Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:SCAF1-ETV7

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: SCAF1-ETV7
	FusionPDB ID: 79403
	FusionGDB2.0 ID: 79403
		Hgene	Tgene
	Gene symbol	SCAF1	ETV7
	Gene ID	58506	51513
	Gene name	SR-related CTD associated factor 1	ETS variant transcription factor 7
	Synonyms	SRA1	TEL-2\|TEL2\|TELB
	Cytomap	19q13.33	6p21.31
	Type of gene	protein-coding	protein-coding
	Description	splicing factor, arginine/serine-rich 19SCAFSR-related C-terminal domain-associated factor 1SR-related and CTD-associated factor 1SR-related-CTD-associated factorserine arginine-rich pre-mRNA splicing factor SR-A1	transcription factor ETV7ETS translocation variant 7ETS variant 7ETS-related protein Tel2Ets transcription factor TEL-2bTEL2 oncogeneets variant gene 7 (TEL2 oncogene)tel-related Ets factor
	Modification date	20200313	20200313
	UniProtAcc	.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000360565,	ENST00000538992, ENST00000339796, ENST00000340181, ENST00000373737, ENST00000373738,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	9 X 8 X 9=648	4 X 4 X 4=64
	# samples	13	5
	** MAII score	log2(13/648*10)=-2.31748218985617 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(5/64*10)=-0.356143810225275 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: SCAF1 [Title/Abstract] AND ETV7 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: SCAF1 [Title/Abstract] AND ETV7 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	SCAF1(50155926)-ETV7(36343378), # samples:1 SCAF1(50150087)-ETV7(36341355), # samples:1
Anticipated loss of major functional domain due to fusion event.	SCAF1-ETV7 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. SCAF1-ETV7 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. SCAF1-ETV7 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. SCAF1-ETV7 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Tgene	ETV7	GO:0000122	negative regulation of transcription by RNA polymerase II	11108721

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr19:50155926/chr6:36343378)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across SCAF1 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across ETV7 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000360565	SCAF1	chr19	50150087	+	ENST00000339796	ETV7	chr6	36341355	-	1249	602	49	1248	400
ENST00000360565	SCAF1	chr19	50150087	+	ENST00000373737	ETV7	chr6	36341355	-	1541	602	49	1089	346
ENST00000360565	SCAF1	chr19	50150087	+	ENST00000340181	ETV7	chr6	36341355	-	1772	602	49	1320	423
ENST00000360565	SCAF1	chr19	50150087	+	ENST00000373738	ETV7	chr6	36341355	-	1771	602	49	1320	423

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000360565	ENST00000339796	SCAF1	chr19	50150087	+	ETV7	chr6	36341355	-	0.03536128	0.9646387
ENST00000360565	ENST00000373737	SCAF1	chr19	50150087	+	ETV7	chr6	36341355	-	0.008992569	0.9910074
ENST00000360565	ENST00000340181	SCAF1	chr19	50150087	+	ETV7	chr6	36341355	-	0.018538302	0.9814617
ENST00000360565	ENST00000373738	SCAF1	chr19	50150087	+	ETV7	chr6	36341355	-	0.018292027	0.98170793

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for SCAF1-ETV7

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
SCAF1	chr19	50150087	ETV7	chr6	36341355	602	184	LLPRLRAWRTGKTGDVLYELLQYIKT

Top

Potential FusionNeoAntigen Information of SCAF1-ETV7 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

SCAF1-ETV7_50150087_36341355.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
SCAF1-ETV7	chr19	50150087	chr6	36341355	602	HLA-B58:01	KTGDVLYEL	0.9912	0.9793	11	20
SCAF1-ETV7	chr19	50150087	chr6	36341355	602	HLA-B15:17	KTGDVLYEL	0.9902	0.9724	11	20
SCAF1-ETV7	chr19	50150087	chr6	36341355	602	HLA-B15:16	KTGDVLYEL	0.9841	0.9638	11	20
SCAF1-ETV7	chr19	50150087	chr6	36341355	602	HLA-A02:24	KTGDVLYEL	0.9762	0.6072	11	20
SCAF1-ETV7	chr19	50150087	chr6	36341355	602	HLA-A02:30	KTGDVLYEL	0.9762	0.6072	11	20
SCAF1-ETV7	chr19	50150087	chr6	36341355	602	HLA-A02:67	KTGDVLYEL	0.9762	0.6072	11	20
SCAF1-ETV7	chr19	50150087	chr6	36341355	602	HLA-A02:60	KTGDVLYEL	0.9753	0.5429	11	20
SCAF1-ETV7	chr19	50150087	chr6	36341355	602	HLA-A02:04	KTGDVLYEL	0.9752	0.6058	11	20
SCAF1-ETV7	chr19	50150087	chr6	36341355	602	HLA-A02:21	KTGDVLYEL	0.9747	0.7214	11	20
SCAF1-ETV7	chr19	50150087	chr6	36341355	602	HLA-B58:02	KTGDVLYEL	0.9726	0.976	11	20
SCAF1-ETV7	chr19	50150087	chr6	36341355	602	HLA-A02:11	KTGDVLYEL	0.9721	0.6418	11	20
SCAF1-ETV7	chr19	50150087	chr6	36341355	602	HLA-B57:03	KTGDVLYEL	0.972	0.9941	11	20
SCAF1-ETV7	chr19	50150087	chr6	36341355	602	HLA-A02:35	KTGDVLYEL	0.9616	0.6253	11	20
SCAF1-ETV7	chr19	50150087	chr6	36341355	602	HLA-A02:16	KTGDVLYEL	0.9479	0.6054	11	20
SCAF1-ETV7	chr19	50150087	chr6	36341355	602	HLA-A32:13	KTGDVLYEL	0.9261	0.9528	11	20
SCAF1-ETV7	chr19	50150087	chr6	36341355	602	HLA-A02:29	KTGDVLYEL	0.9132	0.6106	11	20
SCAF1-ETV7	chr19	50150087	chr6	36341355	602	HLA-A02:20	KTGDVLYEL	0.8845	0.6134	11	20
SCAF1-ETV7	chr19	50150087	chr6	36341355	602	HLA-B13:01	KTGDVLYEL	0.2141	0.9929	11	20
SCAF1-ETV7	chr19	50150087	chr6	36341355	602	HLA-B15:17	RTGKTGDVLY	0.9805	0.9507	8	18
SCAF1-ETV7	chr19	50150087	chr6	36341355	602	HLA-B27:02	WRTGKTGDVLY	0.9997	0.5861	7	18
SCAF1-ETV7	chr19	50150087	chr6	36341355	602	HLA-C05:09	TGDVLYEL	1	0.9664	12	20
SCAF1-ETV7	chr19	50150087	chr6	36341355	602	HLA-C08:15	TGDVLYEL	1	0.977	12	20
SCAF1-ETV7	chr19	50150087	chr6	36341355	602	HLA-C05:09	TGDVLYELL	0.9999	0.9561	12	21
SCAF1-ETV7	chr19	50150087	chr6	36341355	602	HLA-C08:15	TGDVLYELL	0.9998	0.9803	12	21
SCAF1-ETV7	chr19	50150087	chr6	36341355	602	HLA-C15:06	KTGDVLYEL	0.9995	0.9683	11	20
SCAF1-ETV7	chr19	50150087	chr6	36341355	602	HLA-C15:04	KTGDVLYEL	0.9993	0.9652	11	20
SCAF1-ETV7	chr19	50150087	chr6	36341355	602	HLA-C03:07	KTGDVLYEL	0.999	0.9916	11	20
