Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:RNF213-TBCD

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: RNF213-TBCD
	FusionPDB ID: 74993
	FusionGDB2.0 ID: 74993
		Hgene	Tgene
	Gene symbol	RNF213	TBCD
	Gene ID	57674	6904
	Gene name	ring finger protein 213	tubulin folding cofactor D
	Synonyms	ALO17\|C17orf27\|KIAA1618\|MYMY2\|MYSTR\|NET57	PEBAT\|SSD-1\|tfcD
	Cytomap	17q25.3	17q25.3
	Type of gene	protein-coding	protein-coding
	Description	E3 ubiquitin-protein ligase RNF213ALK lymphoma oligomerization partner on chromosome 17RING-type E3 ubiquitin transferase RNF213mysterin	tubulin-specific chaperone Dbeta-tubulin cofactor D
	Modification date	20200313	20200313
	UniProtAcc	Q63HN8 Main function of 5'-partner protein: FUNCTION: Atypical E3 ubiquitin ligase that can catalyze ubiquitination of both proteins and lipids, and which is involved in various processes, such as lipid metabolism, angiogenesis and cell-autonomous immunity (PubMed:21799892, PubMed:26126547, PubMed:26278786, PubMed:26766444, PubMed:30705059, PubMed:32139119, PubMed:34012115). Acts as a key immune sensor by catalyzing ubiquitination of the lipid A moiety of bacterial lipopolysaccharide (LPS) via its RZ-type zinc-finger: restricts the proliferation of cytosolic bacteria, such as Salmonella, by generating the bacterial ubiquitin coat through the ubiquitination of LPS (PubMed:34012115). Also acts indirectly by mediating the recruitment of the LUBAC complex, which conjugates linear polyubiquitin chains (PubMed:34012115). Ubiquitination of LPS triggers cell-autonomous immunity, such as antibacterial autophagy, leading to degradation of the microbial invader (PubMed:34012115). Involved in lipid metabolism by regulating fat storage and lipid droplet formation; act by inhibiting the lipolytic process (PubMed:30705059). Also regulates lipotoxicity by inhibiting desaturation of fatty acids (PubMed:30846318). Also acts as an E3 ubiquitin-protein ligase via its RING-type zinc finger: mediates 'Lys-63'-linked ubiquitination of target proteins (PubMed:32139119, PubMed:33842849). Involved in the non-canonical Wnt signaling pathway in vascular development: acts by mediating ubiquitination and degradation of FLNA and NFATC2 downstream of RSPO3, leading to inhibit the non-canonical Wnt signaling pathway and promoting vessel regression (PubMed:26766444). Also has ATPase activity; ATPase activity is required for ubiquitination of LPS (PubMed:34012115). {ECO:0000269\|PubMed:21799892, ECO:0000269\|PubMed:26126547, ECO:0000269\|PubMed:26278786, ECO:0000269\|PubMed:26766444, ECO:0000269\|PubMed:30705059, ECO:0000269\|PubMed:30846318, ECO:0000269\|PubMed:32139119, ECO:0000269\|PubMed:33842849, ECO:0000269\|PubMed:34012115}.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000336301, ENST00000508628, ENST00000582970, ENST00000319921, ENST00000456466, ENST00000427003,	ENST00000397466, ENST00000539345, ENST00000576691, ENST00000355528,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	34 X 32 X 16=17408	19 X 22 X 13=5434
	# samples	41	28
	** MAII score	log2(41/17408*10)=-5.40798274174489 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(28/5434*10)=-4.27851583327701 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: RNF213 [Title/Abstract] AND TBCD [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: RNF213 [Title/Abstract] AND TBCD [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	RNF213(78237577)-TBCD(80828100), # samples:2
Anticipated loss of major functional domain due to fusion event.	RNF213-TBCD seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. RNF213-TBCD seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. RNF213-TBCD seems lost the major protein functional domain in Hgene partner, which is a CGC due to the frame-shifted ORF. RNF213-TBCD seems lost the major protein functional domain in Tgene partner, which is a cell metabolism gene due to the frame-shifted ORF. RNF213-TBCD seems lost the major protein functional domain in Tgene partner, which is a essential gene due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	RNF213	GO:0016567	protein ubiquitination	21799892
Hgene	RNF213	GO:0051260	protein homooligomerization	24658080\|26126547
Hgene	RNF213	GO:0051865	protein autoubiquitination	21799892
Tgene	TBCD	GO:0006457	protein folding	20740604
Tgene	TBCD	GO:0007021	tubulin complex assembly	28158450
Tgene	TBCD	GO:0007023	post-chaperonin tubulin folding pathway	11847227
Tgene	TBCD	GO:0031115	negative regulation of microtubule polymerization	10831612\|20740604

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr17:78237577/chr17:80828100)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across RNF213 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across TBCD (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000508628	RNF213	chr17	78237577	+	ENST00000355528	TBCD	chr17	80828099	+	2888	242	145	2502	785
ENST00000508628	RNF213	chr17	78237577	+	ENST00000397466	TBCD	chr17	80828099	+	1018	242	1002	58	314
ENST00000508628	RNF213	chr17	78237577	+	ENST00000539345	TBCD	chr17	80828099	+	2863	242	145	2616	823
ENST00000456466	RNF213	chr17	78237577	+	ENST00000355528	TBCD	chr17	80828099	+	2886	240	143	2500	785
ENST00000456466	RNF213	chr17	78237577	+	ENST00000397466	TBCD	chr17	80828099	+	1016	240	1000	56	314
ENST00000456466	RNF213	chr17	78237577	+	ENST00000539345	TBCD	chr17	80828099	+	2861	240	143	2614	823
ENST00000582970	RNF213	chr17	78237577	+	ENST00000355528	TBCD	chr17	80828099	+	2886	240	143	2500	785
ENST00000582970	RNF213	chr17	78237577	+	ENST00000397466	TBCD	chr17	80828099	+	1016	240	1000	56	314
ENST00000582970	RNF213	chr17	78237577	+	ENST00000539345	TBCD	chr17	80828099	+	2861	240	143	2614	823
ENST00000319921	RNF213	chr17	78237577	+	ENST00000355528	TBCD	chr17	80828099	+	2884	238	141	2498	785
ENST00000319921	RNF213	chr17	78237577	+	ENST00000397466	TBCD	chr17	80828099	+	1014	238	998	54	314
ENST00000319921	RNF213	chr17	78237577	+	ENST00000539345	TBCD	chr17	80828099	+	2859	238	141	2612	823
ENST00000508628	RNF213	chr17	78237577	+	ENST00000355528	TBCD	chr17	80828100	+	2888	242	145	2502	785
ENST00000508628	RNF213	chr17	78237577	+	ENST00000397466	TBCD	chr17	80828100	+	1018	242	1002	58	314
ENST00000508628	RNF213	chr17	78237577	+	ENST00000539345	TBCD	chr17	80828100	+	2863	242	145	2616	823
ENST00000456466	RNF213	chr17	78237577	+	ENST00000355528	TBCD	chr17	80828100	+	2886	240	143	2500	785
ENST00000456466	RNF213	chr17	78237577	+	ENST00000397466	TBCD	chr17	80828100	+	1016	240	1000	56	314
ENST00000456466	RNF213	chr17	78237577	+	ENST00000539345	TBCD	chr17	80828100	+	2861	240	143	2614	823
ENST00000582970	RNF213	chr17	78237577	+	ENST00000355528	TBCD	chr17	80828100	+	2886	240	143	2500	785
ENST00000582970	RNF213	chr17	78237577	+	ENST00000397466	TBCD	chr17	80828100	+	1016	240	1000	56	314
ENST00000582970	RNF213	chr17	78237577	+	ENST00000539345	TBCD	chr17	80828100	+	2861	240	143	2614	823
ENST00000319921	RNF213	chr17	78237577	+	ENST00000355528	TBCD	chr17	80828100	+	2884	238	141	2498	785
ENST00000319921	RNF213	chr17	78237577	+	ENST00000397466	TBCD	chr17	80828100	+	1014	238	998	54	314
ENST00000319921	RNF213	chr17	78237577	+	ENST00000539345	TBCD	chr17	80828100	+	2859	238	141	2612	823

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000508628	ENST00000355528	RNF213	chr17	78237577	+	TBCD	chr17	80828099	+	0.005404557	0.99459547
ENST00000508628	ENST00000397466	RNF213	chr17	78237577	+	TBCD	chr17	80828099	+	0.016598929	0.9834011
ENST00000508628	ENST00000539345	RNF213	chr17	78237577	+	TBCD	chr17	80828099	+	0.005208318	0.9947917
ENST00000456466	ENST00000355528	RNF213	chr17	78237577	+	TBCD	chr17	80828099	+	0.005457007	0.99454296
ENST00000456466	ENST00000397466	RNF213	chr17	78237577	+	TBCD	chr17	80828099	+	0.016585056	0.98341495
ENST00000456466	ENST00000539345	RNF213	chr17	78237577	+	TBCD	chr17	80828099	+	0.005261858	0.99473816
ENST00000582970	ENST00000355528	RNF213	chr17	78237577	+	TBCD	chr17	80828099	+	0.005457007	0.99454296
ENST00000582970	ENST00000397466	RNF213	chr17	78237577	+	TBCD	chr17	80828099	+	0.016585056	0.98341495
ENST00000582970	ENST00000539345	RNF213	chr17	78237577	+	TBCD	chr17	80828099	+	0.005261858	0.99473816
ENST00000319921	ENST00000355528	RNF213	chr17	78237577	+	TBCD	chr17	80828099	+	0.005455785	0.99454415
ENST00000319921	ENST00000397466	RNF213	chr17	78237577	+	TBCD	chr17	80828099	+	0.015977683	0.9840223
ENST00000319921	ENST00000539345	RNF213	chr17	78237577	+	TBCD	chr17	80828099	+	0.005254875	0.99474514
ENST00000508628	ENST00000355528	RNF213	chr17	78237577	+	TBCD	chr17	80828100	+	0.005404557	0.99459547
ENST00000508628	ENST00000397466	RNF213	chr17	78237577	+	TBCD	chr17	80828100	+	0.016598929	0.9834011
ENST00000508628	ENST00000539345	RNF213	chr17	78237577	+	TBCD	chr17	80828100	+	0.005208318	0.9947917
ENST00000456466	ENST00000355528	RNF213	chr17	78237577	+	TBCD	chr17	80828100	+	0.005457007	0.99454296
ENST00000456466	ENST00000397466	RNF213	chr17	78237577	+	TBCD	chr17	80828100	+	0.016585056	0.98341495
ENST00000456466	ENST00000539345	RNF213	chr17	78237577	+	TBCD	chr17	80828100	+	0.005261858	0.99473816
ENST00000582970	ENST00000355528	RNF213	chr17	78237577	+	TBCD	chr17	80828100	+	0.005457007	0.99454296
ENST00000582970	ENST00000397466	RNF213	chr17	78237577	+	TBCD	chr17	80828100	+	0.016585056	0.98341495
ENST00000582970	ENST00000539345	RNF213	chr17	78237577	+	TBCD	chr17	80828100	+	0.005261858	0.99473816
ENST00000319921	ENST00000355528	RNF213	chr17	78237577	+	TBCD	chr17	80828100	+	0.005455785	0.99454415
ENST00000319921	ENST00000397466	RNF213	chr17	78237577	+	TBCD	chr17	80828100	+	0.015977683	0.9840223
ENST00000319921	ENST00000539345	RNF213	chr17	78237577	+	TBCD	chr17	80828100	+	0.005254875	0.99474514

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for RNF213-TBCD

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
RNF213	chr17	78237577	TBCD	chr17	80828099	238	25	ETPKFCSQCGERLPPAAPIAVVAVIL
RNF213	chr17	78237577	TBCD	chr17	80828099	240	25	ETPKFCSQCGERLPPAAPIAVVAVIL
RNF213	chr17	78237577	TBCD	chr17	80828099	242	25	ETPKFCSQCGERLPPAAPIAVVAVIL
RNF213	chr17	78237577	TBCD	chr17	80828100	238	25	ETPKFCSQCGERLPPAAPIAVVAVIL
RNF213	chr17	78237577	TBCD	chr17	80828100	240	25	ETPKFCSQCGERLPPAAPIAVVAVIL
RNF213	chr17	78237577	TBCD	chr17	80828100	242	25	ETPKFCSQCGERLPPAAPIAVVAVIL

Top

Potential FusionNeoAntigen Information of RNF213-TBCD in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

RNF213-TBCD_78237577_80828099.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B50:02	GERLPPAA	0.9995	0.8668	9	17
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B45:01	GERLPPAA	0.9994	0.9714	9	17
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B41:01	GERLPPAA	0.9953	0.9333	9	17
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B50:01	GERLPPAA	0.8588	0.9271	9	17
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B39:24	ERLPPAAPI	0.9988	0.7021	10	19
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B14:01	ERLPPAAPI	0.9985	0.9274	10	19
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B14:02	ERLPPAAPI	0.9985	0.9274	10	19
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B39:06	ERLPPAAPI	0.9984	0.9296	10	19
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B39:01	ERLPPAAPI	0.9976	0.9224	10	19
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B51:01	LPPAAPIAV	0.9964	0.7311	12	21
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B38:02	ERLPPAAPI	0.995	0.9809	10	19
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B56:01	LPPAAPIAV	0.9935	0.8568	12	21
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B51:02	LPPAAPIAV	0.9905	0.743	12	21
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B07:05	LPPAAPIAV	0.9874	0.5633	12	21
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B45:01	GERLPPAAP	0.9785	0.9891	9	18
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B35:02	LPPAAPIAV	0.9764	0.9865	12	21
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B35:04	LPPAAPIAV	0.9764	0.9865	12	21
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B35:03	LPPAAPIAV	0.9585	0.9266	12	21
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B55:01	LPPAAPIAV	0.9535	0.6953	12	21
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B50:02	GERLPPAAP	0.9402	0.8885	9	18
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B15:37	ERLPPAAPI	0.6132	0.6879	10	19
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B81:01	LPPAAPIAV	0.4374	0.9387	12	21
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B41:01	GERLPPAAP	0.429	0.9219	9	18
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B82:01	LPPAAPIAV	0.3946	0.7931	12	21
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B50:01	GERLPPAAP	0.2248	0.9395	9	18
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B07:10	ERLPPAAPI	0.0203	0.5027	10	19
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-A02:13	RLPPAAPIAV	0.9968	0.8735	11	21
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-A02:22	RLPPAAPIAV	0.9948	0.8002	11	21
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-A02:27	RLPPAAPIAV	0.9946	0.8367	11	21
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B39:06	ERLPPAAPIA	0.9942	0.95	10	20
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-A02:38	RLPPAAPIAV	0.9907	0.849	11	21
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-A02:11	RLPPAAPIAV	0.9874	0.7758	11	21
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-A02:60	RLPPAAPIAV	0.9862	0.8153	11	21
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-A02:24	RLPPAAPIAV	0.986	0.7754	11	21
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-A02:67	RLPPAAPIAV	0.986	0.7754	11	21
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-A02:30	RLPPAAPIAV	0.986	0.7754	11	21
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-A02:21	RLPPAAPIAV	0.9858	0.8356	11	21
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B56:01	LPPAAPIAVV	0.9796	0.7567	12	22
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-A02:19	RLPPAAPIAV	0.9774	0.7435	11	21
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B51:01	LPPAAPIAVV	0.971	0.7123	12	22
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B51:02	LPPAAPIAVV	0.9551	0.7113	12	22
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-A02:29	RLPPAAPIAV	0.9383	0.7785	11	21
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-A02:35	RLPPAAPIAV	0.9197	0.7817	11	21
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-A02:20	RLPPAAPIAV	0.9076	0.7816	11	21
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B39:06	ERLPPAAPIAV	0.9996	0.9794	10	21
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-A02:13	RLPPAAPIAVV	0.9946	0.8454	11	22
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B56:01	LPPAAPIAVVA	0.9946	0.8555	12	23
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B50:02	GERLPPAAPIA	0.9937	0.9055	9	20
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B55:01	LPPAAPIAVVA	0.9841	0.7322	12	23
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-A02:11	RLPPAAPIAVV	0.9735	0.7451	11	22
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B50:01	GERLPPAAPIA	0.9669	0.9049	9	20
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-A02:20	RLPPAAPIAVV	0.8921	0.7485	11	22
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B07:02	RLPPAAPIAVV	0.7745	0.6528	11	22
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B07:05	RLPPAAPIAVV	0.7471	0.5994	11	22
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B40:06	GERLPPAA	0.9998	0.9761	9	17
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B73:01	ERLPPAAP	0.9989	0.9223	10	18
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-C01:17	RLPPAAPI	0.7887	0.9817	11	19
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-C01:30	RLPPAAPI	0.6809	0.9834	11	19
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B78:01	LPPAAPIAV	0.9978	0.8695	12	21
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B39:09	ERLPPAAPI	0.9976	0.8188	10	19
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B54:01	LPPAAPIAV	0.9975	0.9473	12	21
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B39:12	ERLPPAAPI	0.9971	0.9254	10	19
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B51:07	LPPAAPIAV	0.9961	0.9938	12	21
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B40:06	GERLPPAAP	0.9866	0.9834	9	18
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B51:08	LPPAAPIAV	0.9823	0.7034	12	21
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B35:12	LPPAAPIAV	0.9764	0.9865	12	21
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B73:01	ERLPPAAPI	0.9762	0.8956	10	19
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B56:04	LPPAAPIAV	0.9251	0.9115	12	21
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-A02:07	RLPPAAPIA	0.904	0.808	11	20
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B07:12	LPPAAPIAV	0.8806	0.6409	12	21
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B42:02	LPPAAPIAV	0.7934	0.7807	12	21
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B42:01	LPPAAPIAV	0.7517	0.7701	12	21
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B39:10	LPPAAPIAV	0.5306	0.992	12	21
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B14:03	ERLPPAAPI	0.401	0.9326	10	19
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B73:01	ERLPPAAPIA	0.9976	0.9301	10	20
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-A02:02	RLPPAAPIAV	0.9951	0.7481	11	21
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B54:01	LPPAAPIAVV	0.9934	0.9078	12	22
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B78:01	LPPAAPIAVV	0.9875	0.9024	12	22
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-A02:07	RLPPAAPIAV	0.9863	0.8179	11	21
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-A02:01	RLPPAAPIAV	0.986	0.7754	11	21
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B51:08	LPPAAPIAVV	0.9096	0.6858	12	22
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-C01:17	RLPPAAPIAV	0.8002	0.9828	11	21
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B40:06	GERLPPAAPIA	0.9997	0.9772	9	20
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B73:01	ERLPPAAPIAV	0.9996	0.9705	10	21
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B54:01	LPPAAPIAVVA	0.9994	0.9541	12	23
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B78:01	LPPAAPIAVVA	0.9918	0.9338	12	23
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-A02:07	RLPPAAPIAVV	0.9741	0.7869	11	22
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B07:04	RLPPAAPIAVV	0.8324	0.6433	11	22
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B78:02	LPPAAPIA	0.999	0.8155	12	20
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B50:04	GERLPPAA	0.8588	0.9271	9	17
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B50:05	GERLPPAA	0.8588	0.9271	9	17
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-C01:03	RLPPAAPI	0.8283	0.9835	11	19
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-C01:02	RLPPAAPI	0.7778	0.9813	11	19
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B39:31	ERLPPAAPI	0.9978	0.9199	10	19
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B78:02	LPPAAPIAV	0.9976	0.8971	12	21
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B51:14	LPPAAPIAV	0.9964	0.7747	12	21
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B51:13	LPPAAPIAV	0.9962	0.7893	12	21
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B56:05	LPPAAPIAV	0.9955	0.7851	12	21
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B35:22	LPPAAPIAV	0.9949	0.7929	12	21
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B51:09	LPPAAPIAV	0.9946	0.8074	12	21
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B51:06	LPPAAPIAV	0.9936	0.8184	12	21
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B51:21	LPPAAPIAV	0.9919	0.7526	12	21
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B55:02	LPPAAPIAV	0.9783	0.8691	12	21
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B35:09	LPPAAPIAV	0.9764	0.9865	12	21
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B55:04	LPPAAPIAV	0.9631	0.8579	12	21
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B59:01	LPPAAPIAV	0.9523	0.8981	12	21
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B56:02	LPPAAPIAV	0.9251	0.9115	12	21
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B15:09	ERLPPAAPI	0.8909	0.593	10	19
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B51:05	LPPAAPIAV	0.8277	0.7932	12	21
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B51:29	LPPAAPIAV	0.8261	0.6917	12	21
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B67:01	LPPAAPIAV	0.6916	0.9913	12	21
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B82:02	LPPAAPIAV	0.3946	0.7931	12	21
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B50:05	GERLPPAAP	0.2248	0.9395	9	18
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B50:04	GERLPPAAP	0.2248	0.9395	9	18
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-C01:03	LPPAAPIAV	0.0023	0.9831	12	21
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-A02:03	RLPPAAPIAV	0.9979	0.855	11	21
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-A02:14	RLPPAAPIAV	0.9862	0.8119	11	21
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-A02:06	RLPPAAPIAV	0.9858	0.8356	11	21
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B51:14	LPPAAPIAVV	0.972	0.7437	12	22
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B56:05	LPPAAPIAVV	0.97	0.7262	12	22
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B51:13	LPPAAPIAVV	0.9699	0.7061	12	22
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B51:21	LPPAAPIAVV	0.9535	0.7275	12	22
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-C01:03	RLPPAAPIAV	0.9521	0.9786	11	21
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B51:09	LPPAAPIAVV	0.9483	0.7039	12	22
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B55:02	LPPAAPIAVV	0.9279	0.7955	12	22
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B51:29	LPPAAPIAVV	0.8866	0.5799	12	22
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B59:01	LPPAAPIAVV	0.8756	0.8576	12	22
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-C01:02	RLPPAAPIAV	0.7983	0.9826	11	21
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B51:05	LPPAAPIAVV	0.7707	0.659	12	22
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-A02:03	RLPPAAPIAVV	0.9969	0.8324	11	22
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B55:02	LPPAAPIAVVA	0.9925	0.8914	12	23
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B78:02	LPPAAPIAVVA	0.9909	0.9506	12	23
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B56:05	LPPAAPIAVVA	0.9908	0.8732	12	23
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B50:05	GERLPPAAPIA	0.9669	0.9049	9	20
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B50:04	GERLPPAAPIA	0.9669	0.9049	9	20
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B07:26	RLPPAAPIAVV	0.9193	0.6052	11	22
RNF213-TBCD	chr17	78237577	chr17	80828099	238	HLA-B07:22	RLPPAAPIAVV	0.7745	0.6528	11	22

Top

Potential FusionNeoAntigen Information of RNF213-TBCD in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of RNF213-TBCD

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
8911	SQCGERLPPAAPIA	RNF213	TBCD	chr17	78237577	chr17	80828099	238

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of RNF213-TBCD

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	8911	SQCGERLPPAAPIA	-7.9962	-8.1096
HLA-B14:02	3BVN	8911	SQCGERLPPAAPIA	-5.70842	-6.74372
HLA-B52:01	3W39	8911	SQCGERLPPAAPIA	-6.83737	-6.95077
HLA-B52:01	3W39	8911	SQCGERLPPAAPIA	-4.4836	-5.5189
HLA-A11:01	4UQ2	8911	SQCGERLPPAAPIA	-10.0067	-10.1201
HLA-A11:01	4UQ2	8911	SQCGERLPPAAPIA	-9.03915	-10.0745
HLA-A24:02	5HGA	8911	SQCGERLPPAAPIA	-6.56204	-6.67544
HLA-A24:02	5HGA	8911	SQCGERLPPAAPIA	-5.42271	-6.45801
HLA-B44:05	3DX8	8911	SQCGERLPPAAPIA	-7.85648	-8.89178
HLA-B44:05	3DX8	8911	SQCGERLPPAAPIA	-5.3978	-5.5112
HLA-A02:01	6TDR	8911	SQCGERLPPAAPIA	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of RNF213-TBCD

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
RNF213-TBCD	chr17	78237577	chr17	80828099	10	18	ERLPPAAP	CCATAGCAGTTGTCGCCGTGATCC
RNF213-TBCD	chr17	78237577	chr17	80828099	10	19	ERLPPAAPI	CCATAGCAGTTGTCGCCGTGATCCTGA
RNF213-TBCD	chr17	78237577	chr17	80828099	10	20	ERLPPAAPIA	CCATAGCAGTTGTCGCCGTGATCCTGAAGG
RNF213-TBCD	chr17	78237577	chr17	80828099	10	21	ERLPPAAPIAV	CCATAGCAGTTGTCGCCGTGATCCTGAAGGCGC
RNF213-TBCD	chr17	78237577	chr17	80828099	11	19	RLPPAAPI	TAGCAGTTGTCGCCGTGATCCTGA
RNF213-TBCD	chr17	78237577	chr17	80828099	11	20	RLPPAAPIA	TAGCAGTTGTCGCCGTGATCCTGAAGG
RNF213-TBCD	chr17	78237577	chr17	80828099	11	21	RLPPAAPIAV	TAGCAGTTGTCGCCGTGATCCTGAAGGCGC
RNF213-TBCD	chr17	78237577	chr17	80828099	11	22	RLPPAAPIAVV	TAGCAGTTGTCGCCGTGATCCTGAAGGCGCTGA
RNF213-TBCD	chr17	78237577	chr17	80828099	12	20	LPPAAPIA	CAGTTGTCGCCGTGATCCTGAAGG
RNF213-TBCD	chr17	78237577	chr17	80828099	12	21	LPPAAPIAV	CAGTTGTCGCCGTGATCCTGAAGGCGC
RNF213-TBCD	chr17	78237577	chr17	80828099	12	22	LPPAAPIAVV	CAGTTGTCGCCGTGATCCTGAAGGCGCTGA
RNF213-TBCD	chr17	78237577	chr17	80828099	12	23	LPPAAPIAVVA	CAGTTGTCGCCGTGATCCTGAAGGCGCTGACCT
RNF213-TBCD	chr17	78237577	chr17	80828099	9	17	GERLPPAA	CCCCCATAGCAGTTGTCGCCGTGA
RNF213-TBCD	chr17	78237577	chr17	80828099	9	18	GERLPPAAP	CCCCCATAGCAGTTGTCGCCGTGATCC
RNF213-TBCD	chr17	78237577	chr17	80828099	9	20	GERLPPAAPIA	CCCCCATAGCAGTTGTCGCCGTGATCCTGAAGG

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of RNF213-TBCD

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
SKCM	RNF213-TBCD	chr17	78237577	ENST00000319921	chr17	80828099	ENST00000355528	TCGA-XV-AAZV

Top

Potential target of CAR-T therapy development for RNF213-TBCD

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to RNF213-TBCD

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to RNF213-TBCD

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner	Gene	Disease ID	Disease name	# pubmeds	Source
Hgene	RNF213	C1846689	MOYAMOYA DISEASE 2	9	CTD_human;UNIPROT
Hgene	RNF213	C0026654	Moyamoya Disease	3	ORPHANET
Hgene	RNF213	C2931384	Moyamoya disease 1	3	ORPHANET

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)