Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:RNF213-RBCK1

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: RNF213-RBCK1
	FusionPDB ID: 74985
	FusionGDB2.0 ID: 74985
		Hgene	Tgene
	Gene symbol	RNF213	RBCK1
	Gene ID	57674	10616
	Gene name	ring finger protein 213	RANBP2-type and C3HC4-type zinc finger containing 1
	Synonyms	ALO17\|C17orf27\|KIAA1618\|MYMY2\|MYSTR\|NET57	C20orf18\|HOIL-1\|HOIL1\|PBMEI\|PGBM1\|RBCK2\|RNF54\|UBCE7IP3\|XAP3\|XAP4\|ZRANB4
	Cytomap	17q25.3	20p13
	Type of gene	protein-coding	protein-coding
	Description	E3 ubiquitin-protein ligase RNF213ALK lymphoma oligomerization partner on chromosome 17RING-type E3 ubiquitin transferase RNF213mysterin	ranBP-type and C3HC4-type zinc finger-containing protein 1HBV-associated factor 4RBCC protein interacting with PKC1RING finger protein 54RING-type E3 ubiquitin transferase HOIL-1heme-oxidized IRP2 ubiquitin ligase 1hepatitis B virus X-associated pro
	Modification date	20200313	20200327
	UniProtAcc	Q63HN8 Main function of 5'-partner protein: FUNCTION: Atypical E3 ubiquitin ligase that can catalyze ubiquitination of both proteins and lipids, and which is involved in various processes, such as lipid metabolism, angiogenesis and cell-autonomous immunity (PubMed:21799892, PubMed:26126547, PubMed:26278786, PubMed:26766444, PubMed:30705059, PubMed:32139119, PubMed:34012115). Acts as a key immune sensor by catalyzing ubiquitination of the lipid A moiety of bacterial lipopolysaccharide (LPS) via its RZ-type zinc-finger: restricts the proliferation of cytosolic bacteria, such as Salmonella, by generating the bacterial ubiquitin coat through the ubiquitination of LPS (PubMed:34012115). Also acts indirectly by mediating the recruitment of the LUBAC complex, which conjugates linear polyubiquitin chains (PubMed:34012115). Ubiquitination of LPS triggers cell-autonomous immunity, such as antibacterial autophagy, leading to degradation of the microbial invader (PubMed:34012115). Involved in lipid metabolism by regulating fat storage and lipid droplet formation; act by inhibiting the lipolytic process (PubMed:30705059). Also regulates lipotoxicity by inhibiting desaturation of fatty acids (PubMed:30846318). Also acts as an E3 ubiquitin-protein ligase via its RING-type zinc finger: mediates 'Lys-63'-linked ubiquitination of target proteins (PubMed:32139119, PubMed:33842849). Involved in the non-canonical Wnt signaling pathway in vascular development: acts by mediating ubiquitination and degradation of FLNA and NFATC2 downstream of RSPO3, leading to inhibit the non-canonical Wnt signaling pathway and promoting vessel regression (PubMed:26766444). Also has ATPase activity; ATPase activity is required for ubiquitination of LPS (PubMed:34012115). {ECO:0000269\|PubMed:21799892, ECO:0000269\|PubMed:26126547, ECO:0000269\|PubMed:26278786, ECO:0000269\|PubMed:26766444, ECO:0000269\|PubMed:30705059, ECO:0000269\|PubMed:30846318, ECO:0000269\|PubMed:32139119, ECO:0000269\|PubMed:33842849, ECO:0000269\|PubMed:34012115}.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000319921, ENST00000456466, ENST00000508628, ENST00000582970, ENST00000336301, ENST00000427003,	ENST00000400245, ENST00000400247, ENST00000475269, ENST00000353660, ENST00000356286, ENST00000382181,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	34 X 32 X 16=17408	6 X 5 X 2=60
	# samples	41	8
	** MAII score	log2(41/17408*10)=-5.40798274174489 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(8/60*10)=0.415037499278844 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0
Fusion gene context	PubMed: RNF213 [Title/Abstract] AND RBCK1 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: RNF213 [Title/Abstract] AND RBCK1 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	RNF213(78282971)-RBCK1(407956), # samples:1 RNF213(78282971)-RBCK1(407957), # samples:1
Anticipated loss of major functional domain due to fusion event.	RNF213-RBCK1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. RNF213-RBCK1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. RNF213-RBCK1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. RNF213-RBCK1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	RNF213	GO:0016567	protein ubiquitination	21799892
Hgene	RNF213	GO:0051260	protein homooligomerization	24658080\|26126547
Hgene	RNF213	GO:0051865	protein autoubiquitination	21799892
Tgene	RBCK1	GO:0000209	protein polyubiquitination	12629548\|17006537
Tgene	RBCK1	GO:0032088	negative regulation of NF-kappaB transcription factor activity	17449468
Tgene	RBCK1	GO:0043123	positive regulation of I-kappaB kinase/NF-kappaB signaling	19136968\|21455173
Tgene	RBCK1	GO:0050852	T cell receptor signaling pathway	20005846
Tgene	RBCK1	GO:0051092	positive regulation of NF-kappaB transcription factor activity	19136968
Tgene	RBCK1	GO:0097039	protein linear polyubiquitination	21455173\|21455180\|21455181\|23453807