SCAF1-ETV7	chr19	50150087	chr6	36341355	602	HLA-C04:06	KTGDVLYEL	0.9987	0.9277	11	20
SCAF1-ETV7	chr19	50150087	chr6	36341355	602	HLA-A02:01	KTGDVLYEL	0.9762	0.6072	11	20
SCAF1-ETV7	chr19	50150087	chr6	36341355	602	HLA-A02:07	KTGDVLYEL	0.9757	0.6263	11	20
SCAF1-ETV7	chr19	50150087	chr6	36341355	602	HLA-C06:03	KTGDVLYEL	0.8813	0.9951	11	20
SCAF1-ETV7	chr19	50150087	chr6	36341355	602	HLA-C12:04	KTGDVLYEL	0.8796	0.9943	11	20
SCAF1-ETV7	chr19	50150087	chr6	36341355	602	HLA-C02:06	KTGDVLYEL	0.4593	0.9763	11	20
SCAF1-ETV7	chr19	50150087	chr6	36341355	602	HLA-C04:03	TGDVLYEL	1	0.9079	12	20
SCAF1-ETV7	chr19	50150087	chr6	36341355	602	HLA-C08:02	TGDVLYEL	1	0.977	12	20
SCAF1-ETV7	chr19	50150087	chr6	36341355	602	HLA-C05:01	TGDVLYEL	1	0.9664	12	20
SCAF1-ETV7	chr19	50150087	chr6	36341355	602	HLA-C04:03	TGDVLYELL	0.9999	0.9303	12	21
SCAF1-ETV7	chr19	50150087	chr6	36341355	602	HLA-C05:01	TGDVLYELL	0.9999	0.9561	12	21
SCAF1-ETV7	chr19	50150087	chr6	36341355	602	HLA-C08:02	TGDVLYELL	0.9998	0.9803	12	21
SCAF1-ETV7	chr19	50150087	chr6	36341355	602	HLA-C15:02	KTGDVLYEL	0.9995	0.9361	11	20
SCAF1-ETV7	chr19	50150087	chr6	36341355	602	HLA-C15:05	KTGDVLYEL	0.9995	0.9377	11	20
SCAF1-ETV7	chr19	50150087	chr6	36341355	602	HLA-C15:09	KTGDVLYEL	0.9993	0.9652	11	20
SCAF1-ETV7	chr19	50150087	chr6	36341355	602	HLA-C16:02	KTGDVLYEL	0.9952	0.9957	11	20
SCAF1-ETV7	chr19	50150087	chr6	36341355	602	HLA-B57:04	KTGDVLYEL	0.9879	0.856	11	20
SCAF1-ETV7	chr19	50150087	chr6	36341355	602	HLA-A32:01	KTGDVLYEL	0.9862	0.971	11	20
SCAF1-ETV7	chr19	50150087	chr6	36341355	602	HLA-A02:14	KTGDVLYEL	0.9758	0.5953	11	20
SCAF1-ETV7	chr19	50150087	chr6	36341355	602	HLA-A02:06	KTGDVLYEL	0.9747	0.7214	11	20
SCAF1-ETV7	chr19	50150087	chr6	36341355	602	HLA-B58:06	KTGDVLYEL	0.966	0.9659	11	20
SCAF1-ETV7	chr19	50150087	chr6	36341355	602	HLA-B57:02	KTGDVLYEL	0.9537	0.9707	11	20
SCAF1-ETV7	chr19	50150087	chr6	36341355	602	HLA-C17:01	KTGDVLYEL	0.654	0.9749	11	20
SCAF1-ETV7	chr19	50150087	chr6	36341355	602	HLA-C02:10	KTGDVLYEL	0.3228	0.9854	11	20
SCAF1-ETV7	chr19	50150087	chr6	36341355	602	HLA-C02:02	KTGDVLYEL	0.3228	0.9854	11	20
SCAF1-ETV7	chr19	50150087	chr6	36341355	602	HLA-B57:04	RTGKTGDVLY	0.9954	0.7592	8	18
SCAF1-ETV7	chr19	50150087	chr6	36341355	602	HLA-B15:135	RTGKTGDVLY	0.9873	0.8923	8	18
SCAF1-ETV7	chr19	50150087	chr6	36341355	602	HLA-B58:06	RTGKTGDVLY	0.9754	0.7489	8	18

Top

Potential FusionNeoAntigen Information of SCAF1-ETV7 in HLA II

SCAF1-ETV7_50150087_36341355.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
SCAF1-ETV7	chr19	50150087	chr6	36341355	602	DRB1-0437	LPRLRAWRTGKTGDV	1	16
SCAF1-ETV7	chr19	50150087	chr6	36341355	602	DRB1-0437	LLPRLRAWRTGKTGD	0	15
SCAF1-ETV7	chr19	50150087	chr6	36341355	602	DRB1-1457	LPRLRAWRTGKTGDV	1	16
SCAF1-ETV7	chr19	50150087	chr6	36341355	602	DRB1-1457	LLPRLRAWRTGKTGD	0	15

Top

Fusion breakpoint peptide structures of SCAF1-ETV7

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
732	AWRTGKTGDVLYEL	SCAF1	ETV7	chr19	50150087	chr6	36341355	602

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of SCAF1-ETV7

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	732	AWRTGKTGDVLYEL	-7.63753	-7.75093
HLA-B14:02	3BVN	732	AWRTGKTGDVLYEL	-4.36349	-5.39879
HLA-B52:01	3W39	732	AWRTGKTGDVLYEL	-6.74822	-6.86162
HLA-B52:01	3W39	732	AWRTGKTGDVLYEL	-4.96916	-6.00446
HLA-A24:02	5HGA	732	AWRTGKTGDVLYEL	-8.26666	-9.30196
HLA-A24:02	5HGA	732	AWRTGKTGDVLYEL	-7.6208	-7.7342
HLA-B27:03	6PZ5	732	AWRTGKTGDVLYEL	0.0420189	-0.993281
HLA-B44:05	3DX8	732	AWRTGKTGDVLYEL	-5.06122	-5.17462
HLA-B44:05	3DX8	732	AWRTGKTGDVLYEL	-4.87073	-5.90603

Top

Vaccine Design for the FusionNeoAntigens of SCAF1-ETV7

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
SCAF1-ETV7	chr19	50150087	chr6	36341355	11	20	KTGDVLYEL	AAACGGGTGACGTCCTGTATGAGCTGC
SCAF1-ETV7	chr19	50150087	chr6	36341355	12	20	TGDVLYEL	CGGGTGACGTCCTGTATGAGCTGC
SCAF1-ETV7	chr19	50150087	chr6	36341355	12	21	TGDVLYELL	CGGGTGACGTCCTGTATGAGCTGCTCC
SCAF1-ETV7	chr19	50150087	chr6	36341355	7	18	WRTGKTGDVLY	GGAGGACGGGCAAAACGGGTGACGTCCTGTATG
SCAF1-ETV7	chr19	50150087	chr6	36341355	8	18	RTGKTGDVLY	GGACGGGCAAAACGGGTGACGTCCTGTATG

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
SCAF1-ETV7	chr19	50150087	chr6	36341355	0	15	LLPRLRAWRTGKTGD	TGCTGCCCCGTCTCAGGGCCTGGAGGACGGGCAAAACGGGTGACG
SCAF1-ETV7	chr19	50150087	chr6	36341355	1	16	LPRLRAWRTGKTGDV	TGCCCCGTCTCAGGGCCTGGAGGACGGGCAAAACGGGTGACGTCC

Top

Information of the samples that have these potential fusion neoantigens of SCAF1-ETV7

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
LGG	SCAF1-ETV7	chr19	50150087	ENST00000360565	chr6	36341355	ENST00000339796	TCGA-TM-A7CF

Top

Potential target of CAR-T therapy development for SCAF1-ETV7

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to SCAF1-ETV7

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to SCAF1-ETV7

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)