Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:SLC12A2-CSNK1A1

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: SLC12A2-CSNK1A1
	FusionPDB ID: 82213
	FusionGDB2.0 ID: 82213
		Hgene	Tgene
	Gene symbol	SLC12A2	CSNK1A1
	Gene ID	6558	1452
	Gene name	solute carrier family 12 member 2	casein kinase 1 alpha 1
	Synonyms	BSC\|BSC2\|NKCC1\|PPP1R141	CK1\|CK1a\|CKIa\|HEL-S-77p\|HLCDGP1\|PRO2975
	Cytomap	5q23.3	5q32
	Type of gene	protein-coding	protein-coding
	Description	solute carrier family 12 member 2basolateral Na-K-Cl symporterbumetanide-sensitive sodium-(potassium)-chloride cotransporter 1bumetanide-sensitive sodium-(potassium)-chloride cotransporter 2protein phosphatase 1, regulatory subunit 141solute carrier	casein kinase I isoform alphaCKI-alphaclock regulator kinasedown-regulated in lung cancerepididymis secretory sperm binding protein Li 77p
	Modification date	20200327	20200313
	UniProtAcc	.	P48729 Main function of 5'-partner protein: FUNCTION: Casein kinases are operationally defined by their preferential utilization of acidic proteins such as caseins as substrates. It can phosphorylate a large number of proteins. Participates in Wnt signaling. Phosphorylates CTNNB1 at 'Ser-45'. May phosphorylate PER1 and PER2. May play a role in segregating chromosomes during mitosis (PubMed:11955436, PubMed:1409656, PubMed:18305108). May play a role in keratin cytoskeleton disassembly and thereby, it may regulate epithelial cell migration (PubMed:23902688). {ECO:0000269\|PubMed:11955436, ECO:0000269\|PubMed:1409656, ECO:0000269\|PubMed:18305108, ECO:0000269\|PubMed:23902688}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000262461, ENST00000343225, ENST00000507791,	ENST00000515748, ENST00000606299, ENST00000606719, ENST00000261798, ENST00000377843, ENST00000504676, ENST00000515435, ENST00000515768,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	14 X 13 X 4=728	12 X 13 X 6=936
	# samples	16	15
	** MAII score	log2(16/728*10)=-2.18586654531133 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(15/936*10)=-2.64154602908752 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: SLC12A2 [Title/Abstract] AND CSNK1A1 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: SLC12A2 [Title/Abstract] AND CSNK1A1 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	SLC12A2(127420402)-CSNK1A1(148899951), # samples:2
Anticipated loss of major functional domain due to fusion event.	SLC12A2-CSNK1A1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. SLC12A2-CSNK1A1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. SLC12A2-CSNK1A1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. SLC12A2-CSNK1A1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	SLC12A2	GO:0015696	ammonium transport	12946942\|18032481
Hgene	SLC12A2	GO:0030321	transepithelial chloride transport	12946942
Hgene	SLC12A2	GO:0070634	transepithelial ammonium transport	18032481
Tgene	CSNK1A1	GO:0006468	protein phosphorylation	18305108
Tgene	CSNK1A1	GO:0018105	peptidyl-serine phosphorylation	25500533
Tgene	CSNK1A1	GO:0032436	positive regulation of proteasomal ubiquitin-dependent protein catabolic process	19364825

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr5:127420402/chr5:148899951)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across SLC12A2 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across CSNK1A1 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000262461	SLC12A2	chr5	127420402	+	ENST00000261798	CSNK1A1	chr5	148899951	-	6222	945	33	1565	510
ENST00000262461	SLC12A2	chr5	127420402	+	ENST00000377843	CSNK1A1	chr5	148899951	-	3173	945	33	1601	522
ENST00000262461	SLC12A2	chr5	127420402	+	ENST00000515435	CSNK1A1	chr5	148899951	-	2449	945	33	1649	538
ENST00000262461	SLC12A2	chr5	127420402	+	ENST00000504676	CSNK1A1	chr5	148899951	-	2365	945	33	1565	510
ENST00000262461	SLC12A2	chr5	127420402	+	ENST00000515768	CSNK1A1	chr5	148899951	-	1686	945	33	1685	550
ENST00000343225	SLC12A2	chr5	127420402	+	ENST00000261798	CSNK1A1	chr5	148899951	-	6140	863	8	1483	491
ENST00000343225	SLC12A2	chr5	127420402	+	ENST00000377843	CSNK1A1	chr5	148899951	-	3091	863	8	1519	503
ENST00000343225	SLC12A2	chr5	127420402	+	ENST00000515435	CSNK1A1	chr5	148899951	-	2367	863	8	1567	519
ENST00000343225	SLC12A2	chr5	127420402	+	ENST00000504676	CSNK1A1	chr5	148899951	-	2283	863	8	1483	491
ENST00000343225	SLC12A2	chr5	127420402	+	ENST00000515768	CSNK1A1	chr5	148899951	-	1604	863	8	1603	532

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000262461	ENST00000261798	SLC12A2	chr5	127420402	+	CSNK1A1	chr5	148899951	-	0.000233425	0.9997665
ENST00000262461	ENST00000377843	SLC12A2	chr5	127420402	+	CSNK1A1	chr5	148899951	-	0.000519377	0.99948066
ENST00000262461	ENST00000515435	SLC12A2	chr5	127420402	+	CSNK1A1	chr5	148899951	-	0.001424285	0.9985757
ENST00000262461	ENST00000504676	SLC12A2	chr5	127420402	+	CSNK1A1	chr5	148899951	-	0.001285043	0.9987149
ENST00000262461	ENST00000515768	SLC12A2	chr5	127420402	+	CSNK1A1	chr5	148899951	-	0.004526876	0.9954731
ENST00000343225	ENST00000261798	SLC12A2	chr5	127420402	+	CSNK1A1	chr5	148899951	-	0.000225593	0.9997744
ENST00000343225	ENST00000377843	SLC12A2	chr5	127420402	+	CSNK1A1	chr5	148899951	-	0.000465622	0.99953437
ENST00000343225	ENST00000515435	SLC12A2	chr5	127420402	+	CSNK1A1	chr5	148899951	-	0.001273205	0.9987268
ENST00000343225	ENST00000504676	SLC12A2	chr5	127420402	+	CSNK1A1	chr5	148899951	-	0.00112806	0.99887186
ENST00000343225	ENST00000515768	SLC12A2	chr5	127420402	+	CSNK1A1	chr5	148899951	-	0.003969954	0.99603003

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for SLC12A2-CSNK1A1

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
SLC12A2	chr5	127420402	CSNK1A1	chr5	148899951	863	285	RPSLAELHDELEKMISRIEYVHTKNF
SLC12A2	chr5	127420402	CSNK1A1	chr5	148899951	945	304	RPSLAELHDELEKMISRIEYVHTKNF

Top

Potential FusionNeoAntigen Information of SLC12A2-CSNK1A1 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

SLC12A2-CSNK1A1_127420402_148899951.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-B15:01	KMISRIEY	0.9997	0.9203	12	20
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-B38:02	LHDELEKM	0.999	0.991	6	14
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-B18:01	DELEKMIS	0.9987	0.9623	8	16
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-B38:01	LHDELEKM	0.9987	0.9902	6	14
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-B15:25	KMISRIEY	0.9984	0.8456	12	20
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-B15:03	KMISRIEY	0.9866	0.6371	12	20
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-A02:11	KMISRIEYV	0.9984	0.5342	12	21
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-A02:13	KMISRIEYV	0.9984	0.5154	12	21
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-A02:21	KMISRIEYV	0.9981	0.6499	12	21
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-B39:01	LHDELEKMI	0.9916	0.9588	6	15
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-B38:01	LHDELEKMI	0.9901	0.9811	6	15
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-A30:08	KMISRIEYV	0.99	0.7306	12	21
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-B38:02	LHDELEKMI	0.9893	0.9851	6	15
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-A02:35	KMISRIEYV	0.9872	0.5349	12	21
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-B18:01	DELEKMISR	0.9695	0.9748	8	17
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-B15:10	LHDELEKMI	0.923	0.6488	6	15
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-A32:13	KMISRIEYV	0.8936	0.8624	12	21
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-B13:01	KMISRIEYV	0.2743	0.8957	12	21
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-B18:01	EKMISRIEY	0.2645	0.8487	11	20
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-B44:03	AELHDELEKM	0.9993	0.9788	4	14
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-B47:01	AELHDELEKM	0.9972	0.6302	4	14
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-B18:01	LEKMISRIEY	0.9849	0.8674	10	20
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-B38:01	ELHDELEKMI	0.1377	0.9002	5	15
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-B38:02	ELHDELEKMI	0.11	0.919	5	15
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-B15:07	KMISRIEY	0.9996	0.6792	12	20
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-B39:09	LHDELEKM	0.9995	0.6617	6	14
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-B39:05	LHDELEKM	0.9976	0.9704	6	14
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-B15:04	KMISRIEY	0.9968	0.9277	12	20
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-A02:07	KMISRIEYV	0.9985	0.5611	12	21
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-B39:09	LHDELEKMI	0.992	0.6321	6	15
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-B39:05	LHDELEKMI	0.9875	0.9525	6	15
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-C02:06	KMISRIEYV	0.7777	0.9038	12	21
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-B15:21	EKMISRIEY	0.6757	0.7456	11	20
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-C18:01	LHDELEKM	0.9999	0.9061	6	14
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-B15:34	KMISRIEY	0.9997	0.9203	12	20
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-B15:27	KMISRIEY	0.9997	0.9234	12	20
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-B15:125	KMISRIEY	0.9997	0.9203	12	20
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-B15:135	KMISRIEY	0.9997	0.9101	12	20
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-B15:33	KMISRIEY	0.9997	0.9203	12	20
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-B15:50	KMISRIEY	0.9996	0.9157	12	20
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-B15:35	KMISRIEY	0.9994	0.8953	12	20
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-B38:05	LHDELEKM	0.9987	0.9902	6	14
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-B18:05	DELEKMIS	0.9987	0.9623	8	16
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-B15:39	KMISRIEY	0.9984	0.7538	12	20
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-B15:09	LHDELEKM	0.994	0.7088	6	14
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-B39:11	LHDELEKM	0.9795	0.9272	6	14
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-A02:03	KMISRIEYV	0.9987	0.5529	12	21
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-A02:06	KMISRIEYV	0.9981	0.6499	12	21
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-A02:14	KMISRIEYV	0.9981	0.5354	12	21
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-A25:01	ELHDELEKM	0.9971	0.881	5	14
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-C15:02	KMISRIEYV	0.9966	0.8189	12	21
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-C18:01	LHDELEKMI	0.9957	0.8974	6	15
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-B39:31	LHDELEKMI	0.9919	0.959	6	15
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-B38:05	LHDELEKMI	0.9901	0.9811	6	15
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-B18:08	DELEKMISR	0.9745	0.9688	8	17
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-B18:05	DELEKMISR	0.9695	0.9748	8	17
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-A32:01	KMISRIEYV	0.966	0.8889	12	21
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-B18:06	DELEKMISR	0.9577	0.9779	8	17
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-B18:03	DELEKMISR	0.9575	0.9727	8	17
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-B15:09	LHDELEKMI	0.9372	0.6331	6	15
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-C06:17	KMISRIEYV	0.9279	0.9859	12	21
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-C06:02	KMISRIEYV	0.9279	0.9859	12	21
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-C06:06	KMISRIEYV	0.8991	0.9739	12	21
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-C06:08	KMISRIEYV	0.7899	0.9714	12	21
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-B39:11	LHDELEKMI	0.6716	0.9119	6	15
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-B18:04	EKMISRIEY	0.5444	0.8693	11	20
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-B18:11	EKMISRIEY	0.5273	0.7262	11	20
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-C07:04	KMISRIEYV	0.514	0.8247	12	21
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-B48:02	EKMISRIEY	0.4405	0.8216	11	20
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-B18:03	EKMISRIEY	0.3996	0.8406	11	20
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-B18:08	EKMISRIEY	0.3164	0.7467	11	20
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-B18:07	EKMISRIEY	0.3073	0.7951	11	20
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-B18:06	EKMISRIEY	0.3055	0.8517	11	20
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-B18:05	EKMISRIEY	0.2645	0.8487	11	20
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-B15:53	EKMISRIEY	0.1418	0.7555	11	20
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-B15:54	EKMISRIEY	0.0969	0.7479	11	20
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-B44:07	AELHDELEKM	0.9993	0.9788	4	14
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-B44:13	AELHDELEKM	0.9993	0.9788	4	14
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-B44:26	AELHDELEKM	0.9993	0.9788	4	14
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-B40:04	AELHDELEKM	0.9954	0.6947	4	14
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-B15:53	LEKMISRIEY	0.9945	0.7433	10	20
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-B18:05	LEKMISRIEY	0.9849	0.8674	10	20
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-B18:11	LEKMISRIEY	0.9546	0.7921	10	20
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-B41:03	AELHDELEKM	0.7528	0.7326	4	14
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	945	HLA-B38:05	ELHDELEKMI	0.1377	0.9002	5	15

Top

Potential FusionNeoAntigen Information of SLC12A2-CSNK1A1 in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of SLC12A2-CSNK1A1

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
5042	LHDELEKMISRIEY	SLC12A2	CSNK1A1	chr5	127420402	chr5	148899951	945

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of SLC12A2-CSNK1A1

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	5042	LHDELEKMISRIEY	-7.9962	-8.1096
HLA-B14:02	3BVN	5042	LHDELEKMISRIEY	-5.70842	-6.74372
HLA-B52:01	3W39	5042	LHDELEKMISRIEY	-6.83737	-6.95077
HLA-B52:01	3W39	5042	LHDELEKMISRIEY	-4.4836	-5.5189
HLA-A11:01	4UQ2	5042	LHDELEKMISRIEY	-10.0067	-10.1201
HLA-A11:01	4UQ2	5042	LHDELEKMISRIEY	-9.03915	-10.0745
HLA-A24:02	5HGA	5042	LHDELEKMISRIEY	-6.56204	-6.67544
HLA-A24:02	5HGA	5042	LHDELEKMISRIEY	-5.42271	-6.45801
HLA-B44:05	3DX8	5042	LHDELEKMISRIEY	-7.85648	-8.89178
HLA-B44:05	3DX8	5042	LHDELEKMISRIEY	-5.3978	-5.5112
HLA-A02:01	6TDR	5042	LHDELEKMISRIEY	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of SLC12A2-CSNK1A1

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	10	20	LEKMISRIEY	CTGGAAAAGATGATCAGTAGAATTGAATAT
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	11	20	EKMISRIEY	GAAAAGATGATCAGTAGAATTGAATAT
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	12	20	KMISRIEY	AAGATGATCAGTAGAATTGAATAT
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	12	21	KMISRIEYV	AAGATGATCAGTAGAATTGAATATGTG
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	4	14	AELHDELEKM	GCGGAGCTCCACGACGAGCTGGAAAAGATG
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	5	14	ELHDELEKM	GAGCTCCACGACGAGCTGGAAAAGATG
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	5	15	ELHDELEKMI	GAGCTCCACGACGAGCTGGAAAAGATGATC
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	6	14	LHDELEKM	CTCCACGACGAGCTGGAAAAGATG
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	6	15	LHDELEKMI	CTCCACGACGAGCTGGAAAAGATGATC
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	8	16	DELEKMIS	GACGAGCTGGAAAAGATGATCAGT
SLC12A2-CSNK1A1	chr5	127420402	chr5	148899951	8	17	DELEKMISR	GACGAGCTGGAAAAGATGATCAGTAGA

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of SLC12A2-CSNK1A1

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
LUAD	SLC12A2-CSNK1A1	chr5	127420402	ENST00000262461	chr5	148899951	ENST00000261798	TCGA-55-7913-01B

Top

Potential target of CAR-T therapy development for SLC12A2-CSNK1A1

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to SLC12A2-CSNK1A1

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to SLC12A2-CSNK1A1

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)