![]() |
|||||||
|
Fusion Protein:SFRP1-ARMC5 |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: SFRP1-ARMC5 | FusionPDB ID: 81144 | FusionGDB2.0 ID: 81144 | Hgene | Tgene | Gene symbol | SFRP1 | ARMC5 | Gene ID | 6422 | 79798 |
Gene name | secreted frizzled related protein 1 | armadillo repeat containing 5 | |
Synonyms | FRP|FRP-1|FRP1|FrzA|SARP2 | AIMAH2 | |
Cytomap | 8p11.21 | 16p11.2 | |
Type of gene | protein-coding | protein-coding | |
Description | secreted frizzled-related protein 1SARP-2frizzled-related proteinsFRP-1secreted apoptosis-related protein 2 | armadillo repeat-containing protein 5 | |
Modification date | 20200313 | 20200313 | |
UniProtAcc | . | . | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000220772, ENST00000379845, | ENST00000412665, ENST00000268314, ENST00000408912, ENST00000457010, ENST00000538189, ENST00000563544, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 2 X 2 X 2=8 | 3 X 3 X 3=27 |
# samples | 2 | 4 | |
** MAII score | log2(2/8*10)=1.32192809488736 | log2(4/27*10)=0.567040592723894 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0 | |
Fusion gene context | PubMed: SFRP1 [Title/Abstract] AND ARMC5 [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: SFRP1 [Title/Abstract] AND ARMC5 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | SFRP1(41160980)-ARMC5(31473243), # samples:3 | ||
Anticipated loss of major functional domain due to fusion event. | SFRP1-ARMC5 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. SFRP1-ARMC5 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. SFRP1-ARMC5 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. SFRP1-ARMC5 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Hgene | SFRP1 | GO:0002244 | hematopoietic progenitor cell differentiation | 19778523 |
Hgene | SFRP1 | GO:0008284 | positive regulation of cell proliferation | 10980594 |
Hgene | SFRP1 | GO:0008285 | negative regulation of cell proliferation | 10347172|17443492|17994217|19277043|20208569 |
Hgene | SFRP1 | GO:0009950 | dorsal/ventral axis specification | 9192640 |
Hgene | SFRP1 | GO:0010629 | negative regulation of gene expression | 10980594 |
Hgene | SFRP1 | GO:0010719 | negative regulation of epithelial to mesenchymal transition | 19095296 |
Hgene | SFRP1 | GO:0014070 | response to organic cyclic compound | 20208569 |
Hgene | SFRP1 | GO:0030177 | positive regulation of Wnt signaling pathway | 10660608 |
Hgene | SFRP1 | GO:0030178 | negative regulation of Wnt signaling pathway | 9192640|10660608|17500071|20208569 |
Hgene | SFRP1 | GO:0030279 | negative regulation of ossification | 15677765 |
Hgene | SFRP1 | GO:0030307 | positive regulation of cell growth | 10980594|16288033 |
Hgene | SFRP1 | GO:0030308 | negative regulation of cell growth | 19569235|20208569 |
Hgene | SFRP1 | GO:0030336 | negative regulation of cell migration | 10980594 |
Hgene | SFRP1 | GO:0042493 | response to drug | 19072540|19254787 |
Hgene | SFRP1 | GO:0043065 | positive regulation of apoptotic process | 9391078|15677765 |
Hgene | SFRP1 | GO:0044344 | cellular response to fibroblast growth factor stimulus | 17500071 |
Hgene | SFRP1 | GO:0045600 | positive regulation of fat cell differentiation | 12055200|15886250 |
Hgene | SFRP1 | GO:0045892 | negative regulation of transcription, DNA-templated | 10660608|19095296|19277043|20234818 |
Hgene | SFRP1 | GO:0045893 | positive regulation of transcription, DNA-templated | 10660608|15886250|19569235 |
Hgene | SFRP1 | GO:0046676 | negative regulation of insulin secretion | 17994217 |
Hgene | SFRP1 | GO:0048147 | negative regulation of fibroblast proliferation | 19734317 |
Hgene | SFRP1 | GO:0050680 | negative regulation of epithelial cell proliferation | 19095296 |
Hgene | SFRP1 | GO:0050732 | negative regulation of peptidyl-tyrosine phosphorylation | 10980594 |
Hgene | SFRP1 | GO:0060070 | canonical Wnt signaling pathway | 18787224 |
Hgene | SFRP1 | GO:0060218 | hematopoietic stem cell differentiation | 19778523 |
Hgene | SFRP1 | GO:0060766 | negative regulation of androgen receptor signaling pathway | 19277043 |
Hgene | SFRP1 | GO:0071356 | cellular response to tumor necrosis factor | 9391078 |
Hgene | SFRP1 | GO:0071363 | cellular response to growth factor stimulus | 17500071 |
Hgene | SFRP1 | GO:0071391 | cellular response to estrogen stimulus | 18941195 |
Hgene | SFRP1 | GO:0071504 | cellular response to heparin | 17500071 |
Hgene | SFRP1 | GO:0090090 | negative regulation of canonical Wnt signaling pathway | 9391078|10347172|16149051|16288033|17443492|17471511|19095296|19277043|19569235 |
Hgene | SFRP1 | GO:0090263 | positive regulation of canonical Wnt signaling pathway | 18941195 |
Hgene | SFRP1 | GO:1902043 | positive regulation of extrinsic apoptotic signaling pathway via death domain receptors | 9391078 |
Hgene | SFRP1 | GO:2000052 | positive regulation of non-canonical Wnt signaling pathway | 19569235 |
Hgene | SFRP1 | GO:2000054 | negative regulation of Wnt signaling pathway involved in dorsal/ventral axis specification | 9192640 |
Hgene | SFRP1 | GO:2000080 | negative regulation of canonical Wnt signaling pathway involved in controlling type B pancreatic cell proliferation | 17994217 |
Hgene | SFRP1 | GO:2000270 | negative regulation of fibroblast apoptotic process | 14581477 |
Hgene | SFRP1 | GO:2000271 | positive regulation of fibroblast apoptotic process | 14581477 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr8:41160980/chr16:31473243) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000220772 | SFRP1 | chr8 | 41160980 | - | ENST00000408912 | ARMC5 | chr16 | 31473243 | + | 3509 | 960 | 233 | 3292 | 1019 |
ENST00000220772 | SFRP1 | chr8 | 41160980 | - | ENST00000457010 | ARMC5 | chr16 | 31473243 | + | 4628 | 960 | 233 | 2662 | 809 |
ENST00000220772 | SFRP1 | chr8 | 41160980 | - | ENST00000563544 | ARMC5 | chr16 | 31473243 | + | 3488 | 960 | 233 | 3292 | 1019 |
ENST00000220772 | SFRP1 | chr8 | 41160980 | - | ENST00000538189 | ARMC5 | chr16 | 31473243 | + | 3488 | 960 | 233 | 3292 | 1019 |
ENST00000220772 | SFRP1 | chr8 | 41160980 | - | ENST00000268314 | ARMC5 | chr16 | 31473243 | + | 3568 | 960 | 233 | 3292 | 1019 |
ENST00000379845 | SFRP1 | chr8 | 41160980 | - | ENST00000408912 | ARMC5 | chr16 | 31473243 | + | 2896 | 347 | 133 | 2679 | 848 |
ENST00000379845 | SFRP1 | chr8 | 41160980 | - | ENST00000457010 | ARMC5 | chr16 | 31473243 | + | 4015 | 347 | 133 | 2049 | 638 |
ENST00000379845 | SFRP1 | chr8 | 41160980 | - | ENST00000563544 | ARMC5 | chr16 | 31473243 | + | 2875 | 347 | 133 | 2679 | 848 |
ENST00000379845 | SFRP1 | chr8 | 41160980 | - | ENST00000538189 | ARMC5 | chr16 | 31473243 | + | 2875 | 347 | 133 | 2679 | 848 |
ENST00000379845 | SFRP1 | chr8 | 41160980 | - | ENST00000268314 | ARMC5 | chr16 | 31473243 | + | 2955 | 347 | 133 | 2679 | 848 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000220772 | ENST00000408912 | SFRP1 | chr8 | 41160980 | - | ARMC5 | chr16 | 31473243 | + | 0.011081562 | 0.98891836 |
ENST00000220772 | ENST00000457010 | SFRP1 | chr8 | 41160980 | - | ARMC5 | chr16 | 31473243 | + | 0.0287854 | 0.97121465 |
ENST00000220772 | ENST00000563544 | SFRP1 | chr8 | 41160980 | - | ARMC5 | chr16 | 31473243 | + | 0.010840827 | 0.98915917 |
ENST00000220772 | ENST00000538189 | SFRP1 | chr8 | 41160980 | - | ARMC5 | chr16 | 31473243 | + | 0.010840827 | 0.98915917 |
ENST00000220772 | ENST00000268314 | SFRP1 | chr8 | 41160980 | - | ARMC5 | chr16 | 31473243 | + | 0.010662294 | 0.9893377 |
ENST00000379845 | ENST00000408912 | SFRP1 | chr8 | 41160980 | - | ARMC5 | chr16 | 31473243 | + | 0.03728476 | 0.96271527 |
ENST00000379845 | ENST00000457010 | SFRP1 | chr8 | 41160980 | - | ARMC5 | chr16 | 31473243 | + | 0.20570478 | 0.79429525 |
ENST00000379845 | ENST00000563544 | SFRP1 | chr8 | 41160980 | - | ARMC5 | chr16 | 31473243 | + | 0.037349228 | 0.9626508 |
ENST00000379845 | ENST00000538189 | SFRP1 | chr8 | 41160980 | - | ARMC5 | chr16 | 31473243 | + | 0.037349228 | 0.9626508 |
ENST00000379845 | ENST00000268314 | SFRP1 | chr8 | 41160980 | - | ARMC5 | chr16 | 31473243 | + | 0.03798387 | 0.96201617 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for SFRP1-ARMC5 |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
SFRP1 | chr8 | 41160980 | ARMC5 | chr16 | 31473243 | 347 | 71 | SEAIIEHLCASEFVTILQCMKTDSIQ |
SFRP1 | chr8 | 41160980 | ARMC5 | chr16 | 31473243 | 960 | 242 | SEAIIEHLCASEFVTILQCMKTDSIQ |
Top |
Potential FusionNeoAntigen Information of SFRP1-ARMC5 in HLA I |
![]() |
SFRP1-ARMC5_41160980_31473243.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
SFRP1-ARMC5 | chr8 | 41160980 | chr16 | 31473243 | 960 | HLA-B45:01 | SEFVTILQC | 0.9857 | 0.9163 | 10 | 19 |
SFRP1-ARMC5 | chr8 | 41160980 | chr16 | 31473243 | 960 | HLA-B50:02 | SEFVTILQC | 0.9814 | 0.6229 | 10 | 19 |
SFRP1-ARMC5 | chr8 | 41160980 | chr16 | 31473243 | 960 | HLA-B41:01 | SEFVTILQC | 0.3485 | 0.9132 | 10 | 19 |
SFRP1-ARMC5 | chr8 | 41160980 | chr16 | 31473243 | 960 | HLA-B50:01 | SEFVTILQC | 0.0379 | 0.7585 | 10 | 19 |
SFRP1-ARMC5 | chr8 | 41160980 | chr16 | 31473243 | 960 | HLA-B38:01 | EHLCASEFVTI | 0.9991 | 0.9311 | 5 | 16 |
SFRP1-ARMC5 | chr8 | 41160980 | chr16 | 31473243 | 960 | HLA-B38:02 | EHLCASEFVTI | 0.999 | 0.9472 | 5 | 16 |
SFRP1-ARMC5 | chr8 | 41160980 | chr16 | 31473243 | 960 | HLA-C03:19 | CASEFVTIL | 0.9997 | 0.9903 | 8 | 17 |
SFRP1-ARMC5 | chr8 | 41160980 | chr16 | 31473243 | 960 | HLA-C03:07 | CASEFVTIL | 0.9996 | 0.9847 | 8 | 17 |
SFRP1-ARMC5 | chr8 | 41160980 | chr16 | 31473243 | 960 | HLA-C03:08 | CASEFVTIL | 0.9996 | 0.8869 | 8 | 17 |
SFRP1-ARMC5 | chr8 | 41160980 | chr16 | 31473243 | 960 | HLA-C12:04 | CASEFVTIL | 0.9953 | 0.9948 | 8 | 17 |
SFRP1-ARMC5 | chr8 | 41160980 | chr16 | 31473243 | 960 | HLA-C06:03 | CASEFVTIL | 0.9951 | 0.994 | 8 | 17 |
SFRP1-ARMC5 | chr8 | 41160980 | chr16 | 31473243 | 960 | HLA-C12:12 | CASEFVTIL | 0.9937 | 0.9235 | 8 | 17 |
SFRP1-ARMC5 | chr8 | 41160980 | chr16 | 31473243 | 960 | HLA-B40:06 | SEFVTILQC | 0.9924 | 0.6082 | 10 | 19 |
SFRP1-ARMC5 | chr8 | 41160980 | chr16 | 31473243 | 960 | HLA-C08:03 | CASEFVTIL | 0.978 | 0.9856 | 8 | 17 |
SFRP1-ARMC5 | chr8 | 41160980 | chr16 | 31473243 | 960 | HLA-B40:03 | SEFVTILQC | 0.8961 | 0.5057 | 10 | 19 |
SFRP1-ARMC5 | chr8 | 41160980 | chr16 | 31473243 | 960 | HLA-C02:06 | CASEFVTIL | 0.896 | 0.9723 | 8 | 17 |
SFRP1-ARMC5 | chr8 | 41160980 | chr16 | 31473243 | 960 | HLA-B40:03 | SEFVTILQCM | 0.9655 | 0.5816 | 10 | 20 |
SFRP1-ARMC5 | chr8 | 41160980 | chr16 | 31473243 | 960 | HLA-C03:03 | CASEFVTIL | 0.9997 | 0.9909 | 8 | 17 |
SFRP1-ARMC5 | chr8 | 41160980 | chr16 | 31473243 | 960 | HLA-C03:04 | CASEFVTIL | 0.9997 | 0.9909 | 8 | 17 |
SFRP1-ARMC5 | chr8 | 41160980 | chr16 | 31473243 | 960 | HLA-C03:17 | CASEFVTIL | 0.9993 | 0.9777 | 8 | 17 |
SFRP1-ARMC5 | chr8 | 41160980 | chr16 | 31473243 | 960 | HLA-C03:05 | CASEFVTIL | 0.9991 | 0.9335 | 8 | 17 |
SFRP1-ARMC5 | chr8 | 41160980 | chr16 | 31473243 | 960 | HLA-C16:04 | CASEFVTIL | 0.9975 | 0.9847 | 8 | 17 |
SFRP1-ARMC5 | chr8 | 41160980 | chr16 | 31473243 | 960 | HLA-C03:06 | CASEFVTIL | 0.9966 | 0.9913 | 8 | 17 |
SFRP1-ARMC5 | chr8 | 41160980 | chr16 | 31473243 | 960 | HLA-C12:03 | CASEFVTIL | 0.9966 | 0.9804 | 8 | 17 |
SFRP1-ARMC5 | chr8 | 41160980 | chr16 | 31473243 | 960 | HLA-C12:02 | CASEFVTIL | 0.9933 | 0.9661 | 8 | 17 |
SFRP1-ARMC5 | chr8 | 41160980 | chr16 | 31473243 | 960 | HLA-C16:02 | CASEFVTIL | 0.9803 | 0.9938 | 8 | 17 |
SFRP1-ARMC5 | chr8 | 41160980 | chr16 | 31473243 | 960 | HLA-C08:01 | CASEFVTIL | 0.978 | 0.9856 | 8 | 17 |
SFRP1-ARMC5 | chr8 | 41160980 | chr16 | 31473243 | 960 | HLA-C16:01 | CASEFVTIL | 0.96 | 0.9829 | 8 | 17 |
SFRP1-ARMC5 | chr8 | 41160980 | chr16 | 31473243 | 960 | HLA-B40:04 | SEFVTILQC | 0.9565 | 0.7562 | 10 | 19 |
SFRP1-ARMC5 | chr8 | 41160980 | chr16 | 31473243 | 960 | HLA-C02:02 | CASEFVTIL | 0.8373 | 0.9771 | 8 | 17 |
SFRP1-ARMC5 | chr8 | 41160980 | chr16 | 31473243 | 960 | HLA-C02:10 | CASEFVTIL | 0.8373 | 0.9771 | 8 | 17 |
SFRP1-ARMC5 | chr8 | 41160980 | chr16 | 31473243 | 960 | HLA-C17:01 | CASEFVTIL | 0.8078 | 0.7617 | 8 | 17 |
SFRP1-ARMC5 | chr8 | 41160980 | chr16 | 31473243 | 960 | HLA-B50:04 | SEFVTILQC | 0.0379 | 0.7585 | 10 | 19 |
SFRP1-ARMC5 | chr8 | 41160980 | chr16 | 31473243 | 960 | HLA-B50:05 | SEFVTILQC | 0.0379 | 0.7585 | 10 | 19 |
SFRP1-ARMC5 | chr8 | 41160980 | chr16 | 31473243 | 960 | HLA-B38:05 | EHLCASEFVTI | 0.9991 | 0.9311 | 5 | 16 |
Top |
Potential FusionNeoAntigen Information of SFRP1-ARMC5 in HLA II |
![]() |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of SFRP1-ARMC5 |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
3396 | HLCASEFVTILQCM | SFRP1 | ARMC5 | chr8 | 41160980 | chr16 | 31473243 | 960 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of SFRP1-ARMC5 |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 3396 | HLCASEFVTILQCM | -7.9962 | -8.1096 |
HLA-B14:02 | 3BVN | 3396 | HLCASEFVTILQCM | -5.70842 | -6.74372 |
HLA-B52:01 | 3W39 | 3396 | HLCASEFVTILQCM | -6.83737 | -6.95077 |
HLA-B52:01 | 3W39 | 3396 | HLCASEFVTILQCM | -4.4836 | -5.5189 |
HLA-A11:01 | 4UQ2 | 3396 | HLCASEFVTILQCM | -10.0067 | -10.1201 |
HLA-A11:01 | 4UQ2 | 3396 | HLCASEFVTILQCM | -9.03915 | -10.0745 |
HLA-A24:02 | 5HGA | 3396 | HLCASEFVTILQCM | -6.56204 | -6.67544 |
HLA-A24:02 | 5HGA | 3396 | HLCASEFVTILQCM | -5.42271 | -6.45801 |
HLA-B44:05 | 3DX8 | 3396 | HLCASEFVTILQCM | -7.85648 | -8.89178 |
HLA-B44:05 | 3DX8 | 3396 | HLCASEFVTILQCM | -5.3978 | -5.5112 |
HLA-A02:01 | 6TDR | 3396 | HLCASEFVTILQCM | -3.37154 | -4.40684 |
Top |
Vaccine Design for the FusionNeoAntigens of SFRP1-ARMC5 |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
SFRP1-ARMC5 | chr8 | 41160980 | chr16 | 31473243 | 10 | 19 | SEFVTILQC | GCGAGTTTGTGACCATTCTTCAGTGCA |
SFRP1-ARMC5 | chr8 | 41160980 | chr16 | 31473243 | 10 | 20 | SEFVTILQCM | GCGAGTTTGTGACCATTCTTCAGTGCATGA |
SFRP1-ARMC5 | chr8 | 41160980 | chr16 | 31473243 | 5 | 16 | EHLCASEFVTI | AACATCTCTGTGCCAGCGAGTTTGTGACCATTC |
SFRP1-ARMC5 | chr8 | 41160980 | chr16 | 31473243 | 8 | 17 | CASEFVTIL | GTGCCAGCGAGTTTGTGACCATTCTTC |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of SFRP1-ARMC5 |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
BRCA | SFRP1-ARMC5 | chr8 | 41160980 | ENST00000220772 | chr16 | 31473243 | ENST00000268314 | TCGA-AR-A1AN-01A |
Top |
Potential target of CAR-T therapy development for SFRP1-ARMC5 |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to SFRP1-ARMC5 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to SFRP1-ARMC5 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |