|
|||||||
|
Fusion Protein:SKIV2L2-F2R |
Fusion Gene and Fusion Protein Summary |
 Fusion gene summary |
| Fusion partner gene information | Fusion gene name: SKIV2L2-F2R | FusionPDB ID: 82108 | FusionGDB2.0 ID: 82108 | Hgene | Tgene | Gene symbol | SKIV2L2 | F2R | Gene ID | 23517 | 2149 |
| Gene name | Mtr4 exosome RNA helicase | coagulation factor II thrombin receptor | |
| Synonyms | Dob1|KIAA0052|Mtr4|SKIV2L2|fSAP118 | CF2R|HTR|PAR-1|PAR1|TR | |
| Cytomap | 5q11.2 | 5q13.3 | |
| Type of gene | protein-coding | protein-coding | |
| Description | exosome RNA helicase MTR4ATP-dependent RNA helicase DOB1ATP-dependent RNA helicase SKIV2L2ATP-dependent helicase SKIV2L2Ski2 like RNA helicase 2TRAMP-like complex helicasefunctional spliceosome-associated protein 118superkiller viralicidic activity | proteinase-activated receptor 1protease-activated receptor 1 | |
| Modification date | 20200313 | 20200313 | |
| UniProtAcc | . | P55085 Main function of 5'-partner protein: FUNCTION: Receptor for trypsin and trypsin-like enzymes coupled to G proteins (PubMed:28445455). Its function is mediated through the activation of several signaling pathways including phospholipase C (PLC), intracellular calcium, mitogen-activated protein kinase (MAPK), I-kappaB kinase/NF-kappaB and Rho (PubMed:28445455). Can also be transactivated by cleaved F2R/PAR1. Involved in modulation of inflammatory responses and regulation of innate and adaptive immunity, and acts as a sensor for proteolytic enzymes generated during infection. Generally is promoting inflammation. Can signal synergistically with TLR4 and probably TLR2 in inflammatory responses and modulates TLR3 signaling. Has a protective role in establishing the endothelial barrier; the activity involves coagulation factor X. Regulates endothelial cell barrier integrity during neutrophil extravasation, probably following proteolytic cleavage by PRTN3 (PubMed:23202369). Proposed to have a bronchoprotective role in airway epithelium, but also shown to compromise the airway epithelial barrier by interrupting E-cadherin adhesion (PubMed:10086357). Involved in the regulation of vascular tone; activation results in hypotension presumably mediated by vasodilation. Associates with a subset of G proteins alpha subunits such as GNAQ, GNA11, GNA14, GNA12 and GNA13, but probably not with G(o) alpha, G(i) subunit alpha-1 and G(i) subunit alpha-2. However, according to PubMed:21627585 can signal through G(i) subunit alpha. Believed to be a class B receptor which internalizes as a complex with arrestin and traffic with it to endosomal vesicles, presumably as desensitized receptor, for extended periods of time. Mediates inhibition of TNF-alpha stimulated JNK phosphorylation via coupling to GNAQ and GNA11; the function involves dissociation of RIPK1 and TRADD from TNFR1. Mediates phosphorylation of nuclear factor NF-kappa-B RELA subunit at 'Ser-536'; the function involves IKBKB and is predominantly independent of G proteins. Involved in cellular migration. Involved in cytoskeletal rearrangement and chemotaxis through beta-arrestin-promoted scaffolds; the function is independent of GNAQ and GNA11 and involves promotion of cofilin dephosphorylation and actin filament severing. Induces redistribution of COPS5 from the plasma membrane to the cytosol and activation of the JNK cascade is mediated by COPS5. Involved in the recruitment of leukocytes to the sites of inflammation and is the major PAR receptor capable of modulating eosinophil function such as proinflammatory cytokine secretion, superoxide production and degranulation. During inflammation promotes dendritic cell maturation, trafficking to the lymph nodes and subsequent T-cell activation. Involved in antimicrobial response of innate immune cells; activation enhances phagocytosis of Gram-positive and killing of Gram-negative bacteria. Acts synergistically with interferon-gamma in enhancing antiviral responses. Implicated in a number of acute and chronic inflammatory diseases such as of the joints, lungs, brain, gastrointestinal tract, periodontium, skin, and vascular systems, and in autoimmune disorders. {ECO:0000269|PubMed:10086357, ECO:0000269|PubMed:10725339, ECO:0000269|PubMed:11413129, ECO:0000269|PubMed:11441110, ECO:0000269|PubMed:11447194, ECO:0000269|PubMed:11714832, ECO:0000269|PubMed:12832443, ECO:0000269|PubMed:15155775, ECO:0000269|PubMed:16359518, ECO:0000269|PubMed:16410250, ECO:0000269|PubMed:16478888, ECO:0000269|PubMed:16714334, ECO:0000269|PubMed:17404307, ECO:0000269|PubMed:17500066, ECO:0000269|PubMed:18424071, ECO:0000269|PubMed:18453611, ECO:0000269|PubMed:18474671, ECO:0000269|PubMed:18622013, ECO:0000269|PubMed:19494303, ECO:0000269|PubMed:19781631, ECO:0000269|PubMed:19864598, ECO:0000269|PubMed:19865078, ECO:0000269|PubMed:20826780, ECO:0000269|PubMed:21501162, ECO:0000269|PubMed:23202369, ECO:0000269|PubMed:28445455}. | |
| Ensembl transtripts involved in fusion gene | ENST ids | ENST00000504388, ENST00000230640, ENST00000545714, | ENST00000319211, ENST00000505600, |
| Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 34 X 12 X 8=3264 | 3 X 3 X 2=18 |
| # samples | 15 | 3 | |
| ** MAII score | log2(15/3264*10)=-4.44360665147561 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(3/18*10)=0.736965594166206 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0 | |
| Fusion gene context | PubMed: SKIV2L2 [Title/Abstract] AND F2R [Title/Abstract] AND fusion [Title/Abstract] | ||
| Fusion neoantigen context | PubMed: SKIV2L2 [Title/Abstract] AND F2R [Title/Abstract] AND neoantigen [Title/Abstract] | ||
| Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | SKIV2L2(54603975)-F2R(76028139), # samples:1 | ||
| Anticipated loss of major functional domain due to fusion event. | SKIV2L2-F2R seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. SKIV2L2-F2R seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. SKIV2L2-F2R seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. SKIV2L2-F2R seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. SKIV2L2-F2R seems lost the major protein functional domain in Hgene partner, which is a essential gene due to the frame-shifted ORF. SKIV2L2-F2R seems lost the major protein functional domain in Tgene partner, which is a IUPHAR drug target due to the frame-shifted ORF. | ||
| * DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
| Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Partner | Gene | GO ID | GO term | PubMed ID |
| Hgene | SKIV2L2 | GO:0006401 | RNA catabolic process | 29906447 |
| Tgene | F2R | GO:0002248 | connective tissue replacement involved in inflammatory response wound healing | 9639571 |
| Tgene | F2R | GO:0006919 | activation of cysteine-type endopeptidase activity involved in apoptotic process | 10692450 |
| Tgene | F2R | GO:0007200 | phospholipase C-activating G protein-coupled receptor signaling pathway | 20164183 |
| Tgene | F2R | GO:0008285 | negative regulation of cell proliferation | 10692450 |
| Tgene | F2R | GO:0009611 | response to wounding | 9639571 |
| Tgene | F2R | GO:0030168 | platelet activation | 9038223 |
| Tgene | F2R | GO:0030193 | regulation of blood coagulation | 17848177 |
| Tgene | F2R | GO:0030194 | positive regulation of blood coagulation | 9038223 |
| Tgene | F2R | GO:0032967 | positive regulation of collagen biosynthetic process | 9639571 |
| Tgene | F2R | GO:0043280 | positive regulation of cysteine-type endopeptidase activity involved in apoptotic process | 10692450 |
| Tgene | F2R | GO:0043410 | positive regulation of MAPK cascade | 17848177 |
| Tgene | F2R | GO:0045893 | positive regulation of transcription, DNA-templated | 17848177 |
| Tgene | F2R | GO:0051281 | positive regulation of release of sequestered calcium ion into cytosol | 1672265 |
| Tgene | F2R | GO:2000484 | positive regulation of interleukin-8 secretion | 17404307 |
| Tgene | F2R | GO:2000778 | positive regulation of interleukin-6 secretion | 11447194 |
| Four levels of functional features of fusion genes Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr5:54603975/chr5:76028139) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
 |
| Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here. |
| Fusion gene breakpoints across SKIV2L2 (5'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
| Fusion gene breakpoints across F2R (3'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Fusion Amino Acid Sequences |
| Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
| ENST00000230640 | SKIV2L2 | chr5 | 54603975 | - | ENST00000319211 | F2R | chr5 | 76028139 | + | 3856 | 388 | 273 | 1577 | 434 |
| DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
| ENST00000230640 | ENST00000319211 | SKIV2L2 | chr5 | 54603975 | - | F2R | chr5 | 76028139 | + | 0.00166897 | 0.998331 |
| Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones. |
Get the fusion protein sequences from here. |
| Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for SKIV2L2-F2R |
| +/-13 AA sequence from the breakpoints of the fusion protein sequences. |
| Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
| SKIV2L2 | chr5 | 54603975 | F2R | chr5 | 76028139 | 388 | 38 | GNGRGLQGLQTRQESKATNATLDPRS |
Top |
Potential FusionNeoAntigen Information of SKIV2L2-F2R in HLA I |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| SKIV2L2-F2R_54603975_76028139.msa | |
| SKIV2L2-IGF2R_54603975_160412216.msa |
| Potential FusionNeoAntigen Information * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
| SKIV2L2-F2R | chr5 | 54603975 | chr5 | 76028139 | 388 | HLA-B45:01 | QESKATNA | 0.9986 | 0.9155 | 12 | 20 |
| SKIV2L2-F2R | chr5 | 54603975 | chr5 | 76028139 | 388 | HLA-B45:01 | QESKATNAT | 0.8917 | 0.9517 | 12 | 21 |
| SKIV2L2-F2R | chr5 | 54603975 | chr5 | 76028139 | 388 | HLA-B50:02 | QESKATNAT | 0.8398 | 0.7913 | 12 | 21 |
| SKIV2L2-F2R | chr5 | 54603975 | chr5 | 76028139 | 388 | HLA-B41:01 | QESKATNAT | 0.306 | 0.9051 | 12 | 21 |
| SKIV2L2-F2R | chr5 | 54603975 | chr5 | 76028139 | 388 | HLA-B50:01 | QESKATNAT | 0.1638 | 0.8761 | 12 | 21 |
| SKIV2L2-F2R | chr5 | 54603975 | chr5 | 76028139 | 388 | HLA-B39:13 | QESKATNATL | 0.8971 | 0.9673 | 12 | 22 |
| SKIV2L2-F2R | chr5 | 54603975 | chr5 | 76028139 | 388 | HLA-B48:01 | RQESKATNATL | 0.9987 | 0.5895 | 11 | 22 |
| SKIV2L2-F2R | chr5 | 54603975 | chr5 | 76028139 | 388 | HLA-B44:09 | QESKATNATL | 0.9763 | 0.5424 | 12 | 22 |
| SKIV2L2-F2R | chr5 | 54603975 | chr5 | 76028139 | 388 | HLA-B44:10 | QESKATNATL | 0.9665 | 0.5935 | 12 | 22 |
| SKIV2L2-F2R | chr5 | 54603975 | chr5 | 76028139 | 388 | HLA-B73:01 | TRQESKATNA | 0.9647 | 0.7419 | 10 | 20 |
| SKIV2L2-F2R | chr5 | 54603975 | chr5 | 76028139 | 388 | HLA-B39:08 | QESKATNATL | 0.9506 | 0.8969 | 12 | 22 |
| SKIV2L2-F2R | chr5 | 54603975 | chr5 | 76028139 | 388 | HLA-B48:03 | RQESKATNATL | 0.9873 | 0.5189 | 11 | 22 |
| SKIV2L2-F2R | chr5 | 54603975 | chr5 | 76028139 | 388 | HLA-B39:08 | RQESKATNATL | 0.9688 | 0.761 | 11 | 22 |
| SKIV2L2-F2R | chr5 | 54603975 | chr5 | 76028139 | 388 | HLA-B50:05 | QESKATNAT | 0.1638 | 0.8761 | 12 | 21 |
| SKIV2L2-F2R | chr5 | 54603975 | chr5 | 76028139 | 388 | HLA-B50:04 | QESKATNAT | 0.1638 | 0.8761 | 12 | 21 |
| SKIV2L2-F2R | chr5 | 54603975 | chr5 | 76028139 | 388 | HLA-B40:04 | QESKATNATL | 0.993 | 0.7887 | 12 | 22 |
| SKIV2L2-F2R | chr5 | 54603975 | chr5 | 76028139 | 388 | HLA-B40:36 | QESKATNATL | 0.9903 | 0.5141 | 12 | 22 |
| SKIV2L2-F2R | chr5 | 54603975 | chr5 | 76028139 | 388 | HLA-B40:49 | QESKATNATL | 0.9822 | 0.5212 | 12 | 22 |
| SKIV2L2-F2R | chr5 | 54603975 | chr5 | 76028139 | 388 | HLA-B41:03 | QESKATNATL | 0.8169 | 0.6302 | 12 | 22 |
| SKIV2L2-F2R | chr5 | 54603975 | chr5 | 76028139 | 388 | HLA-B15:73 | RQESKATNATL | 0.9928 | 0.8944 | 11 | 22 |
| SKIV2L2-F2R | chr5 | 54603975 | chr5 | 76028139 | 388 | HLA-B15:30 | RQESKATNATL | 0.9901 | 0.8649 | 11 | 22 |
| SKIV2L2-F2R | chr5 | 54603975 | chr5 | 76028139 | 388 | HLA-B40:12 | RQESKATNATL | 0.9873 | 0.5189 | 11 | 22 |
| SKIV2L2-F2R | chr5 | 54603975 | chr5 | 76028139 | 388 | HLA-B40:21 | RQESKATNATL | 0.9453 | 0.654 | 11 | 22 |
Top |
Potential FusionNeoAntigen Information of SKIV2L2-F2R in HLA II |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| SKIV2L2-F2R_54603975_76028139.msa |
| Potential FusionNeoAntigen Information * We used NetMHCIIpan v4.1 (%rank<0.5). |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
| SKIV2L2-F2R | chr5 | 54603975 | chr5 | 76028139 | 388 | DRB1-0411 | GRGLQGLQTRQESKA | 2 | 17 |
| SKIV2L2-F2R | chr5 | 54603975 | chr5 | 76028139 | 388 | DRB1-0415 | GRGLQGLQTRQESKA | 2 | 17 |
| SKIV2L2-F2R | chr5 | 54603975 | chr5 | 76028139 | 388 | DRB1-0436 | GRGLQGLQTRQESKA | 2 | 17 |
| SKIV2L2-F2R | chr5 | 54603975 | chr5 | 76028139 | 388 | DRB1-0437 | GRGLQGLQTRQESKA | 2 | 17 |
| SKIV2L2-F2R | chr5 | 54603975 | chr5 | 76028139 | 388 | DRB1-0453 | GRGLQGLQTRQESKA | 2 | 17 |
| SKIV2L2-F2R | chr5 | 54603975 | chr5 | 76028139 | 388 | DRB1-0458 | GRGLQGLQTRQESKA | 2 | 17 |
| SKIV2L2-F2R | chr5 | 54603975 | chr5 | 76028139 | 388 | DRB1-0467 | GRGLQGLQTRQESKA | 2 | 17 |
| SKIV2L2-F2R | chr5 | 54603975 | chr5 | 76028139 | 388 | DRB1-0491 | GRGLQGLQTRQESKA | 2 | 17 |
| SKIV2L2-F2R | chr5 | 54603975 | chr5 | 76028139 | 388 | DRB1-1457 | GRGLQGLQTRQESKA | 2 | 17 |
| SKIV2L2-F2R | chr5 | 54603975 | chr5 | 76028139 | 388 | DRB1-1457 | NGRGLQGLQTRQESK | 1 | 16 |
Top |
Fusion breakpoint peptide structures of SKIV2L2-F2R |
| 3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
| File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
| 7280 | QGLQTRQESKATNA | SKIV2L2 | F2R | chr5 | 54603975 | chr5 | 76028139 | 388 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of SKIV2L2-F2R |
| Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens * We used Glide to predict the interaction between HLAs and neoantigens. |
| HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
| HLA-B14:02 | 3BVN | 7280 | QGLQTRQESKATNA | -7.9962 | -8.1096 |
| HLA-B14:02 | 3BVN | 7280 | QGLQTRQESKATNA | -5.70842 | -6.74372 |
| HLA-B52:01 | 3W39 | 7280 | QGLQTRQESKATNA | -6.83737 | -6.95077 |
| HLA-B52:01 | 3W39 | 7280 | QGLQTRQESKATNA | -4.4836 | -5.5189 |
| HLA-A11:01 | 4UQ2 | 7280 | QGLQTRQESKATNA | -10.0067 | -10.1201 |
| HLA-A11:01 | 4UQ2 | 7280 | QGLQTRQESKATNA | -9.03915 | -10.0745 |
| HLA-A24:02 | 5HGA | 7280 | QGLQTRQESKATNA | -6.56204 | -6.67544 |
| HLA-A24:02 | 5HGA | 7280 | QGLQTRQESKATNA | -5.42271 | -6.45801 |
| HLA-B44:05 | 3DX8 | 7280 | QGLQTRQESKATNA | -7.85648 | -8.89178 |
| HLA-B44:05 | 3DX8 | 7280 | QGLQTRQESKATNA | -5.3978 | -5.5112 |
| HLA-A02:01 | 6TDR | 7280 | QGLQTRQESKATNA | -3.37154 | -4.40684 |
Top |
Vaccine Design for the FusionNeoAntigens of SKIV2L2-F2R |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
| SKIV2L2-F2R | chr5 | 54603975 | chr5 | 76028139 | 10 | 20 | TRQESKATNA | CAAGGCAGGAATCAAAAGCAACAAATGCCA |
| SKIV2L2-F2R | chr5 | 54603975 | chr5 | 76028139 | 11 | 22 | RQESKATNATL | GGCAGGAATCAAAAGCAACAAATGCCACCTTAG |
| SKIV2L2-F2R | chr5 | 54603975 | chr5 | 76028139 | 12 | 20 | QESKATNA | AGGAATCAAAAGCAACAAATGCCA |
| SKIV2L2-F2R | chr5 | 54603975 | chr5 | 76028139 | 12 | 21 | QESKATNAT | AGGAATCAAAAGCAACAAATGCCACCT |
| SKIV2L2-F2R | chr5 | 54603975 | chr5 | 76028139 | 12 | 22 | QESKATNATL | AGGAATCAAAAGCAACAAATGCCACCTTAG |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
| SKIV2L2-F2R | chr5 | 54603975 | chr5 | 76028139 | 1 | 16 | NGRGLQGLQTRQESK | ATGGAAGGGGCCTCCAGGGTCTGCAGACAAGGCAGGAATCAAAAG |
| SKIV2L2-F2R | chr5 | 54603975 | chr5 | 76028139 | 2 | 17 | GRGLQGLQTRQESKA | GAAGGGGCCTCCAGGGTCTGCAGACAAGGCAGGAATCAAAAGCAA |
Top |
Information of the samples that have these potential fusion neoantigens of SKIV2L2-F2R |
| These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens. |
| Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
| PRAD | SKIV2L2-F2R | chr5 | 54603975 | ENST00000230640 | chr5 | 76028139 | ENST00000319211 | TCGA-J4-A83I-01A |
Top |
Potential target of CAR-T therapy development for SKIV2L2-F2R |
| Predicted 3D structure. We used RoseTTAFold. |
| Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features * Minus value of BPloci means that the break point is located before the CDS. |
| - In-frame and retained 'Transmembrane'. |
| Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
| Tgene | F2R | chr5:54603975 | chr5:76028139 | ENST00000319211 | 0 | 2 | 103_128 | 0 | 426.0 | Transmembrane | Helical%3B Name%3D1 | |
| Tgene | F2R | chr5:54603975 | chr5:76028139 | ENST00000319211 | 0 | 2 | 138_157 | 0 | 426.0 | Transmembrane | Helical%3B Name%3D2 | |
| Tgene | F2R | chr5:54603975 | chr5:76028139 | ENST00000319211 | 0 | 2 | 177_198 | 0 | 426.0 | Transmembrane | Helical%3B Name%3D3 | |
| Tgene | F2R | chr5:54603975 | chr5:76028139 | ENST00000319211 | 0 | 2 | 219_239 | 0 | 426.0 | Transmembrane | Helical%3B Name%3D4 | |
| Tgene | F2R | chr5:54603975 | chr5:76028139 | ENST00000319211 | 0 | 2 | 269_288 | 0 | 426.0 | Transmembrane | Helical%3B Name%3D5 | |
| Tgene | F2R | chr5:54603975 | chr5:76028139 | ENST00000319211 | 0 | 2 | 312_334 | 0 | 426.0 | Transmembrane | Helical%3B Name%3D6 | |
| Tgene | F2R | chr5:54603975 | chr5:76028139 | ENST00000319211 | 0 | 2 | 351_374 | 0 | 426.0 | Transmembrane | Helical%3B Name%3D7 |
| Subcellular localization prediction of the transmembrane domain retained fusion proteins * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
| Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
| SKIV2L2 | chr5 | 54603975 | ENST00000230640 | F2R | chr5 | 76028139 | ENST00000319211 |  |
Top |
Related Drugs to SKIV2L2-F2R |
| Drugs used for this fusion-positive patient. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to SKIV2L2-F2R |
| Diseases that have this fusion gene. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Disease | Source | PMID |
| Diseases associated with fusion partners. (DisGeNet 4.0) |
| Partner | Gene | Disease ID | Disease name | # pubmeds | Source |
Copyright 2023-PresentThe University of Texas Health Science Center at Houston (UTHealth)
Web File Viewing | Emergency Information
Campus Carry|Site Policies