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr17:78282971/chr20:407956)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across RNF213 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across RBCK1 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000508628	RNF213	chr17	78282971	+	ENST00000356286	RBCK1	chr20	407956	+	3987	2947	145	3450	1101
ENST00000508628	RNF213	chr17	78282971	+	ENST00000353660	RBCK1	chr20	407956	+	3987	2947	145	3450	1101
ENST00000508628	RNF213	chr17	78282971	+	ENST00000382181	RBCK1	chr20	407956	+	3987	2947	145	3450	1101
ENST00000456466	RNF213	chr17	78282971	+	ENST00000356286	RBCK1	chr20	407956	+	3838	2798	143	3301	1052
ENST00000456466	RNF213	chr17	78282971	+	ENST00000353660	RBCK1	chr20	407956	+	3838	2798	143	3301	1052
ENST00000456466	RNF213	chr17	78282971	+	ENST00000382181	RBCK1	chr20	407956	+	3838	2798	143	3301	1052
ENST00000582970	RNF213	chr17	78282971	+	ENST00000356286	RBCK1	chr20	407956	+	3838	2798	143	3301	1052
ENST00000582970	RNF213	chr17	78282971	+	ENST00000353660	RBCK1	chr20	407956	+	3838	2798	143	3301	1052
ENST00000582970	RNF213	chr17	78282971	+	ENST00000382181	RBCK1	chr20	407956	+	3838	2798	143	3301	1052
ENST00000319921	RNF213	chr17	78282971	+	ENST00000356286	RBCK1	chr20	407956	+	3836	2796	141	3299	1052
ENST00000319921	RNF213	chr17	78282971	+	ENST00000353660	RBCK1	chr20	407956	+	3836	2796	141	3299	1052
ENST00000319921	RNF213	chr17	78282971	+	ENST00000382181	RBCK1	chr20	407956	+	3836	2796	141	3299	1052
ENST00000508628	RNF213	chr17	78282971	+	ENST00000356286	RBCK1	chr20	407957	+	3987	2947	145	3450	1101
ENST00000508628	RNF213	chr17	78282971	+	ENST00000353660	RBCK1	chr20	407957	+	3987	2947	145	3450	1101
ENST00000508628	RNF213	chr17	78282971	+	ENST00000382181	RBCK1	chr20	407957	+	3987	2947	145	3450	1101
ENST00000456466	RNF213	chr17	78282971	+	ENST00000356286	RBCK1	chr20	407957	+	3838	2798	143	3301	1052
ENST00000456466	RNF213	chr17	78282971	+	ENST00000353660	RBCK1	chr20	407957	+	3838	2798	143	3301	1052
ENST00000456466	RNF213	chr17	78282971	+	ENST00000382181	RBCK1	chr20	407957	+	3838	2798	143	3301	1052
ENST00000582970	RNF213	chr17	78282971	+	ENST00000356286	RBCK1	chr20	407957	+	3838	2798	143	3301	1052
ENST00000582970	RNF213	chr17	78282971	+	ENST00000353660	RBCK1	chr20	407957	+	3838	2798	143	3301	1052
ENST00000582970	RNF213	chr17	78282971	+	ENST00000382181	RBCK1	chr20	407957	+	3838	2798	143	3301	1052
ENST00000319921	RNF213	chr17	78282971	+	ENST00000356286	RBCK1	chr20	407957	+	3836	2796	141	3299	1052
ENST00000319921	RNF213	chr17	78282971	+	ENST00000353660	RBCK1	chr20	407957	+	3836	2796	141	3299	1052
ENST00000319921	RNF213	chr17	78282971	+	ENST00000382181	RBCK1	chr20	407957	+	3836	2796	141	3299	1052

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000508628	ENST00000356286	RNF213	chr17	78282971	+	RBCK1	chr20	407956	+	0.004954684	0.9950453
ENST00000508628	ENST00000353660	RNF213	chr17	78282971	+	RBCK1	chr20	407956	+	0.004954684	0.9950453
ENST00000508628	ENST00000382181	RNF213	chr17	78282971	+	RBCK1	chr20	407956	+	0.004954684	0.9950453
ENST00000456466	ENST00000356286	RNF213	chr17	78282971	+	RBCK1	chr20	407956	+	0.004240803	0.9957592
ENST00000456466	ENST00000353660	RNF213	chr17	78282971	+	RBCK1	chr20	407956	+	0.004240803	0.9957592
ENST00000456466	ENST00000382181	RNF213	chr17	78282971	+	RBCK1	chr20	407956	+	0.004240803	0.9957592
ENST00000582970	ENST00000356286	RNF213	chr17	78282971	+	RBCK1	chr20	407956	+	0.004240803	0.9957592
ENST00000582970	ENST00000353660	RNF213	chr17	78282971	+	RBCK1	chr20	407956	+	0.004240803	0.9957592
ENST00000582970	ENST00000382181	RNF213	chr17	78282971	+	RBCK1	chr20	407956	+	0.004240803	0.9957592
ENST00000319921	ENST00000356286	RNF213	chr17	78282971	+	RBCK1	chr20	407956	+	0.00424623	0.99575377
ENST00000319921	ENST00000353660	RNF213	chr17	78282971	+	RBCK1	chr20	407956	+	0.00424623	0.99575377
ENST00000319921	ENST00000382181	RNF213	chr17	78282971	+	RBCK1	chr20	407956	+	0.00424623	0.99575377
ENST00000508628	ENST00000356286	RNF213	chr17	78282971	+	RBCK1	chr20	407957	+	0.004954684	0.9950453
ENST00000508628	ENST00000353660	RNF213	chr17	78282971	+	RBCK1	chr20	407957	+	0.004954684	0.9950453
ENST00000508628	ENST00000382181	RNF213	chr17	78282971	+	RBCK1	chr20	407957	+	0.004954684	0.9950453
ENST00000456466	ENST00000356286	RNF213	chr17	78282971	+	RBCK1	chr20	407957	+	0.004240803	0.9957592
ENST00000456466	ENST00000353660	RNF213	chr17	78282971	+	RBCK1	chr20	407957	+	0.004240803	0.9957592
ENST00000456466	ENST00000382181	RNF213	chr17	78282971	+	RBCK1	chr20	407957	+	0.004240803	0.9957592
ENST00000582970	ENST00000356286	RNF213	chr17	78282971	+	RBCK1	chr20	407957	+	0.004240803	0.9957592
ENST00000582970	ENST00000353660	RNF213	chr17	78282971	+	RBCK1	chr20	407957	+	0.004240803	0.9957592
ENST00000582970	ENST00000382181	RNF213	chr17	78282971	+	RBCK1	chr20	407957	+	0.004240803	0.9957592
ENST00000319921	ENST00000356286	RNF213	chr17	78282971	+	RBCK1	chr20	407957	+	0.00424623	0.99575377
ENST00000319921	ENST00000353660	RNF213	chr17	78282971	+	RBCK1	chr20	407957	+	0.00424623	0.99575377
ENST00000319921	ENST00000382181	RNF213	chr17	78282971	+	RBCK1	chr20	407957	+	0.00424623	0.99575377

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for RNF213-RBCK1

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
RNF213	chr17	78282971	RBCK1	chr20	407956	2796	885	EIVCRMIRLLSLVLLTPEDYQRFLDL
RNF213	chr17	78282971	RBCK1	chr20	407956	2798	885	EIVCRMIRLLSLVLLTPEDYQRFLDL
RNF213	chr17	78282971	RBCK1	chr20	407956	2947	934	EIVCRMIRLLSLVLLTPEDYQRFLDL
RNF213	chr17	78282971	RBCK1	chr20	407957	2796	885	EIVCRMIRLLSLVLLTPEDYQRFLDL
RNF213	chr17	78282971	RBCK1	chr20	407957	2798	885	EIVCRMIRLLSLVLLTPEDYQRFLDL
RNF213	chr17	78282971	RBCK1	chr20	407957	2947	934	EIVCRMIRLLSLVLLTPEDYQRFLDL

Top

Potential FusionNeoAntigen Information of RNF213-RBCK1 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

RNF213-RBCK1_78282971_407956.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
RNF213-RBCK1	chr17	78282971	chr20	407956	2796	HLA-B27:05	IRLLSLVLL	0.9998	0.8967	6	15
RNF213-RBCK1	chr17	78282971	chr20	407956	2796	HLA-B27:02	IRLLSLVLL	0.9998	0.5876	6	15
RNF213-RBCK1	chr17	78282971	chr20	407956	2796	HLA-B27:04	IRLLSLVLL	0.9998	0.7321	6	15
RNF213-RBCK1	chr17	78282971	chr20	407956	2796	HLA-B14:01	IRLLSLVLL	0.9927	0.5654	6	15
RNF213-RBCK1	chr17	78282971	chr20	407956	2796	HLA-B14:02	IRLLSLVLL	0.9927	0.5654	6	15
RNF213-RBCK1	chr17	78282971	chr20	407956	2796	HLA-B08:01	MIRLLSLVL	0.9801	0.8822	5	14
RNF213-RBCK1	chr17	78282971	chr20	407956	2796	HLA-B08:09	MIRLLSLVL	0.9671	0.7736	5	14
RNF213-RBCK1	chr17	78282971	chr20	407956	2796	HLA-B27:02	RMIRLLSLVLL	0.992	0.6113	4	15
RNF213-RBCK1	chr17	78282971	chr20	407956	2796	HLA-B27:05	RMIRLLSLVLL	0.9913	0.8696	4	15
RNF213-RBCK1	chr17	78282971	chr20	407956	2796	HLA-B27:04	RMIRLLSLVLL	0.9891	0.753	4	15
RNF213-RBCK1	chr17	78282971	chr20	407956	2796	HLA-B27:14	IRLLSLVLL	0.9998	0.8003	6	15
RNF213-RBCK1	chr17	78282971	chr20	407956	2796	HLA-C07:05	IRLLSLVLL	0.9984	0.9621	6	15
RNF213-RBCK1	chr17	78282971	chr20	407956	2796	HLA-C07:95	IRLLSLVLL	0.9976	0.6675	6	15
RNF213-RBCK1	chr17	78282971	chr20	407956	2796	HLA-C07:27	IRLLSLVLL	0.9974	0.931	6	15
RNF213-RBCK1	chr17	78282971	chr20	407956	2796	HLA-C07:29	IRLLSLVLL	0.9966	0.9234	6	15
RNF213-RBCK1	chr17	78282971	chr20	407956	2796	HLA-C07:13	IRLLSLVLL	0.992	0.8682	6	15
RNF213-RBCK1	chr17	78282971	chr20	407956	2796	HLA-B27:03	IRLLSLVLL	0.9911	0.9145	6	15
RNF213-RBCK1	chr17	78282971	chr20	407956	2796	HLA-C07:19	IRLLSLVLL	0.972	0.6497	6	15
RNF213-RBCK1	chr17	78282971	chr20	407956	2796	HLA-C07:80	IRLLSLVLL	0.9706	0.9067	6	15
RNF213-RBCK1	chr17	78282971	chr20	407956	2796	HLA-C07:67	IRLLSLVLL	0.9706	0.9067	6	15
RNF213-RBCK1	chr17	78282971	chr20	407956	2796	HLA-C07:10	IRLLSLVLL	0.9705	0.9464	6	15
RNF213-RBCK1	chr17	78282971	chr20	407956	2796	HLA-C07:46	IRLLSLVLL	0.9662	0.7903	6	15
RNF213-RBCK1	chr17	78282971	chr20	407956	2796	HLA-B39:12	IRLLSLVLL	0.9656	0.9134	6	15
RNF213-RBCK1	chr17	78282971	chr20	407956	2796	HLA-B27:03	RMIRLLSLVLL	0.6685	0.8875	4	15
RNF213-RBCK1	chr17	78282971	chr20	407956	2796	HLA-B27:10	IRLLSLVLL	0.9998	0.8702	6	15
RNF213-RBCK1	chr17	78282971	chr20	407956	2796	HLA-B27:06	IRLLSLVLL	0.9998	0.7243	6	15
RNF213-RBCK1	chr17	78282971	chr20	407956	2796	HLA-B27:08	IRLLSLVLL	0.9998	0.8031	6	15
RNF213-RBCK1	chr17	78282971	chr20	407956	2796	HLA-B27:09	IRLLSLVLL	0.9994	0.8762	6	15
RNF213-RBCK1	chr17	78282971	chr20	407956	2796	HLA-C07:01	IRLLSLVLL	0.998	0.6018	6	15
RNF213-RBCK1	chr17	78282971	chr20	407956	2796	HLA-B08:18	MIRLLSLVL	0.9801	0.8822	5	14
RNF213-RBCK1	chr17	78282971	chr20	407956	2796	HLA-C07:02	IRLLSLVLL	0.9706	0.9067	6	15
RNF213-RBCK1	chr17	78282971	chr20	407956	2796	HLA-C07:22	IRLLSLVLL	0.9152	0.7468	6	15
RNF213-RBCK1	chr17	78282971	chr20	407956	2796	HLA-C06:08	IRLLSLVLL	0.9103	0.9836	6	15
RNF213-RBCK1	chr17	78282971	chr20	407956	2796	HLA-B08:12	MIRLLSLVL	0.7861	0.9538	5	14
RNF213-RBCK1	chr17	78282971	chr20	407956	2796	HLA-C06:17	IRLLSLVLL	0.3222	0.9926	6	15
RNF213-RBCK1	chr17	78282971	chr20	407956	2796	HLA-C06:02	IRLLSLVLL	0.3222	0.9926	6	15
RNF213-RBCK1	chr17	78282971	chr20	407956	2796	HLA-B27:08	RMIRLLSLVLL	0.9895	0.7632	4	15
RNF213-RBCK1	chr17	78282971	chr20	407956	2796	HLA-B27:06	RMIRLLSLVLL	0.9731	0.7705	4	15
RNF213-RBCK1	chr17	78282971	chr20	407956	2796	HLA-B27:09	RMIRLLSLVLL	0.9373	0.856	4	15

Top

Potential FusionNeoAntigen Information of RNF213-RBCK1 in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of RNF213-RBCK1

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
3947	IRLLSLVLLTPEDY	RNF213	RBCK1	chr17	78282971	chr20	407956	2796

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of RNF213-RBCK1

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	3947	IRLLSLVLLTPEDY	-7.14368	-7.25548
HLA-B14:02	3BVN	3947	IRLLSLVLLTPEDY	-6.90724	-7.95034
HLA-B52:01	3W39	3947	IRLLSLVLLTPEDY	-7.67666	-8.71976
HLA-B52:01	3W39	3947	IRLLSLVLLTPEDY	-5.5221	-5.6339
HLA-A11:01	4UQ2	3947	IRLLSLVLLTPEDY	-8.37369	-9.41679
HLA-A11:01	4UQ2	3947	IRLLSLVLLTPEDY	-6.26273	-6.37453
HLA-A24:02	5HGA	3947	IRLLSLVLLTPEDY	-7.6158	-8.6589
HLA-A24:02	5HGA	3947	IRLLSLVLLTPEDY	-5.36701	-5.47881
HLA-B44:05	3DX8	3947	IRLLSLVLLTPEDY	-8.09865	-8.21045
HLA-B44:05	3DX8	3947	IRLLSLVLLTPEDY	-5.97829	-7.02139

Top

Vaccine Design for the FusionNeoAntigens of RNF213-RBCK1

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
RNF213-RBCK1	chr17	78282971	chr20	407956	4	15	RMIRLLSLVLL	AGAATGATTAGACTTCTATCTCTGGTGCTCCTG
RNF213-RBCK1	chr17	78282971	chr20	407956	5	14	MIRLLSLVL	ATGATTAGACTTCTATCTCTGGTGCTC
RNF213-RBCK1	chr17	78282971	chr20	407956	6	15	IRLLSLVLL	ATTAGACTTCTATCTCTGGTGCTCCTG

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of RNF213-RBCK1

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
STAD	RNF213-RBCK1	chr17	78282971	ENST00000319921	chr20	407956	ENST00000353660	TCGA-BR-A4PE

Top

Potential target of CAR-T therapy development for RNF213-RBCK1

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to RNF213-RBCK1

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to RNF213-RBCK1

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner	Gene	Disease ID	Disease name	# pubmeds	Source
Hgene	RNF213	C1846689	MOYAMOYA DISEASE 2	9	CTD_human;UNIPROT
Hgene	RNF213	C0026654	Moyamoya Disease	3	ORPHANET
Hgene	RNF213	C2931384	Moyamoya disease 1	3	ORPHANET

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)