Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:RMDN1-ESRP1

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: RMDN1-ESRP1
	FusionPDB ID: 74235
	FusionGDB2.0 ID: 74235
		Hgene	Tgene
	Gene symbol	RMDN1	ESRP1
	Gene ID	51115	54845
	Gene name	regulator of microtubule dynamics 1	epithelial splicing regulatory protein 1
	Synonyms	CGI-90\|FAM82B\|RMD-1\|RMD1	DFNB109\|RBM35A\|RMB35A
	Cytomap	8q21.3	8q22.1
	Type of gene	protein-coding	protein-coding
	Description	regulator of microtubule dynamics protein 1family with sequence similarity 82, member Bmicrotubule-associated protein	epithelial splicing regulatory protein 1RNA-binding motif protein 35ARNA-binding protein 35A
	Modification date	20200313	20200313
	UniProtAcc	Q96DB5 Main function of 5'-partner protein:	Q6NXG1 Main function of 5'-partner protein: FUNCTION: mRNA splicing factor that regulates the formation of epithelial cell-specific isoforms. Specifically regulates the expression of FGFR2-IIIb, an epithelial cell-specific isoform of FGFR2. Also regulates the splicing of CD44, CTNND1, ENAH, 3 transcripts that undergo changes in splicing during the epithelial-to-mesenchymal transition (EMT). Acts by directly binding specific sequences in mRNAs. Binds the GU-rich sequence motifs in the ISE/ISS-3, a cis-element regulatory region present in the mRNA of FGFR2 (PubMed:19285943). Regulates splicing and expression of genes involved in inner ear development, auditory hair cell differentiation, and cell fate specification in the cochlear epithelium (By similarity). {ECO:0000250\|UniProtKB:Q3US41, ECO:0000269\|PubMed:19285943}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000406452, ENST00000430676, ENST00000519966, ENST00000523911, ENST00000518772,	ENST00000523347, ENST00000358397, ENST00000423620, ENST00000433389, ENST00000454170,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	5 X 6 X 2=60	14 X 16 X 7=1568
	# samples	6	15
	** MAII score	log2(6/60*10)=0	log2(15/1568*10)=-3.38589115361933 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: RMDN1 [Title/Abstract] AND ESRP1 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: RMDN1 [Title/Abstract] AND ESRP1 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	RMDN1(87519224)-ESRP1(95674729), # samples:2
Anticipated loss of major functional domain due to fusion event.	RMDN1-ESRP1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. RMDN1-ESRP1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. RMDN1-ESRP1 seems lost the major protein functional domain in Tgene partner, which is a essential gene due to the frame-shifted ORF. RMDN1-ESRP1 seems lost the major protein functional domain in Tgene partner, which is a tumor suppressor due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Tgene	ESRP1	GO:0043484	regulation of RNA splicing	19285943

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr8:87519224/chr8:95674729)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across RMDN1 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across ESRP1 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000406452	RMDN1	chr8	87519224	-	ENST00000423620	ESRP1	chr8	95674729	+	3319	407	151	1797	548
ENST00000406452	RMDN1	chr8	87519224	-	ENST00000433389	ESRP1	chr8	95674729	+	3398	407	151	1863	570
ENST00000406452	RMDN1	chr8	87519224	-	ENST00000358397	ESRP1	chr8	95674729	+	3429	407	151	1851	566
ENST00000406452	RMDN1	chr8	87519224	-	ENST00000454170	ESRP1	chr8	95674729	+	3180	407	151	1644	497
ENST00000519966	RMDN1	chr8	87519224	-	ENST00000423620	ESRP1	chr8	95674729	+	3220	308	52	1698	548
ENST00000519966	RMDN1	chr8	87519224	-	ENST00000433389	ESRP1	chr8	95674729	+	3299	308	52	1764	570
ENST00000519966	RMDN1	chr8	87519224	-	ENST00000358397	ESRP1	chr8	95674729	+	3330	308	52	1752	566
ENST00000519966	RMDN1	chr8	87519224	-	ENST00000454170	ESRP1	chr8	95674729	+	3081	308	52	1545	497
ENST00000430676	RMDN1	chr8	87519224	-	ENST00000423620	ESRP1	chr8	95674729	+	3214	302	46	1692	548
ENST00000430676	RMDN1	chr8	87519224	-	ENST00000433389	ESRP1	chr8	95674729	+	3293	302	46	1758	570
ENST00000430676	RMDN1	chr8	87519224	-	ENST00000358397	ESRP1	chr8	95674729	+	3324	302	46	1746	566
ENST00000430676	RMDN1	chr8	87519224	-	ENST00000454170	ESRP1	chr8	95674729	+	3075	302	46	1539	497
ENST00000406452	RMDN1	chr8	87519223	-	ENST00000423620	ESRP1	chr8	95674728	+	3319	407	151	1797	548
ENST00000406452	RMDN1	chr8	87519223	-	ENST00000433389	ESRP1	chr8	95674728	+	3398	407	151	1863	570
ENST00000406452	RMDN1	chr8	87519223	-	ENST00000358397	ESRP1	chr8	95674728	+	3429	407	151	1851	566
ENST00000406452	RMDN1	chr8	87519223	-	ENST00000454170	ESRP1	chr8	95674728	+	3180	407	151	1644	497
ENST00000519966	RMDN1	chr8	87519223	-	ENST00000423620	ESRP1	chr8	95674728	+	3220	308	52	1698	548
ENST00000519966	RMDN1	chr8	87519223	-	ENST00000433389	ESRP1	chr8	95674728	+	3299	308	52	1764	570
ENST00000519966	RMDN1	chr8	87519223	-	ENST00000358397	ESRP1	chr8	95674728	+	3330	308	52	1752	566
ENST00000519966	RMDN1	chr8	87519223	-	ENST00000454170	ESRP1	chr8	95674728	+	3081	308	52	1545	497
ENST00000430676	RMDN1	chr8	87519223	-	ENST00000423620	ESRP1	chr8	95674728	+	3214	302	46	1692	548
ENST00000430676	RMDN1	chr8	87519223	-	ENST00000433389	ESRP1	chr8	95674728	+	3293	302	46	1758	570
ENST00000430676	RMDN1	chr8	87519223	-	ENST00000358397	ESRP1	chr8	95674728	+	3324	302	46	1746	566
ENST00000430676	RMDN1	chr8	87519223	-	ENST00000454170	ESRP1	chr8	95674728	+	3075	302	46	1539	497

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000406452	ENST00000423620	RMDN1	chr8	87519224	-	ESRP1	chr8	95674729	+	0.00032321	0.9996768
ENST00000406452	ENST00000433389	RMDN1	chr8	87519224	-	ESRP1	chr8	95674729	+	0.000414789	0.9995852
ENST00000406452	ENST00000358397	RMDN1	chr8	87519224	-	ESRP1	chr8	95674729	+	0.000348653	0.9996513
ENST00000406452	ENST00000454170	RMDN1	chr8	87519224	-	ESRP1	chr8	95674729	+	0.00024996	0.9997501
ENST00000519966	ENST00000423620	RMDN1	chr8	87519224	-	ESRP1	chr8	95674729	+	0.000309623	0.9996904
ENST00000519966	ENST00000433389	RMDN1	chr8	87519224	-	ESRP1	chr8	95674729	+	0.000409736	0.9995902
ENST00000519966	ENST00000358397	RMDN1	chr8	87519224	-	ESRP1	chr8	95674729	+	0.00034229	0.99965775
ENST00000519966	ENST00000454170	RMDN1	chr8	87519224	-	ESRP1	chr8	95674729	+	0.000242884	0.9997571
ENST00000430676	ENST00000423620	RMDN1	chr8	87519224	-	ESRP1	chr8	95674729	+	0.000307909	0.9996921
ENST00000430676	ENST00000433389	RMDN1	chr8	87519224	-	ESRP1	chr8	95674729	+	0.000406773	0.9995932
ENST00000430676	ENST00000358397	RMDN1	chr8	87519224	-	ESRP1	chr8	95674729	+	0.000340103	0.9996599
ENST00000430676	ENST00000454170	RMDN1	chr8	87519224	-	ESRP1	chr8	95674729	+	0.000241053	0.9997589
ENST00000406452	ENST00000423620	RMDN1	chr8	87519223	-	ESRP1	chr8	95674728	+	0.00032321	0.9996768
ENST00000406452	ENST00000433389	RMDN1	chr8	87519223	-	ESRP1	chr8	95674728	+	0.000414789	0.9995852
ENST00000406452	ENST00000358397	RMDN1	chr8	87519223	-	ESRP1	chr8	95674728	+	0.000348653	0.9996513
ENST00000406452	ENST00000454170	RMDN1	chr8	87519223	-	ESRP1	chr8	95674728	+	0.00024996	0.9997501
ENST00000519966	ENST00000423620	RMDN1	chr8	87519223	-	ESRP1	chr8	95674728	+	0.000309623	0.9996904
ENST00000519966	ENST00000433389	RMDN1	chr8	87519223	-	ESRP1	chr8	95674728	+	0.000409736	0.9995902
ENST00000519966	ENST00000358397	RMDN1	chr8	87519223	-	ESRP1	chr8	95674728	+	0.00034229	0.99965775
ENST00000519966	ENST00000454170	RMDN1	chr8	87519223	-	ESRP1	chr8	95674728	+	0.000242884	0.9997571
ENST00000430676	ENST00000423620	RMDN1	chr8	87519223	-	ESRP1	chr8	95674728	+	0.000307909	0.9996921
ENST00000430676	ENST00000433389	RMDN1	chr8	87519223	-	ESRP1	chr8	95674728	+	0.000406773	0.9995932
ENST00000430676	ENST00000358397	RMDN1	chr8	87519223	-	ESRP1	chr8	95674728	+	0.000340103	0.9996599
ENST00000430676	ENST00000454170	RMDN1	chr8	87519223	-	ESRP1	chr8	95674728	+	0.000241053	0.9997589

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for RMDN1-ESRP1

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
RMDN1	chr8	87519223	ESRP1	chr8	95674728	302	85	VISQAAVVHATAKDHRFSDPERVNYK
RMDN1	chr8	87519223	ESRP1	chr8	95674728	308	85	VISQAAVVHATAKDHRFSDPERVNYK
RMDN1	chr8	87519223	ESRP1	chr8	95674728	407	85	VISQAAVVHATAKDHRFSDPERVNYK
RMDN1	chr8	87519224	ESRP1	chr8	95674729	302	85	VISQAAVVHATAKDHRFSDPERVNYK
RMDN1	chr8	87519224	ESRP1	chr8	95674729	308	85	VISQAAVVHATAKDHRFSDPERVNYK
RMDN1	chr8	87519224	ESRP1	chr8	95674729	407	85	VISQAAVVHATAKDHRFSDPERVNYK

Top

Potential FusionNeoAntigen Information of RMDN1-ESRP1 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

RMDN1-ESRP1_87519223_95674728.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
RMDN1-ESRP1	chr8	87519223	chr8	95674728	407	HLA-B58:02	HATAKDHRF	0.7396	0.7755	8	17
RMDN1-ESRP1	chr8	87519223	chr8	95674728	407	HLA-B38:01	VHATAKDHRF	0.9533	0.7271	7	17
RMDN1-ESRP1	chr8	87519223	chr8	95674728	407	HLA-B38:02	VHATAKDHRF	0.9469	0.7356	7	17
RMDN1-ESRP1	chr8	87519223	chr8	95674728	407	HLA-B27:07	KDHRFSDPERV	0.9919	0.6443	12	23
RMDN1-ESRP1	chr8	87519223	chr8	95674728	407	HLA-C03:14	HATAKDHRF	0.1443	0.9438	8	17
RMDN1-ESRP1	chr8	87519223	chr8	95674728	407	HLA-C12:12	HATAKDHRF	0.0087	0.8742	8	17
RMDN1-ESRP1	chr8	87519223	chr8	95674728	407	HLA-C12:04	HATAKDHRF	0.006	0.9732	8	17
RMDN1-ESRP1	chr8	87519223	chr8	95674728	407	HLA-C06:03	HATAKDHRF	0.0055	0.9633	8	17
RMDN1-ESRP1	chr8	87519223	chr8	95674728	407	HLA-C03:02	HATAKDHRF	0.9622	0.9473	8	17
RMDN1-ESRP1	chr8	87519223	chr8	95674728	407	HLA-B58:06	HATAKDHRF	0.8455	0.6265	8	17
RMDN1-ESRP1	chr8	87519223	chr8	95674728	407	HLA-B35:11	HATAKDHRF	0.822	0.7315	8	17
RMDN1-ESRP1	chr8	87519223	chr8	95674728	407	HLA-B35:23	HATAKDHRF	0.7399	0.7188	8	17
RMDN1-ESRP1	chr8	87519223	chr8	95674728	407	HLA-B57:02	HATAKDHRF	0.6381	0.7812	8	17
RMDN1-ESRP1	chr8	87519223	chr8	95674728	407	HLA-C16:04	HATAKDHRF	0.31	0.9477	8	17
RMDN1-ESRP1	chr8	87519223	chr8	95674728	407	HLA-C16:01	HATAKDHRF	0.2755	0.9318	8	17
RMDN1-ESRP1	chr8	87519223	chr8	95674728	407	HLA-B35:43	HATAKDHRF	0.1084	0.6855	8	17
RMDN1-ESRP1	chr8	87519223	chr8	95674728	407	HLA-C16:02	HATAKDHRF	0.0675	0.9238	8	17
RMDN1-ESRP1	chr8	87519223	chr8	95674728	407	HLA-C12:02	HATAKDHRF	0.0222	0.9531	8	17
RMDN1-ESRP1	chr8	87519223	chr8	95674728	407	HLA-C12:03	HATAKDHRF	0.0102	0.967	8	17
RMDN1-ESRP1	chr8	87519223	chr8	95674728	407	HLA-C02:02	HATAKDHRF	0.0078	0.9454	8	17
RMDN1-ESRP1	chr8	87519223	chr8	95674728	407	HLA-C02:10	HATAKDHRF	0.0078	0.9454	8	17
RMDN1-ESRP1	chr8	87519223	chr8	95674728	407	HLA-B38:05	VHATAKDHRF	0.9533	0.7271	7	17
RMDN1-ESRP1	chr8	87519223	chr8	95674728	407	HLA-B27:09	KDHRFSDPERV	0.9954	0.6803	12	23

Top

Potential FusionNeoAntigen Information of RMDN1-ESRP1 in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of RMDN1-ESRP1

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
10354	VVHATAKDHRFSDP	RMDN1	ESRP1	chr8	87519223	chr8	95674728	407

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of RMDN1-ESRP1

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	10354	VVHATAKDHRFSDP	-6.35143	-7.38673
HLA-B14:02	3BVN	10354	VVHATAKDHRFSDP	-5.20162	-5.31502
HLA-B52:01	3W39	10354	VVHATAKDHRFSDP	-6.03049	-6.14389
HLA-B52:01	3W39	10354	VVHATAKDHRFSDP	-5.12323	-6.15853
HLA-A24:02	5HGA	10354	VVHATAKDHRFSDP	-9.81198	-9.92538
HLA-A24:02	5HGA	10354	VVHATAKDHRFSDP	-7.16433	-8.19963
HLA-B44:05	3DX8	10354	VVHATAKDHRFSDP	-6.46131	-6.57471
HLA-B44:05	3DX8	10354	VVHATAKDHRFSDP	-3.08576	-4.12106
HLA-B35:01	1A1N	10354	VVHATAKDHRFSDP	-6.69492	-6.80832
HLA-B35:01	1A1N	10354	VVHATAKDHRFSDP	-5.92071	-6.95601
HLA-A02:01	6TDR	10354	VVHATAKDHRFSDP	-5.03933	-5.15273

Top

Vaccine Design for the FusionNeoAntigens of RMDN1-ESRP1

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
RMDN1-ESRP1	chr8	87519223	chr8	95674728	12	23	KDHRFSDPERV	AAGATCACAGGTTTTCAGATCCAGAGAGAGTGA
RMDN1-ESRP1	chr8	87519223	chr8	95674728	7	17	VHATAKDHRF	TTCATGCCACAGCCAAAGATCACAGGTTTT
RMDN1-ESRP1	chr8	87519223	chr8	95674728	8	17	HATAKDHRF	ATGCCACAGCCAAAGATCACAGGTTTT

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of RMDN1-ESRP1

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
BRCA	RMDN1-ESRP1	chr8	87519223	ENST00000406452	chr8	95674728	ENST00000358397	TCGA-AR-A0TY-01A

Top

Potential target of CAR-T therapy development for RMDN1-ESRP1

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to RMDN1-ESRP1

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to RMDN1-ESRP1

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner	Gene	Disease ID	Disease name	# pubmeds	Source
Tgene	ESRP1	C4693935	DEAFNESS, AUTOSOMAL RECESSIVE 109	1	GENOMICS_ENGLAND;UNIPROT

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)