Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:SET-UTP11L

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: SET-UTP11L
	FusionPDB ID: 80972
	FusionGDB2.0 ID: 80972
		Hgene	Tgene
	Gene symbol	SET	UTP11L
	Gene ID	6418	51118
	Gene name	SET nuclear proto-oncogene	UTP11 small subunit processome component
	Synonyms	2PP2A\|I2PP2A\|IGAAD\|IPP2A2\|MRD58\|PHAPII\|TAF-I\|TAF-IBETA	CGI-94\|CGI94\|UTP11L
	Cytomap	9q34.11	1p34.3
	Type of gene	protein-coding	protein-coding
	Description	protein SETHLA-DR-associated protein IISET nuclear oncogeneSET translocation (myeloid leukemia-associated)Template-Activating Factor-I, chromatin remodelling factorchromatin remodelling factorinhibitor of granzyme A-activated DNaseinhibitor-2 of pr	probable U3 small nucleolar RNA-associated protein 11U3 snoRNA-associated protein 11UTP11, small subunit processome component homologUTP11-like proteinUTP11-like, U3 small nucleolar ribonucleoprotein
	Modification date	20200313	20200313
	UniProtAcc	Q9BYW2 Main function of 5'-partner protein: FUNCTION: Histone methyltransferase that specifically trimethylates 'Lys-36' of histone H3 (H3K36me3) using dimethylated 'Lys-36' (H3K36me2) as substrate (PubMed:16118227, PubMed:19141475, PubMed:21526191, PubMed:21792193, PubMed:23043551, PubMed:27474439). It is capable of trimethylating unmethylated H3K36 (H3K36me0) in vitro (PubMed:19332550). Represents the main enzyme generating H3K36me3, a specific tag for epigenetic transcriptional activation (By similarity). Plays a role in chromatin structure modulation during elongation by coordinating recruitment of the FACT complex and by interacting with hyperphosphorylated POLR2A (PubMed:23325844). Acts as a key regulator of DNA mismatch repair in G1 and early S phase by generating H3K36me3, a mark required to recruit MSH6 subunit of the MutS alpha complex: early recruitment of the MutS alpha complex to chromatin to be replicated allows a quick identification of mismatch DNA to initiate the mismatch repair reaction (PubMed:23622243). Required for DNA double-strand break repair in response to DNA damage: acts by mediating formation of H3K36me3, promoting recruitment of RAD51 and DNA repair via homologous recombination (HR) (PubMed:24843002). Acts as a tumor suppressor (PubMed:24509477). H3K36me3 also plays an essential role in the maintenance of a heterochromatic state, by recruiting DNA methyltransferase DNMT3A (PubMed:27317772). H3K36me3 is also enhanced in intron-containing genes, suggesting that SETD2 recruitment is enhanced by splicing and that splicing is coupled to recruitment of elongating RNA polymerase (PubMed:21792193). Required during angiogenesis (By similarity). Required for endoderm development by promoting embryonic stem cell differentiation toward endoderm: acts by mediating formation of H3K36me3 in distal promoter regions of FGFR3, leading to regulate transcription initiation of FGFR3 (By similarity). In addition to histones, also mediates methylation of other proteins, such as tubulins and STAT1 (PubMed:27518565, PubMed:28753426). Trimethylates 'Lys-40' of alpha-tubulins such as TUBA1B (alpha-TubK40me3); alpha-TubK40me3 is required for normal mitosis and cytokinesis and may be a specific tag in cytoskeletal remodeling (PubMed:27518565). Involved in interferon-alpha-induced antiviral defense by mediating both monomethylation of STAT1 at 'Lys-525' and catalyzing H3K36me3 on promoters of some interferon-stimulated genes (ISGs) to activate gene transcription (PubMed:28753426). {ECO:0000250\|UniProtKB:E9Q5F9, ECO:0000269\|PubMed:16118227, ECO:0000269\|PubMed:19141475, ECO:0000269\|PubMed:21526191, ECO:0000269\|PubMed:21792193, ECO:0000269\|PubMed:23043551, ECO:0000269\|PubMed:23325844, ECO:0000269\|PubMed:23622243, ECO:0000269\|PubMed:24509477, ECO:0000269\|PubMed:24843002, ECO:0000269\|PubMed:27317772, ECO:0000269\|PubMed:27474439, ECO:0000269\|PubMed:27518565, ECO:0000269\|PubMed:28753426}.; FUNCTION: (Microbial infection) Recruited to the promoters of adenovirus 12 E1A gene in case of infection, possibly leading to regulate its expression. {ECO:0000269\|PubMed:11461154}.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000477806, ENST00000322030, ENST00000372688, ENST00000372692, ENST00000409104,	ENST00000373014, ENST00000537711, ENST00000488453,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	16 X 14 X 3=672	3 X 3 X 3=27
	# samples	17	4
	** MAII score	log2(17/672*10)=-1.98292648664106 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(4/27*10)=0.567040592723894 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0
Fusion gene context	PubMed: SET [Title/Abstract] AND UTP11L [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: SET [Title/Abstract] AND UTP11L [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	SET(131453506)-UTP11L(38483340), # samples:1
Anticipated loss of major functional domain due to fusion event.	SET-UTP11L seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. SET-UTP11L seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	SET	GO:0045892	negative regulation of transcription, DNA-templated	19343227

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr9:131453506/chr1:38483340)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across SET (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across UTP11L (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000372692	SET	chr9	131453506	+	ENST00000373014	UTP11L	chr1	38483340	+	2244	411	241	1047	268
ENST00000372692	SET	chr9	131453506	+	ENST00000537711	UTP11L	chr1	38483340	+	1137	411	241	732	163
ENST00000409104	SET	chr9	131453506	+	ENST00000373014	UTP11L	chr1	38483340	+	2022	189	85	825	246
ENST00000409104	SET	chr9	131453506	+	ENST00000537711	UTP11L	chr1	38483340	+	915	189	85	510	141
ENST00000322030	SET	chr9	131453506	+	ENST00000373014	UTP11L	chr1	38483340	+	2321	488	357	1124	255
ENST00000322030	SET	chr9	131453506	+	ENST00000537711	UTP11L	chr1	38483340	+	1214	488	487	2	162
ENST00000372688	SET	chr9	131453506	+	ENST00000373014	UTP11L	chr1	38483340	+	1931	98	0	734	244
ENST00000372688	SET	chr9	131453506	+	ENST00000537711	UTP11L	chr1	38483340	+	824	98	0	419	139

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000372692	ENST00000373014	SET	chr9	131453506	+	UTP11L	chr1	38483340	+	0.000772628	0.9992274
ENST00000372692	ENST00000537711	SET	chr9	131453506	+	UTP11L	chr1	38483340	+	0.006297492	0.99370253
ENST00000409104	ENST00000373014	SET	chr9	131453506	+	UTP11L	chr1	38483340	+	0.001009723	0.99899024
ENST00000409104	ENST00000537711	SET	chr9	131453506	+	UTP11L	chr1	38483340	+	0.011314304	0.9886857
ENST00000322030	ENST00000373014	SET	chr9	131453506	+	UTP11L	chr1	38483340	+	0.000995171	0.9990049
ENST00000322030	ENST00000537711	SET	chr9	131453506	+	UTP11L	chr1	38483340	+	0.005525249	0.9944747
ENST00000372688	ENST00000373014	SET	chr9	131453506	+	UTP11L	chr1	38483340	+	0.00045038	0.99954957
ENST00000372688	ENST00000537711	SET	chr9	131453506	+	UTP11L	chr1	38483340	+	0.005454534	0.99454546

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for SET-UTP11L

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
SET	chr9	131453506	UTP11L	chr1	38483340	189	34	AIEHIDEVQNEIDSDYRKKQEYLKAL
SET	chr9	131453506	UTP11L	chr1	38483340	411	56	AIEHIDEVQNEIDSDYRKKQEYLKAL
SET	chr9	131453506	UTP11L	chr1	38483340	488	43	AIEHIDEVQNEIDSDYRKKQEYLKAL
SET	chr9	131453506	UTP11L	chr1	38483340	98	32	AIEHIDEVQNEIDSDYRKKQEYLKAL

Top

Potential FusionNeoAntigen Information of SET-UTP11L in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

SET-UTP11L_131453506_38483340.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
SET-UTP11L	chr9	131453506	chr1	38483340	488	HLA-B15:01	VQNEIDSDY	0.9972	0.7357	7	16
SET-UTP11L	chr9	131453506	chr1	38483340	488	HLA-B15:25	VQNEIDSDY	0.8267	0.809	7	16
SET-UTP11L	chr9	131453506	chr1	38483340	488	HLA-B15:02	VQNEIDSDY	0.7352	0.8223	7	16
SET-UTP11L	chr9	131453506	chr1	38483340	488	HLA-B15:03	VQNEIDSDY	0.1838	0.5279	7	16
SET-UTP11L	chr9	131453506	chr1	38483340	488	HLA-B18:01	DEVQNEIDSDY	0.9822	0.8366	5	16
SET-UTP11L	chr9	131453506	chr1	38483340	488	HLA-B15:04	VQNEIDSDY	0.8691	0.7748	7	16
SET-UTP11L	chr9	131453506	chr1	38483340	488	HLA-B15:05	VQNEIDSDY	0.7387	0.7693	7	16
SET-UTP11L	chr9	131453506	chr1	38483340	488	HLA-B15:21	VQNEIDSDY	0.7287	0.8125	7	16
SET-UTP11L	chr9	131453506	chr1	38483340	488	HLA-B15:31	VQNEIDSDY	0.6614	0.7735	7	16
SET-UTP11L	chr9	131453506	chr1	38483340	488	HLA-B15:31	EVQNEIDSDY	0.7927	0.5641	6	16
SET-UTP11L	chr9	131453506	chr1	38483340	488	HLA-B15:33	VQNEIDSDY	0.9972	0.7357	7	16
SET-UTP11L	chr9	131453506	chr1	38483340	488	HLA-B15:125	VQNEIDSDY	0.9972	0.7357	7	16
SET-UTP11L	chr9	131453506	chr1	38483340	488	HLA-B15:34	VQNEIDSDY	0.9972	0.7357	7	16
SET-UTP11L	chr9	131453506	chr1	38483340	488	HLA-B15:27	VQNEIDSDY	0.9971	0.7809	7	16
SET-UTP11L	chr9	131453506	chr1	38483340	488	HLA-B15:135	VQNEIDSDY	0.9968	0.7567	7	16
SET-UTP11L	chr9	131453506	chr1	38483340	488	HLA-B15:50	VQNEIDSDY	0.9953	0.7327	7	16
SET-UTP11L	chr9	131453506	chr1	38483340	488	HLA-B15:24	VQNEIDSDY	0.9775	0.8088	7	16
SET-UTP11L	chr9	131453506	chr1	38483340	488	HLA-B15:35	VQNEIDSDY	0.9567	0.6788	7	16
SET-UTP11L	chr9	131453506	chr1	38483340	488	HLA-B15:12	VQNEIDSDY	0.9414	0.7046	7	16
SET-UTP11L	chr9	131453506	chr1	38483340	488	HLA-B15:39	VQNEIDSDY	0.83	0.6274	7	16
SET-UTP11L	chr9	131453506	chr1	38483340	488	HLA-B15:53	VQNEIDSDY	0.8175	0.6344	7	16
SET-UTP11L	chr9	131453506	chr1	38483340	488	HLA-B15:20	VQNEIDSDY	0.7448	0.8225	7	16
SET-UTP11L	chr9	131453506	chr1	38483340	488	HLA-B35:28	VQNEIDSDY	0.6561	0.8239	7	16
SET-UTP11L	chr9	131453506	chr1	38483340	488	HLA-B15:54	VQNEIDSDY	0.6538	0.5954	7	16
SET-UTP11L	chr9	131453506	chr1	38483340	488	HLA-B35:20	VQNEIDSDY	0.6298	0.832	7	16
SET-UTP11L	chr9	131453506	chr1	38483340	488	HLA-B18:04	VQNEIDSDY	0.4212	0.8574	7	16
SET-UTP11L	chr9	131453506	chr1	38483340	488	HLA-B48:02	VQNEIDSDY	0.143	0.8019	7	16
SET-UTP11L	chr9	131453506	chr1	38483340	488	HLA-B35:20	EVQNEIDSDY	0.7701	0.7063	6	16
SET-UTP11L	chr9	131453506	chr1	38483340	488	HLA-B18:11	DEVQNEIDSDY	0.9826	0.6684	5	16
SET-UTP11L	chr9	131453506	chr1	38483340	488	HLA-B18:05	DEVQNEIDSDY	0.9822	0.8366	5	16

Top

Potential FusionNeoAntigen Information of SET-UTP11L in HLA II

SET-UTP11L_131453506_38483340.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-0301	VQNEIDSDYRKKQEY	7	22
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-0301	QNEIDSDYRKKQEYL	8	23
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-0301	EVQNEIDSDYRKKQE	6	21
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-0307	VQNEIDSDYRKKQEY	7	22
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-0307	QNEIDSDYRKKQEYL	8	23
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-0307	EVQNEIDSDYRKKQE	6	21
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-0310	VQNEIDSDYRKKQEY	7	22
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-0313	VQNEIDSDYRKKQEY	7	22
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-0313	QNEIDSDYRKKQEYL	8	23
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-0313	EVQNEIDSDYRKKQE	6	21
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-0315	VQNEIDSDYRKKQEY	7	22
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-0315	QNEIDSDYRKKQEYL	8	23
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-0315	EVQNEIDSDYRKKQE	6	21
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-0318	VQNEIDSDYRKKQEY	7	22
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-0318	QNEIDSDYRKKQEYL	8	23
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-0318	EVQNEIDSDYRKKQE	6	21
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-0320	VQNEIDSDYRKKQEY	7	22
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-0320	QNEIDSDYRKKQEYL	8	23
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-0320	EVQNEIDSDYRKKQE	6	21
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-0322	VQNEIDSDYRKKQEY	7	22
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-0322	QNEIDSDYRKKQEYL	8	23
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-0322	EVQNEIDSDYRKKQE	6	21
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-0324	VQNEIDSDYRKKQEY	7	22
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-0324	QNEIDSDYRKKQEYL	8	23
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-0324	EVQNEIDSDYRKKQE	6	21
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-0326	VQNEIDSDYRKKQEY	7	22
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-0326	QNEIDSDYRKKQEYL	8	23
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-0328	VQNEIDSDYRKKQEY	7	22
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-0328	QNEIDSDYRKKQEYL	8	23
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-0328	EVQNEIDSDYRKKQE	6	21
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-0330	VQNEIDSDYRKKQEY	7	22
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-0330	QNEIDSDYRKKQEYL	8	23
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-0330	EVQNEIDSDYRKKQE	6	21
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-0332	VQNEIDSDYRKKQEY	7	22
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-0332	QNEIDSDYRKKQEYL	8	23
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-0332	EVQNEIDSDYRKKQE	6	21
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-0334	VQNEIDSDYRKKQEY	7	22
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-0334	QNEIDSDYRKKQEYL	8	23
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-0334	EVQNEIDSDYRKKQE	6	21
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-0336	VQNEIDSDYRKKQEY	7	22
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-0336	QNEIDSDYRKKQEYL	8	23
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-0336	EVQNEIDSDYRKKQE	6	21
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-0340	VQNEIDSDYRKKQEY	7	22
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-0340	QNEIDSDYRKKQEYL	8	23
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-0344	VQNEIDSDYRKKQEY	7	22
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-0344	QNEIDSDYRKKQEYL	8	23
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-0344	EVQNEIDSDYRKKQE	6	21
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-0346	VQNEIDSDYRKKQEY	7	22
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-0346	QNEIDSDYRKKQEYL	8	23
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-0346	EVQNEIDSDYRKKQE	6	21
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-0348	VQNEIDSDYRKKQEY	7	22
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-0348	QNEIDSDYRKKQEYL	8	23
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-0348	EVQNEIDSDYRKKQE	6	21
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-0350	VQNEIDSDYRKKQEY	7	22
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-0350	QNEIDSDYRKKQEYL	8	23
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-0350	EVQNEIDSDYRKKQE	6	21
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-0352	VQNEIDSDYRKKQEY	7	22
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-0352	QNEIDSDYRKKQEYL	8	23
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-0352	EVQNEIDSDYRKKQE	6	21
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-0354	VQNEIDSDYRKKQEY	7	22
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-0354	QNEIDSDYRKKQEYL	8	23
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-0354	EVQNEIDSDYRKKQE	6	21
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-0411	IEHIDEVQNEIDSDY	1	16
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-0411	AIEHIDEVQNEIDSD	0	15
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-0467	IEHIDEVQNEIDSDY	1	16
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-0467	AIEHIDEVQNEIDSD	0	15
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-0491	IEHIDEVQNEIDSDY	1	16
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-0491	AIEHIDEVQNEIDSD	0	15
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-1107	VQNEIDSDYRKKQEY	7	22
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-1107	QNEIDSDYRKKQEYL	8	23
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-1107	EVQNEIDSDYRKKQE	6	21
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-1179	VQNEIDSDYRKKQEY	7	22
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-1179	QNEIDSDYRKKQEYL	8	23
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-1394	VQNEIDSDYRKKQEY	7	22
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-1394	QNEIDSDYRKKQEYL	8	23
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-1394	EVQNEIDSDYRKKQE	6	21
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-1421	VQNEIDSDYRKKQEY	7	22
SET-UTP11L	chr9	131453506	chr1	38483340	488	DRB1-1421	QNEIDSDYRKKQEYL	8	23

Top

Fusion breakpoint peptide structures of SET-UTP11L

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
2233	EVQNEIDSDYRKKQ	SET	UTP11L	chr9	131453506	chr1	38483340	488

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of SET-UTP11L

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	2233	EVQNEIDSDYRKKQ	-7.9962	-8.1096
HLA-B14:02	3BVN	2233	EVQNEIDSDYRKKQ	-5.70842	-6.74372
HLA-B52:01	3W39	2233	EVQNEIDSDYRKKQ	-6.83737	-6.95077
HLA-B52:01	3W39	2233	EVQNEIDSDYRKKQ	-4.4836	-5.5189
HLA-A11:01	4UQ2	2233	EVQNEIDSDYRKKQ	-10.0067	-10.1201
HLA-A11:01	4UQ2	2233	EVQNEIDSDYRKKQ	-9.03915	-10.0745
HLA-A24:02	5HGA	2233	EVQNEIDSDYRKKQ	-6.56204	-6.67544
HLA-A24:02	5HGA	2233	EVQNEIDSDYRKKQ	-5.42271	-6.45801
HLA-B44:05	3DX8	2233	EVQNEIDSDYRKKQ	-7.85648	-8.89178
HLA-B44:05	3DX8	2233	EVQNEIDSDYRKKQ	-5.3978	-5.5112
HLA-A02:01	6TDR	2233	EVQNEIDSDYRKKQ	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of SET-UTP11L

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
SET-UTP11L	chr9	131453506	chr1	38483340	5	16	DEVQNEIDSDY	TGAAGTACAAAATGAAATAGACAGTGACTACCG
SET-UTP11L	chr9	131453506	chr1	38483340	6	16	EVQNEIDSDY	AGTACAAAATGAAATAGACAGTGACTACCG
SET-UTP11L	chr9	131453506	chr1	38483340	7	16	VQNEIDSDY	ACAAAATGAAATAGACAGTGACTACCG

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
SET-UTP11L	chr9	131453506	chr1	38483340	0	15	AIEHIDEVQNEIDSD	GATTGAACACATTGATGAAGTACAAAATGAAATAGACAGTGACTA
SET-UTP11L	chr9	131453506	chr1	38483340	1	16	IEHIDEVQNEIDSDY	TGAACACATTGATGAAGTACAAAATGAAATAGACAGTGACTACCG
SET-UTP11L	chr9	131453506	chr1	38483340	6	21	EVQNEIDSDYRKKQE	AGTACAAAATGAAATAGACAGTGACTACCGTAAAAAACAAGAATA
SET-UTP11L	chr9	131453506	chr1	38483340	7	22	VQNEIDSDYRKKQEY	ACAAAATGAAATAGACAGTGACTACCGTAAAAAACAAGAATACCT
SET-UTP11L	chr9	131453506	chr1	38483340	8	23	QNEIDSDYRKKQEYL	AAATGAAATAGACAGTGACTACCGTAAAAAACAAGAATACCTCAA

Top

Information of the samples that have these potential fusion neoantigens of SET-UTP11L

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
STAD	SET-UTP11L	chr9	131453506	ENST00000322030	chr1	38483340	ENST00000373014	TCGA-BR-8078-01A

Top

Potential target of CAR-T therapy development for SET-UTP11L

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to SET-UTP11L

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to SET-UTP11L

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)