389645.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	HLA-B27:05	RRNKREGFF	0.9984	0.685	7	16
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	HLA-B27:02	RRNKREGFF	0.9983	0.5009	7	16
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	HLA-B27:04	RRNKREGFF	0.9983	0.688	7	16
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	HLA-B27:05	KREGFFSKR	0.9964	0.8983	10	19
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	HLA-B27:04	ARRNKREGF	0.9841	0.6826	6	15
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	HLA-B44:03	REGFFSKRL	0.9713	0.9428	11	20
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	HLA-B47:01	REGFFSKRL	0.9481	0.6447	11	20
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	HLA-B39:13	REGFFSKRL	0.2264	0.9104	11	20
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	HLA-B27:05	RRNKREGFFSK	0.9998	0.676	7	18
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	HLA-B27:04	RRNKREGFFSK	0.9987	0.6752	7	18
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	HLA-B27:14	KREGFFSKR	0.9963	0.7841	10	19
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	HLA-C07:95	RRNKREGFF	0.9474	0.5927	7	16
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	HLA-B27:03	RRNKREGFF	0.9431	0.6963	7	16
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	HLA-C07:05	RRNKREGFF	0.9272	0.8528	7	16
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	HLA-C07:27	RRNKREGFF	0.9172	0.8795	7	16
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	HLA-B27:03	KREGFFSKR	0.8337	0.9077	10	19
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	HLA-C07:46	RRNKREGFF	0.7389	0.8491	7	16
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	HLA-B39:08	REGFFSKRL	0.3591	0.8411	11	20
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	HLA-B27:14	RRNKREGFFSK	0.9998	0.6196	7	18
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	HLA-B27:14	KREGFFSKRLK	0.9983	0.6763	10	21
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	HLA-B27:03	RRNKREGFFSK	0.9943	0.6966	7	18
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	HLA-B27:08	RRNKREGFF	0.9983	0.6107	7	16
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	HLA-B27:10	RRNKREGFF	0.9982	0.7699	7	16
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	HLA-B27:06	RRNKREGFF	0.9971	0.6588	7	16
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	HLA-B40:04	REGFFSKRL	0.9958	0.6773	11	20
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	HLA-B27:10	KREGFFSKR	0.9941	0.8724	10	19
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	HLA-B27:10	ARRNKREGF	0.9861	0.7683	6	15
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	HLA-B27:09	RRNKREGFF	0.9817	0.6514	7	16
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	HLA-C07:01	RRNKREGFF	0.9731	0.6003	7	16
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	HLA-B44:26	REGFFSKRL	0.9713	0.9428	11	20
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	HLA-B44:13	REGFFSKRL	0.9713	0.9428	11	20
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	HLA-B44:07	REGFFSKRL	0.9713	0.9428	11	20
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	HLA-C07:22	RRNKREGFF	0.7008	0.6232	7	16
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	HLA-B41:03	REGFFSKRL	0.5432	0.6204	11	20
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	HLA-B39:02	REGFFSKRL	0.1952	0.9061	11	20
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	HLA-A30:01	RNKREGFFSK	0.9927	0.9106	8	18
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	HLA-B27:10	RRNKREGFFSK	0.9997	0.8235	7	18
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	HLA-B27:08	RRNKREGFFSK	0.9997	0.5928	7	18
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	HLA-B27:10	KREGFFSKRLK	0.999	0.805	10	21

Top

Potential FusionNeoAntigen Information of RFWD2-RASAL2 in HLA II

RFWD2-RASAL2_176118141_178389645.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-0303	MEFLKVARRNKREGF	0	15
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1102	MEFLKVARRNKREGF	0	15
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1102	EFLKVARRNKREGFF	1	16
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1103	MEFLKVARRNKREGF	0	15
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1103	EFLKVARRNKREGFF	1	16
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1111	MEFLKVARRNKREGF	0	15
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1114	MEFLKVARRNKREGF	0	15
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1116	MEFLKVARRNKREGF	0	15
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1116	EFLKVARRNKREGFF	1	16
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1120	MEFLKVARRNKREGF	0	15
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1121	MEFLKVARRNKREGF	0	15
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1121	EFLKVARRNKREGFF	1	16
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1136	MEFLKVARRNKREGF	0	15
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1136	EFLKVARRNKREGFF	1	16
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1141	MEFLKVARRNKREGF	0	15
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1148	MEFLKVARRNKREGF	0	15
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1148	EFLKVARRNKREGFF	1	16
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1155	MEFLKVARRNKREGF	0	15
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1155	EFLKVARRNKREGFF	1	16
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1159	MEFLKVARRNKREGF	0	15
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1159	EFLKVARRNKREGFF	1	16
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1163	MEFLKVARRNKREGF	0	15
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1163	EFLKVARRNKREGFF	1	16
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1165	MEFLKVARRNKREGF	0	15
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1165	EFLKVARRNKREGFF	1	16
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1168	MEFLKVARRNKREGF	0	15
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1170	MEFLKVARRNKREGF	0	15
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1170	EFLKVARRNKREGFF	1	16
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1176	MEFLKVARRNKREGF	0	15
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1176	EFLKVARRNKREGFF	1	16
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1185	MEFLKVARRNKREGF	0	15
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1185	EFLKVARRNKREGFF	1	16
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1186	MEFLKVARRNKREGF	0	15
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1186	EFLKVARRNKREGFF	1	16
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1301	MEFLKVARRNKREGF	0	15
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1301	EFLKVARRNKREGFF	1	16
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1302	MEFLKVARRNKREGF	0	15
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1308	MEFLKVARRNKREGF	0	15
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1308	EFLKVARRNKREGFF	1	16
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1315	MEFLKVARRNKREGF	0	15
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1315	EFLKVARRNKREGFF	1	16
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1316	MEFLKVARRNKREGF	0	15
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1316	EFLKVARRNKREGFF	1	16
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1317	MEFLKVARRNKREGF	0	15
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1319	MEFLKVARRNKREGF	0	15
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1319	EFLKVARRNKREGFF	1	16
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1320	MEFLKVARRNKREGF	0	15
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1320	EFLKVARRNKREGFF	1	16
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1322	MEFLKVARRNKREGF	0	15
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1322	EFLKVARRNKREGFF	1	16
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1323	MEFLKVARRNKREGF	0	15
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1324	MEFLKVARRNKREGF	0	15
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1324	EFLKVARRNKREGFF	1	16
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1327	MEFLKVARRNKREGF	0	15
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1327	EFLKVARRNKREGFF	1	16
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1329	MEFLKVARRNKREGF	0	15
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1334	MEFLKVARRNKREGF	0	15
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1335	MEFLKVARRNKREGF	0	15
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1335	EFLKVARRNKREGFF	1	16
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1336	MEFLKVARRNKREGF	0	15
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1339	MEFLKVARRNKREGF	0	15
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1341	MEFLKVARRNKREGF	0	15
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1351	MEFLKVARRNKREGF	0	15
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1351	EFLKVARRNKREGFF	1	16
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1352	MEFLKVARRNKREGF	0	15
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1352	EFLKVARRNKREGFF	1	16
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1353	MEFLKVARRNKREGF	0	15
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1353	EFLKVARRNKREGFF	1	16
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1357	MEFLKVARRNKREGF	0	15
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1357	EFLKVARRNKREGFF	1	16
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1359	MEFLKVARRNKREGF	0	15
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1359	EFLKVARRNKREGFF	1	16
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1361	MEFLKVARRNKREGF	0	15
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1361	EFLKVARRNKREGFF	1	16
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1363	MEFLKVARRNKREGF	0	15
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1364	MEFLKVARRNKREGF	0	15
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1364	EFLKVARRNKREGFF	1	16
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1368	MEFLKVARRNKREGF	0	15
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1368	EFLKVARRNKREGFF	1	16
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1369	MEFLKVARRNKREGF	0	15
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1369	EFLKVARRNKREGFF	1	16
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1370	MEFLKVARRNKREGF	0	15
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1370	EFLKVARRNKREGFF	1	16
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1371	MEFLKVARRNKREGF	0	15
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1371	EFLKVARRNKREGFF	1	16
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1372	MEFLKVARRNKREGF	0	15
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1372	EFLKVARRNKREGFF	1	16
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1373	MEFLKVARRNKREGF	0	15
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1374	MEFLKVARRNKREGF	0	15
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1376	MEFLKVARRNKREGF	0	15
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1376	EFLKVARRNKREGFF	1	16
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1378	MEFLKVARRNKREGF	0	15
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1378	EFLKVARRNKREGFF	1	16
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1379	MEFLKVARRNKREGF	0	15
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1379	EFLKVARRNKREGFF	1	16
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1380	MEFLKVARRNKREGF	0	15
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1380	EFLKVARRNKREGFF	1	16
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1383	MEFLKVARRNKREGF	0	15
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1383	EFLKVARRNKREGFF	1	16
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1384	MEFLKVARRNKREGF	0	15
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1384	EFLKVARRNKREGFF	1	16
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1387	MEFLKVARRNKREGF	0	15
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1387	EFLKVARRNKREGFF	1	16
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1391	MEFLKVARRNKREGF	0	15
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1391	EFLKVARRNKREGFF	1	16
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1392	MEFLKVARRNKREGF	0	15
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1392	EFLKVARRNKREGFF	1	16
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1396	MEFLKVARRNKREGF	0	15
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1396	EFLKVARRNKREGFF	1	16
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1397	MEFLKVARRNKREGF	0	15
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1398	MEFLKVARRNKREGF	0	15
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1398	EFLKVARRNKREGFF	1	16
RFWD2-RASAL2	chr1	176118141	chr1	178389645	819	DRB1-1399	MEFLKVARRNKREGF	0	15

Top

Fusion breakpoint peptide structures of RFWD2-RASAL2

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
562	ARRNKREGFFSKRL	RFWD2	RASAL2	chr1	176118141	chr1	178389645	819

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of RFWD2-RASAL2

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	562	ARRNKREGFFSKRL	-7.9962	-8.1096
HLA-B14:02	3BVN	562	ARRNKREGFFSKRL	-5.70842	-6.74372
HLA-B52:01	3W39	562	ARRNKREGFFSKRL	-6.83737	-6.95077
HLA-B52:01	3W39	562	ARRNKREGFFSKRL	-4.4836	-5.5189
HLA-A11:01	4UQ2	562	ARRNKREGFFSKRL	-10.0067	-10.1201
HLA-A11:01	4UQ2	562	ARRNKREGFFSKRL	-9.03915	-10.0745
HLA-A24:02	5HGA	562	ARRNKREGFFSKRL	-6.56204	-6.67544
HLA-A24:02	5HGA	562	ARRNKREGFFSKRL	-5.42271	-6.45801
HLA-B44:05	3DX8	562	ARRNKREGFFSKRL	-7.85648	-8.89178
HLA-B44:05	3DX8	562	ARRNKREGFFSKRL	-5.3978	-5.5112
HLA-A02:01	6TDR	562	ARRNKREGFFSKRL	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of RFWD2-RASAL2

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
RFWD2-RASAL2	chr1	176118141	chr1	178389645	10	19	KREGFFSKR	AAGAGAGAGGGATTCTTCAGCAAGCGC
RFWD2-RASAL2	chr1	176118141	chr1	178389645	10	21	KREGFFSKRLK	AAGAGAGAGGGATTCTTCAGCAAGCGCCTGAAA
RFWD2-RASAL2	chr1	176118141	chr1	178389645	11	20	REGFFSKRL	AGAGAGGGATTCTTCAGCAAGCGCCTG
RFWD2-RASAL2	chr1	176118141	chr1	178389645	6	15	ARRNKREGF	GCAAGAAGAAATAAGAGAGAGGGATTC
RFWD2-RASAL2	chr1	176118141	chr1	178389645	7	16	RRNKREGFF	AGAAGAAATAAGAGAGAGGGATTCTTC
RFWD2-RASAL2	chr1	176118141	chr1	178389645	7	18	RRNKREGFFSK	AGAAGAAATAAGAGAGAGGGATTCTTCAGCAAG
RFWD2-RASAL2	chr1	176118141	chr1	178389645	8	18	RNKREGFFSK	AGAAATAAGAGAGAGGGATTCTTCAGCAAG

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
RFWD2-RASAL2	chr1	176118141	chr1	178389645	0	15	MEFLKVARRNKREGF	ATGGAATTCCTCAAGGTTGCAAGAAGAAATAAGAGAGAGGGATTC
RFWD2-RASAL2	chr1	176118141	chr1	178389645	1	16	EFLKVARRNKREGFF	GAATTCCTCAAGGTTGCAAGAAGAAATAAGAGAGAGGGATTCTTC

Top

Information of the samples that have these potential fusion neoantigens of RFWD2-RASAL2

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
STAD	RFWD2-RASAL2	chr1	176118141	ENST00000308769	chr1	178389645	ENST00000367649	TCGA-BR-6565

Top

Potential target of CAR-T therapy development for RFWD2-RASAL2

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to RFWD2-RASAL2

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to RFWD2-RASAL2

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)