Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:ATG4C-NFIA

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: ATG4C-NFIA
	FusionPDB ID: 7578
	FusionGDB2.0 ID: 7578
		Hgene	Tgene
	Gene symbol	ATG4C	NFIA
	Gene ID	84938	4774
	Gene name	autophagy related 4C cysteine peptidase	nuclear factor I A
	Synonyms	APG4-C\|APG4C\|AUTL1\|AUTL3	BRMUTD\|CTF\|NF-I/A\|NF1-A\|NFI-A\|NFI-L
	Cytomap	1p31.3	1p31.3
	Type of gene	protein-coding	protein-coding
	Description	cysteine protease ATG4CAPG4 autophagy 4 homolog CATG4 autophagy related 4 homolog CAUT-like 1, cysteine endopeptidaseAUT-like 3 cysteine endopeptidaseautophagin-3autophagy-related cysteine endopeptidase 3autophagy-related protein 4 homolog Cepidid	nuclear factor 1 A-typeCCAAT-box-binding transcription factorTGGCA-binding protein
	Modification date	20200313	20200313
	UniProtAcc	Q96DT6 Main function of 5'-partner protein: FUNCTION: Cysteine protease required for the cytoplasm to vacuole transport (Cvt) and autophagy. Cleaves the C-terminal amino acid of ATG8 family proteins MAP1LC3 and GABARAPL2, to reveal a C-terminal glycine. Exposure of the glycine at the C-terminus is essential for ATG8 proteins conjugation to phosphatidylethanolamine (PE) and insertion to membranes, which is necessary for autophagy. Has also an activity of delipidating enzyme for the PE-conjugated forms. {ECO:0000250, ECO:0000269\|PubMed:21177865}.	Q12857 Main function of 5'-partner protein: FUNCTION: Recognizes and binds the palindromic sequence 5'-TTGGCNNNNNGCCAA-3' present in viral and cellular promoters and in the origin of replication of adenovirus type 2. These proteins are individually capable of activating transcription and replication.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000317868, ENST00000371120,	ENST00000371185, ENST00000371187, ENST00000371189, ENST00000403491, ENST00000479364, ENST00000485903, ENST00000357977, ENST00000371184, ENST00000371191, ENST00000407417,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	8 X 7 X 5=280	21 X 24 X 8=4032
	# samples	9	28
	** MAII score	log2(9/280*10)=-1.63742992061529 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(28/4032*10)=-3.84799690655495 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: ATG4C [Title/Abstract] AND NFIA [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: ATG4C [Title/Abstract] AND NFIA [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	ATG4C(63270926)-NFIA(61798184), # samples:3
Anticipated loss of major functional domain due to fusion event.	ATG4C-NFIA seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ATG4C-NFIA seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ATG4C-NFIA seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. ATG4C-NFIA seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Tgene	NFIA	GO:0045944	positive regulation of transcription by RNA polymerase II	17010934

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr1:63270926/chr1:61798184)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across ATG4C (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across NFIA (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000371120	ATG4C	chr1	63270926	+	ENST00000371191	NFIA	chr1	61798184	+	1429	319	153	1223	356
ENST00000371120	ATG4C	chr1	63270926	+	ENST00000407417	NFIA	chr1	61798184	+	1489	319	153	1223	356
ENST00000317868	ATG4C	chr1	63270926	+	ENST00000371191	NFIA	chr1	61798184	+	1477	367	201	1271	356
ENST00000317868	ATG4C	chr1	63270926	+	ENST00000407417	NFIA	chr1	61798184	+	1537	367	201	1271	356
ENST00000371120	ATG4C	chr1	63270926	+	ENST00000371191	NFIA	chr1	61798183	+	1429	319	153	1223	356
ENST00000371120	ATG4C	chr1	63270926	+	ENST00000407417	NFIA	chr1	61798183	+	1489	319	153	1223	356
ENST00000317868	ATG4C	chr1	63270926	+	ENST00000371191	NFIA	chr1	61798183	+	1477	367	201	1271	356
ENST00000317868	ATG4C	chr1	63270926	+	ENST00000407417	NFIA	chr1	61798183	+	1537	367	201	1271	356

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000371120	ENST00000371191	ATG4C	chr1	63270926	+	NFIA	chr1	61798184	+	0.021421073	0.978579
ENST00000371120	ENST00000407417	ATG4C	chr1	63270926	+	NFIA	chr1	61798184	+	0.01381239	0.9861876
ENST00000317868	ENST00000371191	ATG4C	chr1	63270926	+	NFIA	chr1	61798184	+	0.017983673	0.98201627
ENST00000317868	ENST00000407417	ATG4C	chr1	63270926	+	NFIA	chr1	61798184	+	0.012284998	0.987715
ENST00000371120	ENST00000371191	ATG4C	chr1	63270926	+	NFIA	chr1	61798183	+	0.021421073	0.978579
ENST00000371120	ENST00000407417	ATG4C	chr1	63270926	+	NFIA	chr1	61798183	+	0.01381239	0.9861876
ENST00000317868	ENST00000371191	ATG4C	chr1	63270926	+	NFIA	chr1	61798183	+	0.017983673	0.98201627
ENST00000317868	ENST00000407417	ATG4C	chr1	63270926	+	NFIA	chr1	61798183	+	0.012284998	0.987715

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for ATG4C-NFIA

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
ATG4C	chr1	63270926	NFIA	chr1	61798183	319	55	VLLLGKCYHFKYEGHLGFQDSFVTSG
ATG4C	chr1	63270926	NFIA	chr1	61798183	367	55	VLLLGKCYHFKYEGHLGFQDSFVTSG
ATG4C	chr1	63270926	NFIA	chr1	61798184	319	55	VLLLGKCYHFKYEGHLGFQDSFVTSG
ATG4C	chr1	63270926	NFIA	chr1	61798184	367	55	VLLLGKCYHFKYEGHLGFQDSFVTSG

Top

Potential FusionNeoAntigen Information of ATG4C-NFIA in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

ATG4C-NFIA_63270926_61798183.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-B39:01	YHFKYEGHL	0.9987	0.7122	7	16
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-B38:02	YHFKYEGHL	0.9968	0.7598	7	16
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-B38:01	YHFKYEGHL	0.9955	0.7698	7	16
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-B27:02	FKYEGHLGF	0.9589	0.5401	9	18
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-B27:04	FKYEGHLGF	0.9495	0.7125	9	18
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-B39:01	FKYEGHLGF	0.8397	0.745	9	18
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-B15:18	YHFKYEGHL	0.786	0.532	7	16
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-B38:02	FKYEGHLGF	0.7693	0.8383	9	18
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-B38:01	FKYEGHLGF	0.7616	0.8618	9	18
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-B14:02	FKYEGHLGF	0.4953	0.6756	9	18
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-B14:01	FKYEGHLGF	0.4953	0.6756	9	18
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-B15:10	FKYEGHLGF	0.4621	0.5248	9	18
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-B15:18	FKYEGHLGF	0.383	0.6835	9	18
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-B15:03	FKYEGHLGF	0.364	0.7177	9	18
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-B52:01	FKYEGHLGF	0.0119	0.7946	9	18
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-B15:18	EGHLGFQDSF	0.878	0.7665	12	22
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-B38:01	EGHLGFQDSF	0.3612	0.9658	12	22
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-B38:02	EGHLGFQDSF	0.3309	0.9691	12	22
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-B39:01	YHFKYEGHLGF	0.9996	0.6782	7	18
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-B38:01	YHFKYEGHLGF	0.9992	0.7364	7	18
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-B38:02	YHFKYEGHLGF	0.9991	0.7301	7	18
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-B38:01	YEGHLGFQDSF	0.9742	0.9622	11	22
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-B38:02	YEGHLGFQDSF	0.9606	0.9687	11	22
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-B39:12	YHFKYEGHL	0.9983	0.7222	7	16
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-B39:05	YHFKYEGHL	0.9971	0.6914	7	16
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-C07:95	FKYEGHLGF	0.9743	0.5283	9	18
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-C07:27	FKYEGHLGF	0.9728	0.9261	9	18
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-C07:05	FKYEGHLGF	0.9456	0.9108	9	18
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-C07:29	FKYEGHLGF	0.9088	0.8368	9	18
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-C03:14	FKYEGHLGF	0.8728	0.9731	9	18
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-C07:13	FKYEGHLGF	0.8581	0.8873	9	18
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-C07:19	FKYEGHLGF	0.8497	0.5585	9	18
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-C07:10	FKYEGHLGF	0.847	0.9377	9	18
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-B39:12	FKYEGHLGF	0.8469	0.7569	9	18
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-C07:80	FKYEGHLGF	0.8418	0.9114	9	18
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-C07:67	FKYEGHLGF	0.8418	0.9114	9	18
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-C07:46	FKYEGHLGF	0.7941	0.7837	9	18
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-C07:13	YHFKYEGHL	0.7319	0.7987	7	16
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-C07:29	YHFKYEGHL	0.7152	0.8389	7	16
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-B39:05	FKYEGHLGF	0.7057	0.698	9	18
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-C07:80	YHFKYEGHL	0.5943	0.8262	7	16
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-C07:67	YHFKYEGHL	0.5943	0.8262	7	16
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-B15:21	FKYEGHLGF	0.5231	0.9106	9	18
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-C07:10	YHFKYEGHL	0.5171	0.8915	7	16
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-B14:03	YHFKYEGHL	0.2297	0.5853	7	16
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-C12:16	FKYEGHLGF	0.0739	0.956	9	18
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-C12:16	YHFKYEGHL	0.0398	0.9416	7	16
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-C12:12	FKYEGHLGF	0.0366	0.9314	9	18
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-C06:03	FKYEGHLGF	0.0176	0.9913	9	18
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-B15:21	HFKYEGHLGF	0.9743	0.8121	8	18
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-B39:12	YHFKYEGHLGF	0.9995	0.6886	7	18
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-B39:05	YHFKYEGHLGF	0.999	0.649	7	18
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-C07:46	YHFKYEGHLGF	0.9969	0.5997	7	18
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-C14:02	KYEGHLGF	0.9941	0.9129	10	18
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-C14:03	KYEGHLGF	0.9941	0.9129	10	18
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-B39:31	YHFKYEGHL	0.9989	0.7138	7	16
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-B38:05	YHFKYEGHL	0.9955	0.7698	7	16
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-B27:08	FKYEGHLGF	0.9502	0.7276	9	18
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-B27:06	FKYEGHLGF	0.9282	0.6625	9	18
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-B39:02	FKYEGHLGF	0.8561	0.7529	9	18
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-B39:31	FKYEGHLGF	0.8483	0.7519	9	18
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-C07:02	FKYEGHLGF	0.8418	0.9114	9	18
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-C07:17	FKYEGHLGF	0.8313	0.954	9	18
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-B27:09	FKYEGHLGF	0.8244	0.7543	9	18
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-B38:05	FKYEGHLGF	0.7616	0.8618	9	18
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-C07:17	YHFKYEGHL	0.748	0.9311	7	16
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-C07:22	FKYEGHLGF	0.7026	0.5468	9	18
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-C07:02	YHFKYEGHL	0.5943	0.8262	7	16
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-B35:28	FKYEGHLGF	0.4626	0.8783	9	18
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-B48:02	FKYEGHLGF	0.4042	0.852	9	18
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-C03:02	FKYEGHLGF	0.3579	0.9451	9	18
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-C06:08	FKYEGHLGF	0.3031	0.9864	9	18
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-B15:09	FKYEGHLGF	0.2729	0.6135	9	18
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-C03:67	FKYEGHLGF	0.2571	0.9364	9	18
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-C02:10	FKYEGHLGF	0.2566	0.9774	9	18
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-C02:02	FKYEGHLGF	0.2566	0.9774	9	18
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-B15:53	FKYEGHLGF	0.0994	0.8358	9	18
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-C12:02	FKYEGHLGF	0.0812	0.9673	9	18
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-C04:04	FKYEGHLGF	0.0722	0.7643	9	18
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-C06:06	FKYEGHLGF	0.0613	0.9889	9	18
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-B15:54	FKYEGHLGF	0.0483	0.7754	9	18
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-C06:02	FKYEGHLGF	0.0301	0.9918	9	18
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-C06:17	FKYEGHLGF	0.0301	0.9918	9	18
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-B15:54	HFKYEGHLGF	0.9835	0.6148	8	18
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-C14:03	HFKYEGHLGF	0.9678	0.9376	8	18
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-C14:02	HFKYEGHLGF	0.9678	0.9376	8	18
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-B48:02	HFKYEGHLGF	0.8966	0.7812	8	18
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-B38:05	EGHLGFQDSF	0.3612	0.9658	12	22
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-B39:31	YHFKYEGHLGF	0.9996	0.6816	7	18
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-B38:05	YHFKYEGHLGF	0.9992	0.7364	7	18
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-B15:54	YHFKYEGHLGF	0.9939	0.5935	7	18
ATG4C-NFIA	chr1	63270926	chr1	61798183	367	HLA-B38:05	YEGHLGFQDSF	0.9742	0.9622	11	22

Top

Potential FusionNeoAntigen Information of ATG4C-NFIA in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of ATG4C-NFIA

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
976	CYHFKYEGHLGFQD	ATG4C	NFIA	chr1	63270926	chr1	61798183	367

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of ATG4C-NFIA

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B52:01	3W39	976	CYHFKYEGHLGFQD	-6.07641	-6.07641
HLA-B44:05	3DX8	976	CYHFKYEGHLGFQD	-5.39456	-5.39456

Top

Vaccine Design for the FusionNeoAntigens of ATG4C-NFIA

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
ATG4C-NFIA	chr1	63270926	chr1	61798183	10	18	KYEGHLGF	AATATGAAGGACATTTGGGCTTCC
ATG4C-NFIA	chr1	63270926	chr1	61798183	11	22	YEGHLGFQDSF	ATGAAGGACATTTGGGCTTCCAGGACAGTTTTG
ATG4C-NFIA	chr1	63270926	chr1	61798183	12	22	EGHLGFQDSF	AAGGACATTTGGGCTTCCAGGACAGTTTTG
ATG4C-NFIA	chr1	63270926	chr1	61798183	7	16	YHFKYEGHL	ACCATTTTAAATATGAAGGACATTTGG
ATG4C-NFIA	chr1	63270926	chr1	61798183	7	18	YHFKYEGHLGF	ACCATTTTAAATATGAAGGACATTTGGGCTTCC
ATG4C-NFIA	chr1	63270926	chr1	61798183	8	18	HFKYEGHLGF	ATTTTAAATATGAAGGACATTTGGGCTTCC
ATG4C-NFIA	chr1	63270926	chr1	61798183	9	18	FKYEGHLGF	TTAAATATGAAGGACATTTGGGCTTCC

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of ATG4C-NFIA

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
OV	ATG4C-NFIA	chr1	63270926	ENST00000317868	chr1	61798183	ENST00000371191	TCGA-20-1684

Top

Potential target of CAR-T therapy development for ATG4C-NFIA

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to ATG4C-NFIA

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to ATG4C-NFIA

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)