![]() |
|||||||
|
Fusion Protein:RYR2-MTR |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: RYR2-MTR | FusionPDB ID: 78806 | FusionGDB2.0 ID: 78806 | Hgene | Tgene | Gene symbol | RYR2 | MTR | Gene ID | 6262 | 4548 |
Gene name | ryanodine receptor 2 | 5-methyltetrahydrofolate-homocysteine methyltransferase | |
Synonyms | ARVC2|ARVD2|RYR-2|RyR|VTSIP | HMAG|MS|cblG | |
Cytomap | 1q43 | 1q43 | |
Type of gene | protein-coding | protein-coding | |
Description | ryanodine receptor 2cardiac muscle ryanodine receptor-calcium release channelcardiac-type ryanodine receptorislet-type ryanodine receptorkidney-type ryanodine receptorryanodine receptor 2 (cardiac)type 2 ryanodine receptor | methionine synthase5-methyltetrahydrofolate-homocysteine methyltransferase 1cobalamin-dependent methionine synthasevitamin-B12 dependent methionine synthase | |
Modification date | 20200315 | 20200313 | |
UniProtAcc | . | Q9UBK8 Main function of 5'-partner protein: FUNCTION: Key enzyme in methionine and folate homeostasis responsible for the reactivation of methionine synthase (MTR/MS) activity by catalyzing the reductive methylation of MTR-bound cob(II)alamin (PubMed:17892308). Cobalamin (vitamin B12) forms a complex with MTR to serve as an intermediary in methyl transfer reactions that cycles between MTR-bound methylcob(III)alamin and MTR bound-cob(I)alamin forms, and occasional oxidative escape of the cob(I)alamin intermediate during the catalytic cycle leads to the inactive cob(II)alamin species (Probable). The processing of cobalamin in the cytosol occurs in a multiprotein complex composed of at least MMACHC, MMADHC, MTRR and MTR which may contribute to shuttle safely and efficiently cobalamin towards MTR in order to produce methionine (PubMed:27771510). Also necessary for the utilization of methyl groups from the folate cycle, thereby affecting transgenerational epigenetic inheritance (By similarity). Also acts as a molecular chaperone for methionine synthase by stabilizing apoMTR and incorporating methylcob(III)alamin into apoMTR to form the holoenzyme (PubMed:16769880). Also serves as an aquacob(III)alamin reductase by reducing aquacob(III)alamin to cob(II)alamin; this reduction leads to stimulation of the conversion of apoMTR and aquacob(III)alamin to MTR holoenzyme (PubMed:16769880). {ECO:0000250|UniProtKB:Q8C1A3, ECO:0000269|PubMed:16769880, ECO:0000269|PubMed:17892308, ECO:0000269|PubMed:27771510, ECO:0000305|PubMed:19243433}. | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000360064, ENST00000366574, ENST00000542537, ENST00000609119, | ENST00000418145, ENST00000470570, ENST00000535889, ENST00000366577, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 10 X 11 X 5=550 | 5 X 5 X 2=50 |
# samples | 11 | 5 | |
** MAII score | log2(11/550*10)=-2.32192809488736 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(5/50*10)=0 | |
Fusion gene context | PubMed: RYR2 [Title/Abstract] AND MTR [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: RYR2 [Title/Abstract] AND MTR [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | RYR2(237551483)-MTR(237044055), # samples:1 | ||
Anticipated loss of major functional domain due to fusion event. | RYR2-MTR seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. RYR2-MTR seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. RYR2-MTR seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. RYR2-MTR seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Hgene | RYR2 | GO:0005513 | detection of calcium ion | 10830164 |
Hgene | RYR2 | GO:0006816 | calcium ion transport | 17921453 |
Hgene | RYR2 | GO:0031000 | response to caffeine | 17921453 |
Hgene | RYR2 | GO:0035584 | calcium-mediated signaling using intracellular calcium source | 17921453 |
Hgene | RYR2 | GO:0051209 | release of sequestered calcium ion into cytosol | 12443530|17921453 |
Hgene | RYR2 | GO:0051284 | positive regulation of sequestering of calcium ion | 12443530|12919952 |
Hgene | RYR2 | GO:0051775 | response to redox state | 19226252 |
Hgene | RYR2 | GO:0060402 | calcium ion transport into cytosol | 17921453 |
Hgene | RYR2 | GO:0071313 | cellular response to caffeine | 12919952 |
Hgene | RYR2 | GO:0072599 | establishment of protein localization to endoplasmic reticulum | 12443530 |
Hgene | RYR2 | GO:1901896 | positive regulation of calcium-transporting ATPase activity | 12443530 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr1:237551483/chr1:237044055) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000366574 | RYR2 | chr1 | 237551483 | + | ENST00000366577 | MTR | chr1 | 237044055 | + | 8631 | 1090 | 35 | 2293 | 752 |
ENST00000360064 | RYR2 | chr1 | 237551483 | + | ENST00000366577 | MTR | chr1 | 237044055 | + | 8308 | 767 | 0 | 1970 | 656 |
ENST00000542537 | RYR2 | chr1 | 237551483 | + | ENST00000366577 | MTR | chr1 | 237044055 | + | 8266 | 725 | 15 | 1928 | 637 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000366574 | ENST00000366577 | RYR2 | chr1 | 237551483 | + | MTR | chr1 | 237044055 | + | 0.000564066 | 0.99943596 |
ENST00000360064 | ENST00000366577 | RYR2 | chr1 | 237551483 | + | MTR | chr1 | 237044055 | + | 0.001317921 | 0.9986821 |
ENST00000542537 | ENST00000366577 | RYR2 | chr1 | 237551483 | + | MTR | chr1 | 237044055 | + | 0.000549984 | 0.99945 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for RYR2-MTR |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
RYR2 | chr1 | 237551483 | MTR | chr1 | 237044055 | 1090 | 351 | LTVPSGEHGEEQRRTHTAVKIAPRYS |
RYR2 | chr1 | 237551483 | MTR | chr1 | 237044055 | 725 | 236 | LTVPSGEHGEEQRRTHTAVKIAPRYS |
RYR2 | chr1 | 237551483 | MTR | chr1 | 237044055 | 767 | 255 | LTVPSGEHGEEQRRTHTAVKIAPRYS |
Top |
Potential FusionNeoAntigen Information of RYR2-MTR in HLA I |
![]() |
RYR2-MTR_237551483_237044055.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
RYR2-MTR | chr1 | 237551483 | chr1 | 237044055 | 767 | HLA-B27:05 | RRTHTAVKI | 0.9997 | 0.6723 | 12 | 21 |
RYR2-MTR | chr1 | 237551483 | chr1 | 237044055 | 767 | HLA-B27:04 | RRTHTAVKI | 0.9997 | 0.5981 | 12 | 21 |
RYR2-MTR | chr1 | 237551483 | chr1 | 237044055 | 767 | HLA-B45:01 | EEQRRTHTA | 0.9984 | 0.7198 | 9 | 18 |
RYR2-MTR | chr1 | 237551483 | chr1 | 237044055 | 767 | HLA-B14:01 | EQRRTHTAV | 0.988 | 0.7923 | 10 | 19 |
RYR2-MTR | chr1 | 237551483 | chr1 | 237044055 | 767 | HLA-B14:02 | EQRRTHTAV | 0.988 | 0.7923 | 10 | 19 |
RYR2-MTR | chr1 | 237551483 | chr1 | 237044055 | 767 | HLA-B41:01 | EEQRRTHTA | 0.9838 | 0.7689 | 9 | 18 |
RYR2-MTR | chr1 | 237551483 | chr1 | 237044055 | 767 | HLA-B08:09 | EEQRRTHTA | 0.9542 | 0.5556 | 9 | 18 |
RYR2-MTR | chr1 | 237551483 | chr1 | 237044055 | 767 | HLA-B18:01 | EEQRRTHTA | 0.5439 | 0.5368 | 9 | 18 |
RYR2-MTR | chr1 | 237551483 | chr1 | 237044055 | 767 | HLA-B45:01 | GEEQRRTHTA | 0.9892 | 0.9424 | 8 | 18 |
RYR2-MTR | chr1 | 237551483 | chr1 | 237044055 | 767 | HLA-B50:02 | GEEQRRTHTA | 0.974 | 0.6649 | 8 | 18 |
RYR2-MTR | chr1 | 237551483 | chr1 | 237044055 | 767 | HLA-B41:01 | GEEQRRTHTA | 0.766 | 0.9242 | 8 | 18 |
RYR2-MTR | chr1 | 237551483 | chr1 | 237044055 | 767 | HLA-B50:01 | GEEQRRTHTA | 0.6389 | 0.6316 | 8 | 18 |
RYR2-MTR | chr1 | 237551483 | chr1 | 237044055 | 767 | HLA-B27:14 | RRTHTAVKI | 0.9997 | 0.5109 | 12 | 21 |
RYR2-MTR | chr1 | 237551483 | chr1 | 237044055 | 767 | HLA-B27:03 | RRTHTAVKI | 0.9937 | 0.6857 | 12 | 21 |
RYR2-MTR | chr1 | 237551483 | chr1 | 237044055 | 767 | HLA-C07:27 | RRTHTAVKI | 0.9637 | 0.8146 | 12 | 21 |
RYR2-MTR | chr1 | 237551483 | chr1 | 237044055 | 767 | HLA-C07:05 | RRTHTAVKI | 0.9561 | 0.7735 | 12 | 21 |
RYR2-MTR | chr1 | 237551483 | chr1 | 237044055 | 767 | HLA-B14:03 | EQRRTHTAV | 0.7966 | 0.6445 | 10 | 19 |
RYR2-MTR | chr1 | 237551483 | chr1 | 237044055 | 767 | HLA-B15:04 | EQRRTHTAV | 0.4516 | 0.6295 | 10 | 19 |
RYR2-MTR | chr1 | 237551483 | chr1 | 237044055 | 767 | HLA-B51:07 | EQRRTHTAV | 0.0903 | 0.7051 | 10 | 19 |
RYR2-MTR | chr1 | 237551483 | chr1 | 237044055 | 767 | HLA-B27:10 | RRTHTAVKI | 0.9997 | 0.7412 | 12 | 21 |
RYR2-MTR | chr1 | 237551483 | chr1 | 237044055 | 767 | HLA-B27:08 | RRTHTAVKI | 0.9997 | 0.5311 | 12 | 21 |
RYR2-MTR | chr1 | 237551483 | chr1 | 237044055 | 767 | HLA-B27:09 | RRTHTAVKI | 0.9993 | 0.6672 | 12 | 21 |
RYR2-MTR | chr1 | 237551483 | chr1 | 237044055 | 767 | HLA-B27:10 | QRRTHTAVK | 0.9927 | 0.6396 | 11 | 20 |
RYR2-MTR | chr1 | 237551483 | chr1 | 237044055 | 767 | HLA-C06:08 | RRTHTAVKI | 0.8759 | 0.9706 | 12 | 21 |
RYR2-MTR | chr1 | 237551483 | chr1 | 237044055 | 767 | HLA-B18:05 | EEQRRTHTA | 0.5439 | 0.5368 | 9 | 18 |
RYR2-MTR | chr1 | 237551483 | chr1 | 237044055 | 767 | HLA-B18:06 | EEQRRTHTA | 0.5218 | 0.567 | 9 | 18 |
RYR2-MTR | chr1 | 237551483 | chr1 | 237044055 | 767 | HLA-B18:03 | EEQRRTHTA | 0.5056 | 0.5285 | 9 | 18 |
RYR2-MTR | chr1 | 237551483 | chr1 | 237044055 | 767 | HLA-C06:06 | RRTHTAVKI | 0.1579 | 0.949 | 12 | 21 |
RYR2-MTR | chr1 | 237551483 | chr1 | 237044055 | 767 | HLA-C06:02 | RRTHTAVKI | 0.0087 | 0.9593 | 12 | 21 |
RYR2-MTR | chr1 | 237551483 | chr1 | 237044055 | 767 | HLA-C06:17 | RRTHTAVKI | 0.0087 | 0.9593 | 12 | 21 |
RYR2-MTR | chr1 | 237551483 | chr1 | 237044055 | 767 | HLA-B50:05 | GEEQRRTHTA | 0.6389 | 0.6316 | 8 | 18 |
RYR2-MTR | chr1 | 237551483 | chr1 | 237044055 | 767 | HLA-B50:04 | GEEQRRTHTA | 0.6389 | 0.6316 | 8 | 18 |
Top |
Potential FusionNeoAntigen Information of RYR2-MTR in HLA II |
![]() |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of RYR2-MTR |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
1778 | EHGEEQRRTHTAVK | RYR2 | MTR | chr1 | 237551483 | chr1 | 237044055 | 767 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of RYR2-MTR |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 1778 | EHGEEQRRTHTAVK | -7.9962 | -8.1096 |
HLA-B14:02 | 3BVN | 1778 | EHGEEQRRTHTAVK | -5.70842 | -6.74372 |
HLA-B52:01 | 3W39 | 1778 | EHGEEQRRTHTAVK | -6.83737 | -6.95077 |
HLA-B52:01 | 3W39 | 1778 | EHGEEQRRTHTAVK | -4.4836 | -5.5189 |
HLA-A11:01 | 4UQ2 | 1778 | EHGEEQRRTHTAVK | -10.0067 | -10.1201 |
HLA-A11:01 | 4UQ2 | 1778 | EHGEEQRRTHTAVK | -9.03915 | -10.0745 |
HLA-A24:02 | 5HGA | 1778 | EHGEEQRRTHTAVK | -6.56204 | -6.67544 |
HLA-A24:02 | 5HGA | 1778 | EHGEEQRRTHTAVK | -5.42271 | -6.45801 |
HLA-B44:05 | 3DX8 | 1778 | EHGEEQRRTHTAVK | -7.85648 | -8.89178 |
HLA-B44:05 | 3DX8 | 1778 | EHGEEQRRTHTAVK | -5.3978 | -5.5112 |
HLA-A02:01 | 6TDR | 1778 | EHGEEQRRTHTAVK | -3.37154 | -4.40684 |
Top |
Vaccine Design for the FusionNeoAntigens of RYR2-MTR |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
RYR2-MTR | chr1 | 237551483 | chr1 | 237044055 | 10 | 19 | EQRRTHTAV | GCAGCGGAGAACCCACACAGCAGTTAA |
RYR2-MTR | chr1 | 237551483 | chr1 | 237044055 | 11 | 20 | QRRTHTAVK | GCGGAGAACCCACACAGCAGTTAAAAT |
RYR2-MTR | chr1 | 237551483 | chr1 | 237044055 | 12 | 21 | RRTHTAVKI | GAGAACCCACACAGCAGTTAAAATAGC |
RYR2-MTR | chr1 | 237551483 | chr1 | 237044055 | 8 | 18 | GEEQRRTHTA | TGAAGAGCAGCGGAGAACCCACACAGCAGT |
RYR2-MTR | chr1 | 237551483 | chr1 | 237044055 | 9 | 18 | EEQRRTHTA | AGAGCAGCGGAGAACCCACACAGCAGT |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of RYR2-MTR |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
Non-Cancer | RYR2-MTR | chr1 | 237551483 | ENST00000360064 | chr1 | 237044055 | ENST00000366577 | ERR315413 |
Top |
Potential target of CAR-T therapy development for RYR2-MTR |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to RYR2-MTR |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to RYR2-MTR |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |