Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:SEP15-CLTC

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: SEP15-CLTC
	FusionPDB ID: 80444
	FusionGDB2.0 ID: 80444
		Hgene	Tgene
	Gene symbol	SEP15	CLTC
	Gene ID	9403	1213
	Gene name	selenoprotein F	clathrin heavy chain
	Synonyms	SEP15	CHC\|CHC17\|CLH-17\|CLTCL2\|Hc\|MRD56
	Cytomap	1p22.3	17q23.1
	Type of gene	protein-coding	protein-coding
	Description	selenoprotein F15 kDa selenoprotein	clathrin heavy chain 1clathrin heavy chain on chromosome 17clathrin, heavy polypeptide (Hc)clathrin, heavy polypeptide-like 2
	Modification date	20200313	20200313
	UniProtAcc	.	P53675 Main function of 5'-partner protein: FUNCTION: Clathrin is the major protein of the polyhedral coat of coated pits and vesicles. Two different adapter protein complexes link the clathrin lattice either to the plasma membrane or to the trans-Golgi network (By similarity). {ECO:0000250}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000331835, ENST00000370554, ENST00000401030, ENST00000469566,	ENST00000579815, ENST00000269122, ENST00000393043, ENST00000579456,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	5 X 5 X 3=75	18 X 18 X 8=2592
	# samples	6	22
	** MAII score	log2(6/75*10)=-0.321928094887362 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(22/2592*10)=-3.55849028935997 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: SEP15 [Title/Abstract] AND CLTC [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: SEP15 [Title/Abstract] AND CLTC [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	SEP15(87368963)-CLTC(57760267), # samples:1
Anticipated loss of major functional domain due to fusion event.	SEP15-CLTC seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. SEP15-CLTC seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. SEP15-CLTC seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. SEP15-CLTC seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Tgene	CLTC	GO:1900126	negative regulation of hyaluronan biosynthetic process	24251095

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr1:87368963/chr17:57760267)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across SEP15 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across CLTC (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000331835	SEP15	chr1	87368963	-	ENST00000393043	CLTC	chr17	57760267	+	1759	506	245	1660	471
ENST00000331835	SEP15	chr1	87368963	-	ENST00000269122	CLTC	chr17	57760267	+	4227	506	245	1768	507
ENST00000331835	SEP15	chr1	87368963	-	ENST00000579456	CLTC	chr17	57760267	+	2031	506	245	1768	507
ENST00000370554	SEP15	chr1	87368963	-	ENST00000393043	CLTC	chr17	57760267	+	1528	275	14	1429	471
ENST00000370554	SEP15	chr1	87368963	-	ENST00000269122	CLTC	chr17	57760267	+	3996	275	14	1537	507
ENST00000370554	SEP15	chr1	87368963	-	ENST00000579456	CLTC	chr17	57760267	+	1800	275	14	1537	507
ENST00000401030	SEP15	chr1	87368963	-	ENST00000393043	CLTC	chr17	57760267	+	1520	267	6	1421	471
ENST00000401030	SEP15	chr1	87368963	-	ENST00000269122	CLTC	chr17	57760267	+	3988	267	6	1529	507
ENST00000401030	SEP15	chr1	87368963	-	ENST00000579456	CLTC	chr17	57760267	+	1792	267	6	1529	507

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000331835	ENST00000393043	SEP15	chr1	87368963	-	CLTC	chr17	57760267	+	0.001441004	0.99855906
ENST00000331835	ENST00000269122	SEP15	chr1	87368963	-	CLTC	chr17	57760267	+	0.00027966	0.9997203
ENST00000331835	ENST00000579456	SEP15	chr1	87368963	-	CLTC	chr17	57760267	+	0.000889539	0.9991104
ENST00000370554	ENST00000393043	SEP15	chr1	87368963	-	CLTC	chr17	57760267	+	0.001858855	0.99814117
ENST00000370554	ENST00000269122	SEP15	chr1	87368963	-	CLTC	chr17	57760267	+	0.000298824	0.9997012
ENST00000370554	ENST00000579456	SEP15	chr1	87368963	-	CLTC	chr17	57760267	+	0.001174904	0.99882513
ENST00000401030	ENST00000393043	SEP15	chr1	87368963	-	CLTC	chr17	57760267	+	0.001797395	0.99820256
ENST00000401030	ENST00000269122	SEP15	chr1	87368963	-	CLTC	chr17	57760267	+	0.000291259	0.9997087
ENST00000401030	ENST00000579456	SEP15	chr1	87368963	-	CLTC	chr17	57760267	+	0.001094161	0.9989058

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for SEP15-CLTC

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
SEP15	chr1	87368963	CLTC	chr17	57760267	267	87	GCCQEEAQFETKKVCFACVDGKEFRL
SEP15	chr1	87368963	CLTC	chr17	57760267	275	87	GCCQEEAQFETKKVCFACVDGKEFRL
SEP15	chr1	87368963	CLTC	chr17	57760267	506	87	GCCQEEAQFETKKVCFACVDGKEFRL

Top

Potential FusionNeoAntigen Information of SEP15-CLTC in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

SEP15-CLTC_87368963_57760267.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
SEP15-CLTC	chr1	87368963	chr17	57760267	506	HLA-B13:02	AQFETKKV	0.9975	0.7875	6	14
SEP15-CLTC	chr1	87368963	chr17	57760267	506	HLA-B18:01	FETKKVCF	0.9965	0.7089	8	16
SEP15-CLTC	chr1	87368963	chr17	57760267	506	HLA-B52:01	AQFETKKV	0.8771	0.9774	6	14
SEP15-CLTC	chr1	87368963	chr17	57760267	506	HLA-B50:01	AQFETKKVC	0.1878	0.7198	6	15
SEP15-CLTC	chr1	87368963	chr17	57760267	506	HLA-B50:01	FETKKVCFA	0.0187	0.5671	8	17
SEP15-CLTC	chr1	87368963	chr17	57760267	506	HLA-B15:01	AQFETKKVCF	0.9994	0.8566	6	16
SEP15-CLTC	chr1	87368963	chr17	57760267	506	HLA-B15:25	AQFETKKVCF	0.9549	0.9065	6	16
SEP15-CLTC	chr1	87368963	chr17	57760267	506	HLA-B15:03	AQFETKKVCF	0.9429	0.7958	6	16
SEP15-CLTC	chr1	87368963	chr17	57760267	506	HLA-B13:01	AQFETKKVCF	0.9012	0.9363	6	16
SEP15-CLTC	chr1	87368963	chr17	57760267	506	HLA-B15:04	AQFETKKVC	0.5817	0.8492	6	15
SEP15-CLTC	chr1	87368963	chr17	57760267	506	HLA-C04:07	QFETKKVCF	0.5472	0.8321	7	16
SEP15-CLTC	chr1	87368963	chr17	57760267	506	HLA-C04:10	QFETKKVCF	0.5383	0.8177	7	16
SEP15-CLTC	chr1	87368963	chr17	57760267	506	HLA-B15:07	AQFETKKVCF	0.9961	0.6853	6	16
SEP15-CLTC	chr1	87368963	chr17	57760267	506	HLA-B15:04	AQFETKKVCF	0.9937	0.8823	6	16
SEP15-CLTC	chr1	87368963	chr17	57760267	506	HLA-B15:05	AQFETKKVCF	0.812	0.891	6	16
SEP15-CLTC	chr1	87368963	chr17	57760267	506	HLA-B18:06	FETKKVCF	0.9971	0.7056	8	16
SEP15-CLTC	chr1	87368963	chr17	57760267	506	HLA-B18:08	FETKKVCF	0.9967	0.5934	8	16
SEP15-CLTC	chr1	87368963	chr17	57760267	506	HLA-B18:05	FETKKVCF	0.9965	0.7089	8	16
SEP15-CLTC	chr1	87368963	chr17	57760267	506	HLA-B18:03	FETKKVCF	0.9951	0.6933	8	16
SEP15-CLTC	chr1	87368963	chr17	57760267	506	HLA-B18:11	FETKKVCF	0.9933	0.6864	8	16
SEP15-CLTC	chr1	87368963	chr17	57760267	506	HLA-C04:01	QFETKKVCF	0.5472	0.8321	7	16
SEP15-CLTC	chr1	87368963	chr17	57760267	506	HLA-C18:01	QFETKKVCF	0.5378	0.8338	7	16
SEP15-CLTC	chr1	87368963	chr17	57760267	506	HLA-B08:12	QFETKKVCF	0.3524	0.8081	7	16
SEP15-CLTC	chr1	87368963	chr17	57760267	506	HLA-B50:05	AQFETKKVC	0.1878	0.7198	6	15
SEP15-CLTC	chr1	87368963	chr17	57760267	506	HLA-B50:04	AQFETKKVC	0.1878	0.7198	6	15
SEP15-CLTC	chr1	87368963	chr17	57760267	506	HLA-B50:04	FETKKVCFA	0.0187	0.5671	8	17
SEP15-CLTC	chr1	87368963	chr17	57760267	506	HLA-B50:05	FETKKVCFA	0.0187	0.5671	8	17
SEP15-CLTC	chr1	87368963	chr17	57760267	506	HLA-B15:135	AQFETKKVCF	0.9995	0.8461	6	16
SEP15-CLTC	chr1	87368963	chr17	57760267	506	HLA-B15:27	AQFETKKVCF	0.9994	0.8646	6	16
SEP15-CLTC	chr1	87368963	chr17	57760267	506	HLA-B15:34	AQFETKKVCF	0.9994	0.8566	6	16
SEP15-CLTC	chr1	87368963	chr17	57760267	506	HLA-B15:24	AQFETKKVCF	0.9994	0.8458	6	16
SEP15-CLTC	chr1	87368963	chr17	57760267	506	HLA-B15:33	AQFETKKVCF	0.9994	0.8566	6	16
SEP15-CLTC	chr1	87368963	chr17	57760267	506	HLA-B15:125	AQFETKKVCF	0.9994	0.8566	6	16
SEP15-CLTC	chr1	87368963	chr17	57760267	506	HLA-B15:50	AQFETKKVCF	0.9992	0.9068	6	16
SEP15-CLTC	chr1	87368963	chr17	57760267	506	HLA-B15:53	AQFETKKVCF	0.9977	0.8251	6	16
SEP15-CLTC	chr1	87368963	chr17	57760267	506	HLA-B15:68	AQFETKKVCF	0.9966	0.5832	6	16
SEP15-CLTC	chr1	87368963	chr17	57760267	506	HLA-B15:35	AQFETKKVCF	0.9931	0.8589	6	16
SEP15-CLTC	chr1	87368963	chr17	57760267	506	HLA-B15:12	AQFETKKVCF	0.9914	0.8315	6	16
SEP15-CLTC	chr1	87368963	chr17	57760267	506	HLA-B15:54	AQFETKKVCF	0.984	0.8043	6	16
SEP15-CLTC	chr1	87368963	chr17	57760267	506	HLA-B15:73	AQFETKKVCF	0.9838	0.9463	6	16
SEP15-CLTC	chr1	87368963	chr17	57760267	506	HLA-B15:30	AQFETKKVCF	0.9774	0.8718	6	16
SEP15-CLTC	chr1	87368963	chr17	57760267	506	HLA-B15:39	AQFETKKVCF	0.9583	0.837	6	16
SEP15-CLTC	chr1	87368963	chr17	57760267	506	HLA-B48:02	AQFETKKVCF	0.8874	0.9096	6	16
SEP15-CLTC	chr1	87368963	chr17	57760267	506	HLA-B15:20	AQFETKKVCF	0.815	0.9202	6	16
SEP15-CLTC	chr1	87368963	chr17	57760267	506	HLA-B35:28	AQFETKKVCF	0.8011	0.9226	6	16

Top

Potential FusionNeoAntigen Information of SEP15-CLTC in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of SEP15-CLTC

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
514	AQFETKKVCFACVD	SEP15	CLTC	chr1	87368963	chr17	57760267	506

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of SEP15-CLTC

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	514	AQFETKKVCFACVD	-7.9962	-8.1096
HLA-B14:02	3BVN	514	AQFETKKVCFACVD	-5.70842	-6.74372
HLA-B52:01	3W39	514	AQFETKKVCFACVD	-6.83737	-6.95077
HLA-B52:01	3W39	514	AQFETKKVCFACVD	-4.4836	-5.5189
HLA-A11:01	4UQ2	514	AQFETKKVCFACVD	-10.0067	-10.1201
HLA-A11:01	4UQ2	514	AQFETKKVCFACVD	-9.03915	-10.0745
HLA-A24:02	5HGA	514	AQFETKKVCFACVD	-6.56204	-6.67544
HLA-A24:02	5HGA	514	AQFETKKVCFACVD	-5.42271	-6.45801
HLA-B44:05	3DX8	514	AQFETKKVCFACVD	-7.85648	-8.89178
HLA-B44:05	3DX8	514	AQFETKKVCFACVD	-5.3978	-5.5112
HLA-A02:01	6TDR	514	AQFETKKVCFACVD	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of SEP15-CLTC

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
SEP15-CLTC	chr1	87368963	chr17	57760267	6	14	AQFETKKV	GCACAATTTGAAACCAAAAAGGTC
SEP15-CLTC	chr1	87368963	chr17	57760267	6	15	AQFETKKVC	GCACAATTTGAAACCAAAAAGGTCTGC
SEP15-CLTC	chr1	87368963	chr17	57760267	6	16	AQFETKKVCF	GCACAATTTGAAACCAAAAAGGTCTGCTTC
SEP15-CLTC	chr1	87368963	chr17	57760267	7	16	QFETKKVCF	CAATTTGAAACCAAAAAGGTCTGCTTC
SEP15-CLTC	chr1	87368963	chr17	57760267	8	16	FETKKVCF	TTTGAAACCAAAAAGGTCTGCTTC
SEP15-CLTC	chr1	87368963	chr17	57760267	8	17	FETKKVCFA	TTTGAAACCAAAAAGGTCTGCTTCGCC

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of SEP15-CLTC

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
ESCA	SEP15-CLTC	chr1	87368963	ENST00000331835	chr17	57760267	ENST00000269122	TCGA-L5-A8NK

Top

Potential target of CAR-T therapy development for SEP15-CLTC

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to SEP15-CLTC

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to SEP15-CLTC

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner	Gene	Disease ID	Disease name	# pubmeds	Source
Tgene	CLTC	C4518356	MiT family translocation renal cell carcinoma	2	ORPHANET
Tgene	CLTC	C4693389	MENTAL RETARDATION, AUTOSOMAL DOMINANT 56	2	GENOMICS_ENGLAND;UNIPROT
Tgene	CLTC	C0079744	Diffuse Large B-Cell Lymphoma	1	CTD_human
Tgene	CLTC	C0334121	Inflammatory Myofibroblastic Tumor	1	ORPHANET

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)