![]() |
|||||||
|
Fusion Protein:ATF6-MNDA |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: ATF6-MNDA | FusionPDB ID: 7446 | FusionGDB2.0 ID: 7446 | Hgene | Tgene | Gene symbol | ATF6 | MNDA | Gene ID | 22926 | 4332 |
Gene name | activating transcription factor 6 | myeloid cell nuclear differentiation antigen | |
Synonyms | ACHM7|ATF6A | PYHIN3 | |
Cytomap | 1q23.3 | 1q23.1 | |
Type of gene | protein-coding | protein-coding | |
Description | cyclic AMP-dependent transcription factor ATF-6 alphacAMP-dependent transcription factor ATF-6 alpha | myeloid cell nuclear differentiation antigenepididymis secretory sperm binding protein | |
Modification date | 20200313 | 20200313 | |
UniProtAcc | Q99941 Main function of 5'-partner protein: FUNCTION: [Cyclic AMP-dependent transcription factor ATF-6 beta]: Precursor of the transcription factor form (Processed cyclic AMP-dependent transcription factor ATF-6 beta), which is embedded in the endoplasmic reticulum membrane (PubMed:11256944). Endoplasmic reticulum stress promotes processing of this form, releasing the transcription factor form that translocates into the nucleus, where it activates transcription of genes involved in the unfolded protein response (UPR) (PubMed:11256944). {ECO:0000269|PubMed:11256944}.; FUNCTION: [Processed cyclic AMP-dependent transcription factor ATF-6 beta]: Transcription factor that acts in the unfolded protein response (UPR) pathway by activating UPR target genes induced during ER stress (PubMed:11256944). Binds DNA on the 5'-CCAC[GA]-3' half of the ER stress response element (ERSE) (5'-CCAATN(9)CCAC[GA]-3') when NF-Y is bound to ERSE (PubMed:11256944). {ECO:0000269|PubMed:11256944}. | . | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000367942, ENST00000476437, | ENST00000491210, ENST00000368141, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 12 X 10 X 8=960 | 4 X 4 X 4=64 |
# samples | 12 | 5 | |
** MAII score | log2(12/960*10)=-3 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(5/64*10)=-0.356143810225275 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: ATF6 [Title/Abstract] AND MNDA [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: ATF6 [Title/Abstract] AND MNDA [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | ATF6(161789608)-MNDA(158815376), # samples:1 | ||
Anticipated loss of major functional domain due to fusion event. | ATF6-MNDA seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ATF6-MNDA seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ATF6-MNDA seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. ATF6-MNDA seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Hgene | ATF6 | GO:0043065 | positive regulation of apoptotic process | 14752510 |
Hgene | ATF6 | GO:0045944 | positive regulation of transcription by RNA polymerase II | 14973138 |
Hgene | ATF6 | GO:1903893 | positive regulation of ATF6-mediated unfolded protein response | 9837962 |
Hgene | ATF6 | GO:1990440 | positive regulation of transcription from RNA polymerase II promoter in response to endoplasmic reticulum stress | 11163209|11256944|16469704 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr1:161789608/chr1:158815376) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000367942 | ATF6 | chr1 | 161789608 | + | ENST00000368141 | MNDA | chr1 | 158815376 | + | 2083 | 1162 | 10 | 1815 | 601 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000367942 | ENST00000368141 | ATF6 | chr1 | 161789608 | + | MNDA | chr1 | 158815376 | + | 0.000683217 | 0.9993168 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for ATF6-MNDA |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
ATF6 | chr1 | 161789608 | MNDA | chr1 | 158815376 | 1162 | 384 | GTLKRQLDEVVSENQETQAQRQVDAR |
Top |
Potential FusionNeoAntigen Information of ATF6-MNDA in HLA I |
![]() |
ATF6-MNDA_161789608_158815376.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
ATF6-MNDA | chr1 | 161789608 | chr1 | 158815376 | 1162 | HLA-B50:02 | SENQETQA | 0.9991 | 0.6936 | 11 | 19 |
ATF6-MNDA | chr1 | 161789608 | chr1 | 158815376 | 1162 | HLA-B45:01 | SENQETQA | 0.9964 | 0.8999 | 11 | 19 |
ATF6-MNDA | chr1 | 161789608 | chr1 | 158815376 | 1162 | HLA-B41:01 | SENQETQA | 0.9844 | 0.9093 | 11 | 19 |
ATF6-MNDA | chr1 | 161789608 | chr1 | 158815376 | 1162 | HLA-B50:01 | SENQETQA | 0.9552 | 0.7903 | 11 | 19 |
ATF6-MNDA | chr1 | 161789608 | chr1 | 158815376 | 1162 | HLA-A33:05 | ENQETQAQR | 0.8649 | 0.6193 | 12 | 21 |
ATF6-MNDA | chr1 | 161789608 | chr1 | 158815376 | 1162 | HLA-A33:01 | ENQETQAQR | 0.8649 | 0.6193 | 12 | 21 |
ATF6-MNDA | chr1 | 161789608 | chr1 | 158815376 | 1162 | HLA-A68:05 | ENQETQAQR | 0.7006 | 0.5518 | 12 | 21 |
ATF6-MNDA | chr1 | 161789608 | chr1 | 158815376 | 1162 | HLA-B50:05 | SENQETQA | 0.9552 | 0.7903 | 11 | 19 |
ATF6-MNDA | chr1 | 161789608 | chr1 | 158815376 | 1162 | HLA-B50:04 | SENQETQA | 0.9552 | 0.7903 | 11 | 19 |
Top |
Potential FusionNeoAntigen Information of ATF6-MNDA in HLA II |
![]() |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of ATF6-MNDA |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
4837 | LDEVVSENQETQAQ | ATF6 | MNDA | chr1 | 161789608 | chr1 | 158815376 | 1162 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of ATF6-MNDA |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 4837 | LDEVVSENQETQAQ | -7.15543 | -7.26883 |
HLA-B14:02 | 3BVN | 4837 | LDEVVSENQETQAQ | -4.77435 | -5.80965 |
HLA-B52:01 | 3W39 | 4837 | LDEVVSENQETQAQ | -6.80875 | -6.92215 |
HLA-B52:01 | 3W39 | 4837 | LDEVVSENQETQAQ | -4.20386 | -5.23916 |
HLA-A11:01 | 4UQ2 | 4837 | LDEVVSENQETQAQ | -7.5194 | -8.5547 |
HLA-A11:01 | 4UQ2 | 4837 | LDEVVSENQETQAQ | -6.9601 | -7.0735 |
HLA-A24:02 | 5HGA | 4837 | LDEVVSENQETQAQ | -7.52403 | -7.63743 |
HLA-A24:02 | 5HGA | 4837 | LDEVVSENQETQAQ | -5.82433 | -6.85963 |
HLA-B27:05 | 6PYJ | 4837 | LDEVVSENQETQAQ | -3.28285 | -4.31815 |
HLA-B44:05 | 3DX8 | 4837 | LDEVVSENQETQAQ | -5.91172 | -6.94702 |
HLA-B44:05 | 3DX8 | 4837 | LDEVVSENQETQAQ | -4.24346 | -4.35686 |
Top |
Vaccine Design for the FusionNeoAntigens of ATF6-MNDA |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
ATF6-MNDA | chr1 | 161789608 | chr1 | 158815376 | 11 | 19 | SENQETQA | TCAGAGAATCAGGAAACCCAGGCC |
ATF6-MNDA | chr1 | 161789608 | chr1 | 158815376 | 12 | 21 | ENQETQAQR | GAGAATCAGGAAACCCAGGCCCAACGG |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of ATF6-MNDA |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
STAD | ATF6-MNDA | chr1 | 161789608 | ENST00000367942 | chr1 | 158815376 | ENST00000368141 | TCGA-BR-8371 |
Top |
Potential target of CAR-T therapy development for ATF6-MNDA |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to ATF6-MNDA |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to ATF6-MNDA |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |