Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:RNF111-TCF12

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: RNF111-TCF12
	FusionPDB ID: 74700
	FusionGDB2.0 ID: 74700
		Hgene	Tgene
	Gene symbol	RNF111	TCF12
	Gene ID	54778	6938
	Gene name	ring finger protein 111	transcription factor 12
	Synonyms	ARK\|hRNF111	CRS3\|HEB\|HTF4\|HsT17266\|TCF-12\|bHLHb20\|p64
	Cytomap	15q22.1-q22.2	15q21.3
	Type of gene	protein-coding	protein-coding
	Description	E3 ubiquitin-protein ligase ArkadiaArkadiaRING-type E3 ubiquitin transferase Arkadia	transcription factor 12DNA-binding protein HTF4E-box-binding proteinclass B basic helix-loop-helix protein 20helix-loop-helix transcription factor 4transcription factor HTF-4
	Modification date	20200327	20200313
	UniProtAcc	.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000348370, ENST00000434298, ENST00000557998, ENST00000559209, ENST00000561186, ENST00000560080,	ENST00000343827, ENST00000537840, ENST00000543579, ENST00000559703, ENST00000559710, ENST00000560764, ENST00000267811, ENST00000333725, ENST00000438423, ENST00000452095, ENST00000557843,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	11 X 8 X 9=792	21 X 22 X 8=3696
	# samples	14	26
	** MAII score	log2(14/792*10)=-2.50007360313464 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(26/3696*10)=-3.8293812283876 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: RNF111 [Title/Abstract] AND TCF12 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: RNF111 [Title/Abstract] AND TCF12 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	RNF111(59359282)-TCF12(57383987), # samples:1 RNF111(59280267)-TCF12(57565228), # samples:1 TCF12(57526305)-RNF111(59323003), # samples:1
Anticipated loss of major functional domain due to fusion event.	RNF111-TCF12 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. RNF111-TCF12 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. RNF111-TCF12 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. RNF111-TCF12 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Tgene	TCF12	GO:0045944	positive regulation of transcription by RNA polymerase II	11802795

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr15:59359282/chr15:57383987)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across RNF111 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across TCF12 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000348370	RNF111	chr15	59359282	-	ENST00000438423	TCF12	chr15	57383987	+	6387	2119	433	4017	1194
ENST00000348370	RNF111	chr15	59359282	-	ENST00000267811	TCF12	chr15	57383987	+	7654	2119	433	3945	1170
ENST00000348370	RNF111	chr15	59359282	-	ENST00000452095	TCF12	chr15	57383987	+	6387	2119	433	4017	1194
ENST00000348370	RNF111	chr15	59359282	-	ENST00000333725	TCF12	chr15	57383987	+	6381	2119	433	4017	1194
ENST00000348370	RNF111	chr15	59359282	-	ENST00000557843	TCF12	chr15	57383987	+	5886	2119	433	3945	1170
ENST00000434298	RNF111	chr15	59359282	-	ENST00000438423	TCF12	chr15	57383987	+	6376	2108	422	4006	1194
ENST00000434298	RNF111	chr15	59359282	-	ENST00000267811	TCF12	chr15	57383987	+	7643	2108	422	3934	1170
ENST00000434298	RNF111	chr15	59359282	-	ENST00000452095	TCF12	chr15	57383987	+	6376	2108	422	4006	1194
ENST00000434298	RNF111	chr15	59359282	-	ENST00000333725	TCF12	chr15	57383987	+	6370	2108	422	4006	1194
ENST00000434298	RNF111	chr15	59359282	-	ENST00000557843	TCF12	chr15	57383987	+	5875	2108	422	3934	1170
ENST00000559209	RNF111	chr15	59359282	-	ENST00000438423	TCF12	chr15	57383987	+	6090	1822	136	3720	1194
ENST00000559209	RNF111	chr15	59359282	-	ENST00000267811	TCF12	chr15	57383987	+	7357	1822	136	3648	1170
ENST00000559209	RNF111	chr15	59359282	-	ENST00000452095	TCF12	chr15	57383987	+	6090	1822	136	3720	1194
ENST00000559209	RNF111	chr15	59359282	-	ENST00000333725	TCF12	chr15	57383987	+	6084	1822	136	3720	1194
ENST00000559209	RNF111	chr15	59359282	-	ENST00000557843	TCF12	chr15	57383987	+	5589	1822	136	3648	1170
ENST00000557998	RNF111	chr15	59359282	-	ENST00000438423	TCF12	chr15	57383987	+	6241	1973	287	3871	1194
ENST00000557998	RNF111	chr15	59359282	-	ENST00000267811	TCF12	chr15	57383987	+	7508	1973	287	3799	1170
ENST00000557998	RNF111	chr15	59359282	-	ENST00000452095	TCF12	chr15	57383987	+	6241	1973	287	3871	1194
ENST00000557998	RNF111	chr15	59359282	-	ENST00000333725	TCF12	chr15	57383987	+	6235	1973	287	3871	1194
ENST00000557998	RNF111	chr15	59359282	-	ENST00000557843	TCF12	chr15	57383987	+	5740	1973	287	3799	1170
ENST00000561186	RNF111	chr15	59359282	-	ENST00000438423	TCF12	chr15	57383987	+	5954	1686	0	3584	1194
ENST00000561186	RNF111	chr15	59359282	-	ENST00000267811	TCF12	chr15	57383987	+	7221	1686	0	3512	1170
ENST00000561186	RNF111	chr15	59359282	-	ENST00000452095	TCF12	chr15	57383987	+	5954	1686	0	3584	1194
ENST00000561186	RNF111	chr15	59359282	-	ENST00000333725	TCF12	chr15	57383987	+	5948	1686	0	3584	1194
ENST00000561186	RNF111	chr15	59359282	-	ENST00000557843	TCF12	chr15	57383987	+	5453	1686	0	3512	1170

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000348370	ENST00000438423	RNF111	chr15	59359282	-	TCF12	chr15	57383987	+	0.000512685	0.9994873
ENST00000348370	ENST00000267811	RNF111	chr15	59359282	-	TCF12	chr15	57383987	+	0.000473281	0.99952674
ENST00000348370	ENST00000452095	RNF111	chr15	59359282	-	TCF12	chr15	57383987	+	0.000512685	0.9994873
ENST00000348370	ENST00000333725	RNF111	chr15	59359282	-	TCF12	chr15	57383987	+	0.000518272	0.99948174
ENST00000348370	ENST00000557843	RNF111	chr15	59359282	-	TCF12	chr15	57383987	+	0.00114388	0.99885607
ENST00000434298	ENST00000438423	RNF111	chr15	59359282	-	TCF12	chr15	57383987	+	0.000513531	0.99948645
ENST00000434298	ENST00000267811	RNF111	chr15	59359282	-	TCF12	chr15	57383987	+	0.000469207	0.9995308
ENST00000434298	ENST00000452095	RNF111	chr15	59359282	-	TCF12	chr15	57383987	+	0.000513531	0.99948645
ENST00000434298	ENST00000333725	RNF111	chr15	59359282	-	TCF12	chr15	57383987	+	0.000519146	0.9994809
ENST00000434298	ENST00000557843	RNF111	chr15	59359282	-	TCF12	chr15	57383987	+	0.001142024	0.998858
ENST00000559209	ENST00000438423	RNF111	chr15	59359282	-	TCF12	chr15	57383987	+	0.000344191	0.99965584
ENST00000559209	ENST00000267811	RNF111	chr15	59359282	-	TCF12	chr15	57383987	+	0.000324027	0.999676
ENST00000559209	ENST00000452095	RNF111	chr15	59359282	-	TCF12	chr15	57383987	+	0.000344191	0.99965584
ENST00000559209	ENST00000333725	RNF111	chr15	59359282	-	TCF12	chr15	57383987	+	0.000348171	0.9996518
ENST00000559209	ENST00000557843	RNF111	chr15	59359282	-	TCF12	chr15	57383987	+	0.000798817	0.99920124
ENST00000557998	ENST00000438423	RNF111	chr15	59359282	-	TCF12	chr15	57383987	+	0.000378969	0.99962103
ENST00000557998	ENST00000267811	RNF111	chr15	59359282	-	TCF12	chr15	57383987	+	0.000377372	0.9996226
ENST00000557998	ENST00000452095	RNF111	chr15	59359282	-	TCF12	chr15	57383987	+	0.000378969	0.99962103
ENST00000557998	ENST00000333725	RNF111	chr15	59359282	-	TCF12	chr15	57383987	+	0.000383225	0.99961674
ENST00000557998	ENST00000557843	RNF111	chr15	59359282	-	TCF12	chr15	57383987	+	0.000882429	0.99911755
ENST00000561186	ENST00000438423	RNF111	chr15	59359282	-	TCF12	chr15	57383987	+	0.000342477	0.9996575
ENST00000561186	ENST00000267811	RNF111	chr15	59359282	-	TCF12	chr15	57383987	+	0.000286853	0.9997131
ENST00000561186	ENST00000452095	RNF111	chr15	59359282	-	TCF12	chr15	57383987	+	0.000342477	0.9996575
ENST00000561186	ENST00000333725	RNF111	chr15	59359282	-	TCF12	chr15	57383987	+	0.000346208	0.9996538
ENST00000561186	ENST00000557843	RNF111	chr15	59359282	-	TCF12	chr15	57383987	+	0.0007946	0.9992054

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for RNF111-TCF12

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
RNF111	chr15	59359282	TCF12	chr15	57383987	1686	562	GANSSSGTSYHEQGFTDSPHYSDHLN
RNF111	chr15	59359282	TCF12	chr15	57383987	1822	562	GANSSSGTSYHEQGFTDSPHYSDHLN
RNF111	chr15	59359282	TCF12	chr15	57383987	1973	562	GANSSSGTSYHEQGFTDSPHYSDHLN
RNF111	chr15	59359282	TCF12	chr15	57383987	2108	562	GANSSSGTSYHEQGFTDSPHYSDHLN
RNF111	chr15	59359282	TCF12	chr15	57383987	2119	562	GANSSSGTSYHEQGFTDSPHYSDHLN

Top

Potential FusionNeoAntigen Information of RNF111-TCF12 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

RNF111-TCF12_59359282_57383987.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
RNF111-TCF12	chr15	59359282	chr15	57383987	2119	HLA-B45:01	HEQGFTDSP	0.9791	0.8162	10	19
RNF111-TCF12	chr15	59359282	chr15	57383987	2119	HLA-B50:02	HEQGFTDSP	0.9669	0.5994	10	19
RNF111-TCF12	chr15	59359282	chr15	57383987	2119	HLA-B41:01	HEQGFTDSP	0.3716	0.8915	10	19
RNF111-TCF12	chr15	59359282	chr15	57383987	2119	HLA-B50:01	HEQGFTDSP	0.3288	0.6716	10	19
RNF111-TCF12	chr15	59359282	chr15	57383987	2119	HLA-B15:01	EQGFTDSPHY	0.9849	0.6856	11	21
RNF111-TCF12	chr15	59359282	chr15	57383987	2119	HLA-B15:02	EQGFTDSPHY	0.8867	0.8018	11	21
RNF111-TCF12	chr15	59359282	chr15	57383987	2119	HLA-B44:03	HEQGFTDSPHY	0.9995	0.79	10	21
RNF111-TCF12	chr15	59359282	chr15	57383987	2119	HLA-B18:01	HEQGFTDSPHY	0.9863	0.7728	10	21
RNF111-TCF12	chr15	59359282	chr15	57383987	2119	HLA-B40:06	HEQGFTDSP	0.9698	0.7698	10	19
RNF111-TCF12	chr15	59359282	chr15	57383987	2119	HLA-B15:21	EQGFTDSPHY	0.8838	0.7542	11	21
RNF111-TCF12	chr15	59359282	chr15	57383987	2119	HLA-B15:05	EQGFTDSPHY	0.8727	0.679	11	21
RNF111-TCF12	chr15	59359282	chr15	57383987	2119	HLA-B15:31	EQGFTDSPHY	0.8478	0.687	11	21
RNF111-TCF12	chr15	59359282	chr15	57383987	2119	HLA-B15:20	QGFTDSPHY	0.9836	0.931	12	21
RNF111-TCF12	chr15	59359282	chr15	57383987	2119	HLA-B35:28	QGFTDSPHY	0.9717	0.9344	12	21
RNF111-TCF12	chr15	59359282	chr15	57383987	2119	HLA-B35:20	QGFTDSPHY	0.9626	0.9392	12	21
RNF111-TCF12	chr15	59359282	chr15	57383987	2119	HLA-B50:04	HEQGFTDSP	0.3288	0.6716	10	19
RNF111-TCF12	chr15	59359282	chr15	57383987	2119	HLA-B50:05	HEQGFTDSP	0.3288	0.6716	10	19
RNF111-TCF12	chr15	59359282	chr15	57383987	2119	HLA-B15:125	EQGFTDSPHY	0.9849	0.6856	11	21
RNF111-TCF12	chr15	59359282	chr15	57383987	2119	HLA-B15:33	EQGFTDSPHY	0.9849	0.6856	11	21
RNF111-TCF12	chr15	59359282	chr15	57383987	2119	HLA-B15:34	EQGFTDSPHY	0.9849	0.6856	11	21
RNF111-TCF12	chr15	59359282	chr15	57383987	2119	HLA-B15:135	EQGFTDSPHY	0.9812	0.6888	11	21
RNF111-TCF12	chr15	59359282	chr15	57383987	2119	HLA-B15:53	EQGFTDSPHY	0.9634	0.6496	11	21
RNF111-TCF12	chr15	59359282	chr15	57383987	2119	HLA-B15:50	EQGFTDSPHY	0.9612	0.7356	11	21
RNF111-TCF12	chr15	59359282	chr15	57383987	2119	HLA-B15:12	EQGFTDSPHY	0.9012	0.7302	11	21
RNF111-TCF12	chr15	59359282	chr15	57383987	2119	HLA-B15:54	EQGFTDSPHY	0.8787	0.6285	11	21
RNF111-TCF12	chr15	59359282	chr15	57383987	2119	HLA-B15:20	EQGFTDSPHY	0.8659	0.7603	11	21
RNF111-TCF12	chr15	59359282	chr15	57383987	2119	HLA-B35:28	EQGFTDSPHY	0.8296	0.7725	11	21
RNF111-TCF12	chr15	59359282	chr15	57383987	2119	HLA-B35:20	EQGFTDSPHY	0.8204	0.7836	11	21
RNF111-TCF12	chr15	59359282	chr15	57383987	2119	HLA-B18:04	EQGFTDSPHY	0.7439	0.7588	11	21
RNF111-TCF12	chr15	59359282	chr15	57383987	2119	HLA-B48:02	EQGFTDSPHY	0.6349	0.7445	11	21
RNF111-TCF12	chr15	59359282	chr15	57383987	2119	HLA-B44:26	HEQGFTDSPHY	0.9995	0.79	10	21
RNF111-TCF12	chr15	59359282	chr15	57383987	2119	HLA-B44:13	HEQGFTDSPHY	0.9995	0.79	10	21
RNF111-TCF12	chr15	59359282	chr15	57383987	2119	HLA-B44:07	HEQGFTDSPHY	0.9995	0.79	10	21
RNF111-TCF12	chr15	59359282	chr15	57383987	2119	HLA-B15:53	HEQGFTDSPHY	0.9986	0.7102	10	21
RNF111-TCF12	chr15	59359282	chr15	57383987	2119	HLA-B18:11	HEQGFTDSPHY	0.9962	0.7099	10	21
RNF111-TCF12	chr15	59359282	chr15	57383987	2119	HLA-B18:04	HEQGFTDSPHY	0.9901	0.7806	10	21
RNF111-TCF12	chr15	59359282	chr15	57383987	2119	HLA-B18:08	HEQGFTDSPHY	0.99	0.7462	10	21
RNF111-TCF12	chr15	59359282	chr15	57383987	2119	HLA-B18:06	HEQGFTDSPHY	0.9885	0.7761	10	21
RNF111-TCF12	chr15	59359282	chr15	57383987	2119	HLA-B35:20	HEQGFTDSPHY	0.9874	0.7653	10	21
RNF111-TCF12	chr15	59359282	chr15	57383987	2119	HLA-B18:05	HEQGFTDSPHY	0.9863	0.7728	10	21
RNF111-TCF12	chr15	59359282	chr15	57383987	2119	HLA-B18:03	HEQGFTDSPHY	0.9843	0.7592	10	21
RNF111-TCF12	chr15	59359282	chr15	57383987	2119	HLA-B48:02	HEQGFTDSPHY	0.9309	0.7373	10	21

Top

Potential FusionNeoAntigen Information of RNF111-TCF12 in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of RNF111-TCF12

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
3181	GTSYHEQGFTDSPH	RNF111	TCF12	chr15	59359282	chr15	57383987	2119

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of RNF111-TCF12

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	3181	GTSYHEQGFTDSPH	-6.07233	-6.07953
HLA-B52:01	3W39	3181	GTSYHEQGFTDSPH	-5.45645	-5.46365
HLA-A24:02	5HGA	3181	GTSYHEQGFTDSPH	-3.85827	-3.86547
HLA-B44:05	3DX8	3181	GTSYHEQGFTDSPH	-4.76301	-4.77021

Top

Vaccine Design for the FusionNeoAntigens of RNF111-TCF12

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
RNF111-TCF12	chr15	59359282	chr15	57383987	10	19	HEQGFTDSP	CATGAACAGGGTTTTACAGACAGCCCT
RNF111-TCF12	chr15	59359282	chr15	57383987	10	21	HEQGFTDSPHY	CATGAACAGGGTTTTACAGACAGCCCTCATTAC
RNF111-TCF12	chr15	59359282	chr15	57383987	11	21	EQGFTDSPHY	GAACAGGGTTTTACAGACAGCCCTCATTAC
RNF111-TCF12	chr15	59359282	chr15	57383987	12	21	QGFTDSPHY	CAGGGTTTTACAGACAGCCCTCATTAC

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of RNF111-TCF12

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
BRCA	RNF111-TCF12	chr15	59359282	ENST00000348370	chr15	57383987	ENST00000267811	TCGA-B6-A0RT-01A

Top

Potential target of CAR-T therapy development for RNF111-TCF12

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to RNF111-TCF12

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to RNF111-TCF12

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)