Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:SCAF4-RUNX2

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: SCAF4-RUNX2
	FusionPDB ID: 79420
	FusionGDB2.0 ID: 79420
		Hgene	Tgene
	Gene symbol	SCAF4	RUNX2
	Gene ID	57466	860
	Gene name	SR-related CTD associated factor 4	RUNX family transcription factor 2
	Synonyms	SFRS15\|SRA4	AML3\|CBF-alpha-1\|CBFA1\|CCD\|CCD1\|CLCD\|OSF-2\|OSF2\|PEA2aA\|PEBP2aA
	Cytomap	21q22.11	6p21.1
	Type of gene	protein-coding	protein-coding
	Description	SR-related and CTD-associated factor 4CTD-binding SR-like protein rA4SR-like CTD-associated factor 4pre-mRNA splicing SR protein rA4splicing factor serine alanine 15splicing factor, arginine/serine-rich 15	runt-related transcription factor 2PEA2-alpha APEBP2-alpha ASL3-3 enhancer factor 1 alpha A subunitSL3/AKV core-binding factor alpha A subunitacute myeloid leukemia 3 proteincore-binding factor, runt domain, alpha subunit 1oncogene AML-3osteoblast
	Modification date	20200314	20200322
	UniProtAcc	.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000286835, ENST00000399804, ENST00000434667,	ENST00000483243, ENST00000352853, ENST00000359524, ENST00000371432, ENST00000371436, ENST00000371438, ENST00000465038, ENST00000541979, ENST00000576263,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	21 X 11 X 5=1155	6 X 6 X 4=144
	# samples	20	6
	** MAII score	log2(20/1155*10)=-2.5298209465287 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(6/144*10)=-1.26303440583379 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: SCAF4 [Title/Abstract] AND RUNX2 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: SCAF4 [Title/Abstract] AND RUNX2 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	SCAF4(33057361)-RUNX2(45459677), # samples:1
Anticipated loss of major functional domain due to fusion event.	SCAF4-RUNX2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. SCAF4-RUNX2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. SCAF4-RUNX2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. SCAF4-RUNX2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	SCAF4	GO:2000805	negative regulation of termination of RNA polymerase II transcription, poly(A)-coupled	31104839
Tgene	RUNX2	GO:0045892	negative regulation of transcription, DNA-templated	11965546
Tgene	RUNX2	GO:0045893	positive regulation of transcription, DNA-templated	11965546

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr21:33057361/chr6:45459677)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across SCAF4 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across RUNX2 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000399804	SCAF4	chr21	33057361	-	ENST00000541979	RUNX2	chr6	45459677	+	3620	2805	302	3619	1106
ENST00000399804	SCAF4	chr21	33057361	-	ENST00000465038	RUNX2	chr6	45459677	+	3686	2805	302	3685	1128
ENST00000399804	SCAF4	chr21	33057361	-	ENST00000352853	RUNX2	chr6	45459677	+	3686	2805	302	3685	1128
ENST00000399804	SCAF4	chr21	33057361	-	ENST00000371438	RUNX2	chr6	45459677	+	7460	2805	302	3685	1127
ENST00000399804	SCAF4	chr21	33057361	-	ENST00000371436	RUNX2	chr6	45459677	+	3708	2805	302	3619	1105
ENST00000399804	SCAF4	chr21	33057361	-	ENST00000576263	RUNX2	chr6	45459677	+	4376	2805	302	3748	1148
ENST00000399804	SCAF4	chr21	33057361	-	ENST00000371432	RUNX2	chr6	45459677	+	7396	2805	302	3619	1105
ENST00000399804	SCAF4	chr21	33057361	-	ENST00000359524	RUNX2	chr6	45459677	+	7460	2805	302	3685	1127
ENST00000286835	SCAF4	chr21	33057361	-	ENST00000541979	RUNX2	chr6	45459677	+	3686	2871	302	3685	1128
ENST00000286835	SCAF4	chr21	33057361	-	ENST00000465038	RUNX2	chr6	45459677	+	3752	2871	302	3751	1150
ENST00000286835	SCAF4	chr21	33057361	-	ENST00000352853	RUNX2	chr6	45459677	+	3752	2871	302	3751	1150
ENST00000286835	SCAF4	chr21	33057361	-	ENST00000371438	RUNX2	chr6	45459677	+	7526	2871	302	3751	1149
ENST00000286835	SCAF4	chr21	33057361	-	ENST00000371436	RUNX2	chr6	45459677	+	3774	2871	302	3685	1127
ENST00000286835	SCAF4	chr21	33057361	-	ENST00000576263	RUNX2	chr6	45459677	+	4442	2871	302	3814	1170
ENST00000286835	SCAF4	chr21	33057361	-	ENST00000371432	RUNX2	chr6	45459677	+	7462	2871	302	3685	1127
ENST00000286835	SCAF4	chr21	33057361	-	ENST00000359524	RUNX2	chr6	45459677	+	7526	2871	302	3751	1149
ENST00000434667	SCAF4	chr21	33057361	-	ENST00000541979	RUNX2	chr6	45459677	+	3534	2719	195	3533	1112
ENST00000434667	SCAF4	chr21	33057361	-	ENST00000465038	RUNX2	chr6	45459677	+	3600	2719	195	3599	1134
ENST00000434667	SCAF4	chr21	33057361	-	ENST00000352853	RUNX2	chr6	45459677	+	3600	2719	195	3599	1134
ENST00000434667	SCAF4	chr21	33057361	-	ENST00000371438	RUNX2	chr6	45459677	+	7374	2719	195	3599	1134
ENST00000434667	SCAF4	chr21	33057361	-	ENST00000371436	RUNX2	chr6	45459677	+	3622	2719	195	3533	1112
ENST00000434667	SCAF4	chr21	33057361	-	ENST00000576263	RUNX2	chr6	45459677	+	4290	2719	195	3662	1155
ENST00000434667	SCAF4	chr21	33057361	-	ENST00000371432	RUNX2	chr6	45459677	+	7310	2719	195	3533	1112
ENST00000434667	SCAF4	chr21	33057361	-	ENST00000359524	RUNX2	chr6	45459677	+	7374	2719	195	3599	1134

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000399804	ENST00000541979	SCAF4	chr21	33057361	-	RUNX2	chr6	45459677	+	0.001615035	0.99838495
ENST00000399804	ENST00000465038	SCAF4	chr21	33057361	-	RUNX2	chr6	45459677	+	0.002093842	0.9979062
ENST00000399804	ENST00000352853	SCAF4	chr21	33057361	-	RUNX2	chr6	45459677	+	0.002093842	0.9979062
ENST00000399804	ENST00000371438	SCAF4	chr21	33057361	-	RUNX2	chr6	45459677	+	0.00043641	0.99956363
ENST00000399804	ENST00000371436	SCAF4	chr21	33057361	-	RUNX2	chr6	45459677	+	0.001515519	0.99848455
ENST00000399804	ENST00000576263	SCAF4	chr21	33057361	-	RUNX2	chr6	45459677	+	0.002394389	0.99760556
ENST00000399804	ENST00000371432	SCAF4	chr21	33057361	-	RUNX2	chr6	45459677	+	0.000289683	0.99971026
ENST00000399804	ENST00000359524	SCAF4	chr21	33057361	-	RUNX2	chr6	45459677	+	0.00043641	0.99956363
ENST00000286835	ENST00000541979	SCAF4	chr21	33057361	-	RUNX2	chr6	45459677	+	0.001824016	0.998176
ENST00000286835	ENST00000465038	SCAF4	chr21	33057361	-	RUNX2	chr6	45459677	+	0.001805917	0.99819404
ENST00000286835	ENST00000352853	SCAF4	chr21	33057361	-	RUNX2	chr6	45459677	+	0.001805917	0.99819404
ENST00000286835	ENST00000371438	SCAF4	chr21	33057361	-	RUNX2	chr6	45459677	+	0.000384847	0.9996151
ENST00000286835	ENST00000371436	SCAF4	chr21	33057361	-	RUNX2	chr6	45459677	+	0.001721438	0.9982786
ENST00000286835	ENST00000576263	SCAF4	chr21	33057361	-	RUNX2	chr6	45459677	+	0.002229892	0.9977702
ENST00000286835	ENST00000371432	SCAF4	chr21	33057361	-	RUNX2	chr6	45459677	+	0.000393686	0.9996063
ENST00000286835	ENST00000359524	SCAF4	chr21	33057361	-	RUNX2	chr6	45459677	+	0.000384847	0.9996151
ENST00000434667	ENST00000541979	SCAF4	chr21	33057361	-	RUNX2	chr6	45459677	+	0.001558067	0.998442
ENST00000434667	ENST00000465038	SCAF4	chr21	33057361	-	RUNX2	chr6	45459677	+	0.001566344	0.99843365
ENST00000434667	ENST00000352853	SCAF4	chr21	33057361	-	RUNX2	chr6	45459677	+	0.001566344	0.99843365
ENST00000434667	ENST00000371438	SCAF4	chr21	33057361	-	RUNX2	chr6	45459677	+	0.000334849	0.99966514
ENST00000434667	ENST00000371436	SCAF4	chr21	33057361	-	RUNX2	chr6	45459677	+	0.001475055	0.99852496
ENST00000434667	ENST00000576263	SCAF4	chr21	33057361	-	RUNX2	chr6	45459677	+	0.001941688	0.99805826
ENST00000434667	ENST00000371432	SCAF4	chr21	33057361	-	RUNX2	chr6	45459677	+	0.000338926	0.9996611
ENST00000434667	ENST00000359524	SCAF4	chr21	33057361	-	RUNX2	chr6	45459677	+	0.000334849	0.99966514

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for SCAF4-RUNX2

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
SCAF4	chr21	33057361	RUNX2	chr6	45459677	2719	841	LPTPPVTQPVSLLGHRQKLDDSKPSL
SCAF4	chr21	33057361	RUNX2	chr6	45459677	2805	834	LPTPPVTQPVSLLGHRQKLDDSKPSL
SCAF4	chr21	33057361	RUNX2	chr6	45459677	2871	856	LPTPPVTQPVSLLGHRQKLDDSKPSL

Top

Potential FusionNeoAntigen Information of SCAF4-RUNX2 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

SCAF4-RUNX2_33057361_45459677.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
SCAF4-RUNX2	chr21	33057361	chr6	45459677	2871	HLA-A30:08	VSLLGHRQK	0.9516	0.5853	9	18
SCAF4-RUNX2	chr21	33057361	chr6	45459677	2871	HLA-A02:13	SLLGHRQKL	0.9144	0.6586	10	19
SCAF4-RUNX2	chr21	33057361	chr6	45459677	2871	HLA-A02:27	SLLGHRQKL	0.9106	0.5829	10	19
SCAF4-RUNX2	chr21	33057361	chr6	45459677	2871	HLA-A02:11	SLLGHRQKL	0.9084	0.5999	10	19
SCAF4-RUNX2	chr21	33057361	chr6	45459677	2871	HLA-A02:24	SLLGHRQKL	0.9055	0.5704	10	19
SCAF4-RUNX2	chr21	33057361	chr6	45459677	2871	HLA-A02:30	SLLGHRQKL	0.9055	0.5704	10	19
SCAF4-RUNX2	chr21	33057361	chr6	45459677	2871	HLA-A02:67	SLLGHRQKL	0.9055	0.5704	10	19
SCAF4-RUNX2	chr21	33057361	chr6	45459677	2871	HLA-A02:38	SLLGHRQKL	0.8675	0.634	10	19
SCAF4-RUNX2	chr21	33057361	chr6	45459677	2871	HLA-A02:35	SLLGHRQKL	0.7828	0.5928	10	19
SCAF4-RUNX2	chr21	33057361	chr6	45459677	2871	HLA-A02:29	SLLGHRQKL	0.755	0.5757	10	19
SCAF4-RUNX2	chr21	33057361	chr6	45459677	2871	HLA-A02:20	SLLGHRQKL	0.7441	0.5732	10	19
SCAF4-RUNX2	chr21	33057361	chr6	45459677	2871	HLA-B13:01	SLLGHRQKL	0.0578	0.8153	10	19
SCAF4-RUNX2	chr21	33057361	chr6	45459677	2871	HLA-A02:01	SLLGHRQKL	0.9055	0.5704	10	19
SCAF4-RUNX2	chr21	33057361	chr6	45459677	2871	HLA-C07:29	SLLGHRQKL	0.3639	0.9434	10	19
SCAF4-RUNX2	chr21	33057361	chr6	45459677	2871	HLA-C01:30	SLLGHRQKL	0.0139	0.933	10	19
SCAF4-RUNX2	chr21	33057361	chr6	45459677	2871	HLA-A02:03	SLLGHRQKL	0.9567	0.5884	10	19
SCAF4-RUNX2	chr21	33057361	chr6	45459677	2871	HLA-A30:01	VSLLGHRQK	0.9539	0.6966	9	18
SCAF4-RUNX2	chr21	33057361	chr6	45459677	2871	HLA-B08:12	SLLGHRQKL	0.6941	0.5089	10	19
SCAF4-RUNX2	chr21	33057361	chr6	45459677	2871	HLA-C06:06	SLLGHRQKL	0.6266	0.9847	10	19
SCAF4-RUNX2	chr21	33057361	chr6	45459677	2871	HLA-C07:04	SLLGHRQKL	0.5683	0.9543	10	19
SCAF4-RUNX2	chr21	33057361	chr6	45459677	2871	HLA-C03:67	SLLGHRQKL	0.3865	0.9687	10	19
SCAF4-RUNX2	chr21	33057361	chr6	45459677	2871	HLA-B15:73	SLLGHRQKL	0.1348	0.8338	10	19
SCAF4-RUNX2	chr21	33057361	chr6	45459677	2871	HLA-C01:02	SLLGHRQKL	0.1324	0.9302	10	19
SCAF4-RUNX2	chr21	33057361	chr6	45459677	2871	HLA-B15:30	SLLGHRQKL	0.1036	0.6361	10	19
SCAF4-RUNX2	chr21	33057361	chr6	45459677	2871	HLA-B07:13	SLLGHRQKL	0.0156	0.7505	10	19

Top

Potential FusionNeoAntigen Information of SCAF4-RUNX2 in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of SCAF4-RUNX2

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
9577	TQPVSLLGHRQKLD	SCAF4	RUNX2	chr21	33057361	chr6	45459677	2871

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of SCAF4-RUNX2

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	9577	TQPVSLLGHRQKLD	-7.9962	-8.1096
HLA-B14:02	3BVN	9577	TQPVSLLGHRQKLD	-5.70842	-6.74372
HLA-B52:01	3W39	9577	TQPVSLLGHRQKLD	-6.83737	-6.95077
HLA-B52:01	3W39	9577	TQPVSLLGHRQKLD	-4.4836	-5.5189
HLA-A11:01	4UQ2	9577	TQPVSLLGHRQKLD	-10.0067	-10.1201
HLA-A11:01	4UQ2	9577	TQPVSLLGHRQKLD	-9.03915	-10.0745
HLA-A24:02	5HGA	9577	TQPVSLLGHRQKLD	-6.56204	-6.67544
HLA-A24:02	5HGA	9577	TQPVSLLGHRQKLD	-5.42271	-6.45801
HLA-B44:05	3DX8	9577	TQPVSLLGHRQKLD	-7.85648	-8.89178
HLA-B44:05	3DX8	9577	TQPVSLLGHRQKLD	-5.3978	-5.5112
HLA-A02:01	6TDR	9577	TQPVSLLGHRQKLD	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of SCAF4-RUNX2

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
SCAF4-RUNX2	chr21	33057361	chr6	45459677	10	19	SLLGHRQKL	CACTTCTTGGGCACAGACAGAAGCTTG
SCAF4-RUNX2	chr21	33057361	chr6	45459677	9	18	VSLLGHRQK	TTTCACTTCTTGGGCACAGACAGAAGC

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of SCAF4-RUNX2

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
STAD	SCAF4-RUNX2	chr21	33057361	ENST00000286835	chr6	45459677	ENST00000352853	TCGA-CD-A4MI

Top

Potential target of CAR-T therapy development for SCAF4-RUNX2

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to SCAF4-RUNX2

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to SCAF4-RUNX2

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)