|
|||||||
|
Fusion Protein:ROS1-CD74 |
Fusion Gene and Fusion Protein Summary |
 Fusion gene summary |
| Fusion partner gene information | Fusion gene name: ROS1-CD74 | FusionPDB ID: 75411 | FusionGDB2.0 ID: 75411 | Hgene | Tgene | Gene symbol | ROS1 | CD74 | Gene ID | 6098 | 972 |
| Gene name | ROS proto-oncogene 1, receptor tyrosine kinase | CD74 molecule | |
| Synonyms | MCF3|ROS|c-ros-1 | DHLAG|HLADG|II|Ia-GAMMA|p33 | |
| Cytomap | 6q22.1 | 5q33.1 | |
| Type of gene | protein-coding | protein-coding | |
| Description | proto-oncogene tyrosine-protein kinase ROSROS proto-oncogene 1 , receptor tyrosine kinasec-ros oncogene 1 , receptor tyrosine kinaseproto-oncogene c-Ros-1transmembrane tyrosine-specific protein kinasev-ros avian UR2 sarcoma virus oncogene homolog 1 | HLA class II histocompatibility antigen gamma chainCD74 antigen (invariant polypeptide of major histocompatibility complex, class II antigen-associated)CD74 molecule, major histocompatibility complex, class II invariant chainHLA-DR antigens-associated | |
| Modification date | 20200314 | 20200313 | |
| UniProtAcc | P08922 Main function of 5'-partner protein: FUNCTION: Orphan receptor tyrosine kinase (RTK) that plays a role in epithelial cell differentiation and regionalization of the proximal epididymal epithelium. May activate several downstream signaling pathways related to cell differentiation, proliferation, growth and survival including the PI3 kinase-mTOR signaling pathway. Mediates the phosphorylation of PTPN11, an activator of this pathway. May also phosphorylate and activate the transcription factor STAT3 to control anchorage-independent cell growth. Mediates the phosphorylation and the activation of VAV3, a guanine nucleotide exchange factor regulating cell morphology. May activate other downstream signaling proteins including AKT1, MAPK1, MAPK3, IRS1 and PLCG2. {ECO:0000269|PubMed:11094073, ECO:0000269|PubMed:16885344}. | P04233 Main function of 5'-partner protein: FUNCTION: Plays a critical role in MHC class II antigen processing by stabilizing peptide-free class II alpha/beta heterodimers in a complex soon after their synthesis and directing transport of the complex from the endoplasmic reticulum to the endosomal/lysosomal system where the antigen processing and binding of antigenic peptides to MHC class II takes place. Serves as cell surface receptor for the cytokine MIF.; FUNCTION: [Class-II-associated invariant chain peptide]: Binds to the peptide-binding site of MHC class II alpha/beta heterodimers forming an alpha-beta-CLIP complex, thereby preventing the loading of antigenic peptides to the MHC class II complex until its release by HLA-DM in the endosome. {ECO:0000269|PubMed:1448172}.; FUNCTION: [Isoform p41]: Stabilizes the conformation of mature CTSL by binding to its active site and serving as a chaperone to help maintain a pool of mature enzyme in endocytic compartments and extracellular space of antigen-presenting cells (APCs). Has antiviral activity by stymieing the endosomal entry of Ebola virus and coronaviruses, including SARS-CoV-2 (PubMed:32855215). Disrupts cathepsin-mediated Ebola virus glycoprotein processing, which prevents viral fusion and entry. This antiviral activity is specific to p41 isoform (PubMed:32855215). {ECO:0000250|UniProtKB:P04441, ECO:0000269|PubMed:32855215}. | |
| Ensembl transtripts involved in fusion gene | ENST ids | ENST00000368507, ENST00000368508, | ENST00000009530, ENST00000353334, ENST00000377795, ENST00000524315, |
| Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 3 X 4 X 1=12 | 31 X 31 X 11=10571 |
| # samples | 4 | 39 | |
| ** MAII score | log2(4/12*10)=1.73696559416621 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0 | log2(39/10571*10)=-4.76049392566144 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
| Fusion gene context | PubMed: ROS1 [Title/Abstract] AND CD74 [Title/Abstract] AND fusion [Title/Abstract] CD74-ROS1 fusion transcripts in resected non-small cell lung carcinoma (pmid: 23877438) | ||
| Fusion neoantigen context | PubMed: ROS1 [Title/Abstract] AND CD74 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
| Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | CD74(149784243)-ROS1(117645578), # samples:6 CD74(149784243)-ROS1(117645580), # samples:6 ROS1(117700222)-CD74(149782188), # samples:2 | ||
| Anticipated loss of major functional domain due to fusion event. | CD74-ROS1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. CD74-ROS1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. ROS1-CD74 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ROS1-CD74 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ROS1-CD74 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. ROS1-CD74 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. ROS1-CD74 seems lost the major protein functional domain in Hgene partner, which is a CGC due to the frame-shifted ORF. ROS1-CD74 seems lost the major protein functional domain in Hgene partner, which is a IUPHAR drug target due to the frame-shifted ORF. ROS1-CD74 seems lost the major protein functional domain in Hgene partner, which is a kinase due to the frame-shifted ORF. ROS1-CD74 seems lost the major protein functional domain in Tgene partner, which is a CGC due to the frame-shifted ORF. ROS1-CD74 seems lost the major protein functional domain in Tgene partner, which is a IUPHAR drug target due to the frame-shifted ORF. | ||
| * DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
| Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Partner | Gene | GO ID | GO term | PubMed ID |
| Hgene | ROS1 | GO:0001558 | regulation of cell growth | 16885344 |
| Hgene | ROS1 | GO:0006468 | protein phosphorylation | 16885344 |
| Hgene | ROS1 | GO:0032006 | regulation of TOR signaling | 16885344 |
| Tgene | CD74 | GO:0001516 | prostaglandin biosynthetic process | 12782713 |
| Tgene | CD74 | GO:0001934 | positive regulation of protein phosphorylation | 24942581 |
| Tgene | CD74 | GO:0002792 | negative regulation of peptide secretion | 19849849 |
| Tgene | CD74 | GO:0033674 | positive regulation of kinase activity | 24942581 |
| Tgene | CD74 | GO:0043066 | negative regulation of apoptotic process | 12782713 |
| Tgene | CD74 | GO:0043123 | positive regulation of I-kappaB kinase/NF-kappaB signaling | 24942581 |
| Tgene | CD74 | GO:0043410 | positive regulation of MAPK cascade | 24942581 |
| Tgene | CD74 | GO:0043518 | negative regulation of DNA damage response, signal transduction by p53 class mediator | 17045821 |
| Tgene | CD74 | GO:0045657 | positive regulation of monocyte differentiation | 24942581 |
| Tgene | CD74 | GO:0045893 | positive regulation of transcription, DNA-templated | 24942581 |
| Tgene | CD74 | GO:0046598 | positive regulation of viral entry into host cell | 24942581 |
| Tgene | CD74 | GO:0050731 | positive regulation of peptidyl-tyrosine phosphorylation | 17045821 |
| Tgene | CD74 | GO:0070374 | positive regulation of ERK1 and ERK2 cascade | 17045821|24942581 |
| Four levels of functional features of fusion genes Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr6:149784243/chr5:117645578) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
 |
| Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here. |
| Fusion gene breakpoints across ROS1 (5'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
| Fusion gene breakpoints across CD74 (3'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Fusion Amino Acid Sequences |
| Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
| ENST00000368508 | ROS1 | chr6 | 117700222 | - | ENST00000377795 | CD74 | chr5 | 149782188 | - | 3473 | 2796 | 199 | 3045 | 948 |
| ENST00000368507 | ROS1 | chr6 | 117700222 | - | ENST00000377795 | CD74 | chr5 | 149782188 | - | 3458 | 2781 | 199 | 3030 | 943 |
| ENST00000368508 | ROS1 | chr6 | 117700221 | - | ENST00000377795 | CD74 | chr5 | 149782188 | - | 3473 | 2796 | 199 | 3045 | 948 |
| ENST00000368507 | ROS1 | chr6 | 117700221 | - | ENST00000377795 | CD74 | chr5 | 149782188 | - | 3458 | 2781 | 199 | 3030 | 943 |
| ENST00000368508 | ROS1 | chr6 | 117700221 | - | ENST00000377795 | CD74 | chr5 | 149782187 | - | 3473 | 2796 | 199 | 3045 | 948 |
| ENST00000368507 | ROS1 | chr6 | 117700221 | - | ENST00000377795 | CD74 | chr5 | 149782187 | - | 3458 | 2781 | 199 | 3030 | 943 |
| DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
| ENST00000368508 | ENST00000377795 | ROS1 | chr6 | 117700222 | - | CD74 | chr5 | 149782188 | - | 0.00046117 | 0.9995389 |
| ENST00000368507 | ENST00000377795 | ROS1 | chr6 | 117700222 | - | CD74 | chr5 | 149782188 | - | 0.000297075 | 0.9997029 |
| ENST00000368508 | ENST00000377795 | ROS1 | chr6 | 117700221 | - | CD74 | chr5 | 149782188 | - | 0.00046117 | 0.9995389 |
| ENST00000368507 | ENST00000377795 | ROS1 | chr6 | 117700221 | - | CD74 | chr5 | 149782188 | - | 0.000297075 | 0.9997029 |
| ENST00000368508 | ENST00000377795 | ROS1 | chr6 | 117700221 | - | CD74 | chr5 | 149782187 | - | 0.00046117 | 0.9995389 |
| ENST00000368507 | ENST00000377795 | ROS1 | chr6 | 117700221 | - | CD74 | chr5 | 149782187 | - | 0.000297075 | 0.9997029 |
| Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones. |
Get the fusion protein sequences from here. |
| Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for ROS1-CD74 |
| +/-13 AA sequence from the breakpoints of the fusion protein sequences. |
| Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
| ROS1 | chr6 | 117700221 | CD74 | chr5 | 149782187 | 2781 | 860 | QCIHLYTAVLRGQRVTGTGGPVFWAG |
| ROS1 | chr6 | 117700221 | CD74 | chr5 | 149782187 | 2796 | 865 | QCIHLYTAVLRGQRVTGTGGPVFWAG |
| ROS1 | chr6 | 117700221 | CD74 | chr5 | 149782188 | 2781 | 860 | QCIHLYTAVLRGQRVTGTGGPVFWAG |
| ROS1 | chr6 | 117700221 | CD74 | chr5 | 149782188 | 2796 | 865 | QCIHLYTAVLRGQRVTGTGGPVFWAG |
| ROS1 | chr6 | 117700222 | CD74 | chr5 | 149782188 | 2781 | 860 | QCIHLYTAVLRGQRVTGTGGPVFWAG |
| ROS1 | chr6 | 117700222 | CD74 | chr5 | 149782188 | 2796 | 865 | QCIHLYTAVLRGQRVTGTGGPVFWAG |
Top |
Potential FusionNeoAntigen Information of ROS1-CD74 in HLA I |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| ROS1-CD74_117700221_149782187.msa |
| Potential FusionNeoAntigen Information * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
| ROS1-CD74 | chr6 | 117700221 | chr5 | 149782187 | 2781 | HLA-A68:24 | YTAVLRGQR | 0.9958 | 0.6467 | 5 | 14 |
| ROS1-CD74 | chr6 | 117700221 | chr5 | 149782187 | 2781 | HLA-A68:03 | YTAVLRGQR | 0.9935 | 0.6375 | 5 | 14 |
| ROS1-CD74 | chr6 | 117700221 | chr5 | 149782187 | 2781 | HLA-A66:01 | YTAVLRGQR | 0.9861 | 0.5547 | 5 | 14 |
| ROS1-CD74 | chr6 | 117700221 | chr5 | 149782187 | 2781 | HLA-A68:08 | YTAVLRGQR | 0.9824 | 0.639 | 5 | 14 |
| ROS1-CD74 | chr6 | 117700221 | chr5 | 149782187 | 2781 | HLA-A33:05 | YTAVLRGQR | 0.9713 | 0.5573 | 5 | 14 |
| ROS1-CD74 | chr6 | 117700221 | chr5 | 149782187 | 2781 | HLA-A33:01 | YTAVLRGQR | 0.9713 | 0.5573 | 5 | 14 |
| ROS1-CD74 | chr6 | 117700221 | chr5 | 149782187 | 2781 | HLA-A68:05 | YTAVLRGQR | 0.9651 | 0.6434 | 5 | 14 |
| ROS1-CD74 | chr6 | 117700221 | chr5 | 149782187 | 2781 | HLA-B51:01 | TAVLRGQRV | 0.9587 | 0.6264 | 6 | 15 |
| ROS1-CD74 | chr6 | 117700221 | chr5 | 149782187 | 2781 | HLA-A68:06 | YTAVLRGQR | 0.9547 | 0.6587 | 5 | 14 |
| ROS1-CD74 | chr6 | 117700221 | chr5 | 149782187 | 2781 | HLA-A66:03 | YTAVLRGQR | 0.8497 | 0.5109 | 5 | 14 |
| ROS1-CD74 | chr6 | 117700221 | chr5 | 149782187 | 2781 | HLA-A74:09 | HLYTAVLRGQR | 0.9809 | 0.8284 | 3 | 14 |
| ROS1-CD74 | chr6 | 117700221 | chr5 | 149782187 | 2781 | HLA-A74:11 | HLYTAVLRGQR | 0.9809 | 0.8284 | 3 | 14 |
| ROS1-CD74 | chr6 | 117700221 | chr5 | 149782187 | 2781 | HLA-A74:03 | HLYTAVLRGQR | 0.9809 | 0.8284 | 3 | 14 |
| ROS1-CD74 | chr6 | 117700221 | chr5 | 149782187 | 2781 | HLA-A68:01 | YTAVLRGQR | 0.9958 | 0.6467 | 5 | 14 |
| ROS1-CD74 | chr6 | 117700221 | chr5 | 149782187 | 2781 | HLA-A33:03 | YTAVLRGQR | 0.9748 | 0.515 | 5 | 14 |
| ROS1-CD74 | chr6 | 117700221 | chr5 | 149782187 | 2781 | HLA-C06:03 | TAVLRGQRV | 0.8581 | 0.9911 | 6 | 15 |
| ROS1-CD74 | chr6 | 117700221 | chr5 | 149782187 | 2781 | HLA-C12:04 | TAVLRGQRV | 0.8509 | 0.9909 | 6 | 15 |
| ROS1-CD74 | chr6 | 117700221 | chr5 | 149782187 | 2781 | HLA-C12:12 | TAVLRGQRV | 0.669 | 0.9461 | 6 | 15 |
| ROS1-CD74 | chr6 | 117700221 | chr5 | 149782187 | 2781 | HLA-B51:21 | TAVLRGQRV | 0.9597 | 0.5113 | 6 | 15 |
| ROS1-CD74 | chr6 | 117700221 | chr5 | 149782187 | 2781 | HLA-C16:04 | TAVLRGQRV | 0.8596 | 0.9654 | 6 | 15 |
| ROS1-CD74 | chr6 | 117700221 | chr5 | 149782187 | 2781 | HLA-C12:03 | TAVLRGQRV | 0.6078 | 0.9794 | 6 | 15 |
| ROS1-CD74 | chr6 | 117700221 | chr5 | 149782187 | 2781 | HLA-A74:01 | HLYTAVLRGQR | 0.9809 | 0.8284 | 3 | 14 |
Top |
Potential FusionNeoAntigen Information of ROS1-CD74 in HLA II |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| ROS1-CD74_117700221_149782187.msa |
| Potential FusionNeoAntigen Information * We used NetMHCIIpan v4.1 (%rank<0.5). |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
| ROS1-CD74 | chr6 | 117700221 | chr5 | 149782187 | 2781 | DRB1-1145 | IHLYTAVLRGQRVTG | 2 | 17 |
| ROS1-CD74 | chr6 | 117700221 | chr5 | 149782187 | 2781 | DRB1-1164 | IHLYTAVLRGQRVTG | 2 | 17 |
| ROS1-CD74 | chr6 | 117700221 | chr5 | 149782187 | 2781 | DRB5-0106 | QCIHLYTAVLRGQRV | 0 | 15 |
| ROS1-CD74 | chr6 | 117700221 | chr5 | 149782187 | 2781 | DRB5-0202 | QCIHLYTAVLRGQRV | 0 | 15 |
| ROS1-CD74 | chr6 | 117700221 | chr5 | 149782187 | 2781 | DRB5-0203 | QCIHLYTAVLRGQRV | 0 | 15 |
| ROS1-CD74 | chr6 | 117700221 | chr5 | 149782187 | 2781 | DRB5-0204 | QCIHLYTAVLRGQRV | 0 | 15 |
| ROS1-CD74 | chr6 | 117700221 | chr5 | 149782187 | 2781 | DRB5-0205 | QCIHLYTAVLRGQRV | 0 | 15 |
Top |
Fusion breakpoint peptide structures of ROS1-CD74 |
| 3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
| File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
| 9260 | TAVLRGQRVTGTGG | ROS1 | CD74 | chr6 | 117700221 | chr5 | 149782187 | 2781 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of ROS1-CD74 |
| Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens * We used Glide to predict the interaction between HLAs and neoantigens. |
| HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
| HLA-B14:02 | 3BVN | 9260 | TAVLRGQRVTGTGG | -8.85616 | -8.96956 |
| HLA-B14:02 | 3BVN | 9260 | TAVLRGQRVTGTGG | -5.66423 | -6.69953 |
| HLA-B52:01 | 3W39 | 9260 | TAVLRGQRVTGTGG | -6.49489 | -6.60829 |
| HLA-B52:01 | 3W39 | 9260 | TAVLRGQRVTGTGG | -3.99785 | -5.03315 |
| HLA-A11:01 | 4UQ2 | 9260 | TAVLRGQRVTGTGG | -4.90759 | -5.94289 |
| HLA-A24:02 | 5HGA | 9260 | TAVLRGQRVTGTGG | -7.27887 | -7.39227 |
| HLA-A24:02 | 5HGA | 9260 | TAVLRGQRVTGTGG | -7.11524 | -8.15054 |
| HLA-B27:05 | 6PYJ | 9260 | TAVLRGQRVTGTGG | -6.11615 | -6.22955 |
| HLA-B27:05 | 6PYJ | 9260 | TAVLRGQRVTGTGG | -4.78818 | -5.82348 |
| HLA-B44:05 | 3DX8 | 9260 | TAVLRGQRVTGTGG | -7.22602 | -7.33942 |
| HLA-B44:05 | 3DX8 | 9260 | TAVLRGQRVTGTGG | -4.86671 | -5.90201 |
Top |
Vaccine Design for the FusionNeoAntigens of ROS1-CD74 |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
| ROS1-CD74 | chr6 | 117700221 | chr5 | 149782187 | 3 | 14 | HLYTAVLRGQR | CCTGTACACAGCTGTTCTTCGGGGACAGAGAGT |
| ROS1-CD74 | chr6 | 117700221 | chr5 | 149782187 | 5 | 14 | YTAVLRGQR | CACAGCTGTTCTTCGGGGACAGAGAGT |
| ROS1-CD74 | chr6 | 117700221 | chr5 | 149782187 | 6 | 15 | TAVLRGQRV | AGCTGTTCTTCGGGGACAGAGAGTCAC |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
| ROS1-CD74 | chr6 | 117700221 | chr5 | 149782187 | 0 | 15 | QCIHLYTAVLRGQRV | ATGTATTCACCTGTACACAGCTGTTCTTCGGGGACAGAGAGTCAC |
| ROS1-CD74 | chr6 | 117700221 | chr5 | 149782187 | 2 | 17 | IHLYTAVLRGQRVTG | TCACCTGTACACAGCTGTTCTTCGGGGACAGAGAGTCACTGGAAC |
Top |
Information of the samples that have these potential fusion neoantigens of ROS1-CD74 |
| These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens. |
| Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
| LUAD | ROS1-CD74 | chr6 | 117700221 | ENST00000368507 | chr5 | 149782187 | ENST00000377795 | TCGA-86-8278-01A |
Top |
Potential target of CAR-T therapy development for ROS1-CD74 |
| Predicted 3D structure. We used RoseTTAFold. |
| Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features * Minus value of BPloci means that the break point is located before the CDS. |
| - In-frame and retained 'Transmembrane'. |
| Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
| Subcellular localization prediction of the transmembrane domain retained fusion proteins * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
| Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
| ROS1 | chr6 | 117700221 | ENST00000368507 | CD74 | chr5 | 149782187 | ENST00000377795 |  |
| ROS1 | chr6 | 117700221 | ENST00000368508 | CD74 | chr5 | 149782187 | ENST00000377795 |  |
Top |
Related Drugs to ROS1-CD74 |
| Drugs used for this fusion-positive patient. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to ROS1-CD74 |
| Diseases that have this fusion gene. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Disease | Source | PMID |
| Diseases associated with fusion partners. (DisGeNet 4.0) |
| Partner | Gene | Disease ID | Disease name | # pubmeds | Source |
| Hgene | ROS1 | C0007131 | Non-Small Cell Lung Carcinoma | 4 | CTD_human |
| Hgene | ROS1 | C0017638 | Glioma | 1 | CTD_human |
| Hgene | ROS1 | C0025202 | melanoma | 1 | CTD_human |
| Hgene | ROS1 | C0152013 | Adenocarcinoma of lung (disorder) | 1 | CGI;CTD_human |
| Hgene | ROS1 | C0259783 | mixed gliomas | 1 | CTD_human |
| Hgene | ROS1 | C0555198 | Malignant Glioma | 1 | CTD_human |
| Tgene | CD74 | C0006142 | Malignant neoplasm of breast | 1 | CTD_human |
| Tgene | CD74 | C0007131 | Non-Small Cell Lung Carcinoma | 1 | CTD_human |
| Tgene | CD74 | C0023893 | Liver Cirrhosis, Experimental | 1 | CTD_human |
| Tgene | CD74 | C0162557 | Liver Failure, Acute | 1 | CTD_human |
| Tgene | CD74 | C0678222 | Breast Carcinoma | 1 | CTD_human |
| Tgene | CD74 | C1257931 | Mammary Neoplasms, Human | 1 | CTD_human |
| Tgene | CD74 | C1458155 | Mammary Neoplasms | 1 | CTD_human |
| Tgene | CD74 | C4704874 | Mammary Carcinoma, Human | 1 | CTD_human |
Copyright 2023-PresentThe University of Texas Health Science Center at Houston (UTHealth)
Web File Viewing | Emergency Information
Campus Carry|Site Policies