Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:SMYD3-TRIM58

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: SMYD3-TRIM58
	FusionPDB ID: 84386
	FusionGDB2.0 ID: 84386
		Hgene	Tgene
	Gene symbol	SMYD3	TRIM58
	Gene ID	64754	25893
	Gene name	SET and MYND domain containing 3	tripartite motif containing 58
	Synonyms	KMT3E\|ZMYND1\|ZNFN3A1\|bA74P14.1	BIA2
	Cytomap	1q44	1q44
	Type of gene	protein-coding	protein-coding
	Description	histone-lysine N-methyltransferase SMYD3SET and MYND domain-containing protein 3bA74P14.1 (novel protein)zinc finger MYND domain-containing protein 1zinc finger protein, subfamily 3A (MYND domain containing), 1zinc finger, MYND domain containing 1	E3 ubiquitin-protein ligase TRIM58RING-type E3 ubiquitin transferase TRIM58tripartite motif-containing protein 58
	Modification date	20200320	20200313
	UniProtAcc	.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000541742, ENST00000388985, ENST00000403792, ENST00000490107, ENST00000366517,	ENST00000366481,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	22 X 13 X 10=2860	5 X 5 X 3=75
	# samples	24	6
	** MAII score	log2(24/2860*10)=-3.57490883605723 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(6/75*10)=-0.321928094887362 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: SMYD3 [Title/Abstract] AND TRIM58 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: SMYD3 [Title/Abstract] AND TRIM58 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	SMYD3(246490503)-TRIM58(248023919), # samples:2 SMYD3(246490502)-TRIM58(248023918), # samples:2
Anticipated loss of major functional domain due to fusion event.	SMYD3-TRIM58 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. SMYD3-TRIM58 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. SMYD3-TRIM58 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. SMYD3-TRIM58 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. SMYD3-TRIM58 seems lost the major protein functional domain in Hgene partner, which is a epigenetic factor due to the frame-shifted ORF. SMYD3-TRIM58 seems lost the major protein functional domain in Hgene partner, which is a transcription factor due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner

Gene

GO ID

GO term

PubMed ID

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr1:246490503/chr1:248023919)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across SMYD3 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across TRIM58 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000490107	SMYD3	chr1	246490503	-	ENST00000366481	TRIM58	chr1	248023919	+	3328	571	16	1611	531
ENST00000388985	SMYD3	chr1	246490503	-	ENST00000366481	TRIM58	chr1	248023919	+	3288	531	0	1571	523
ENST00000403792	SMYD3	chr1	246490503	-	ENST00000366481	TRIM58	chr1	248023919	+	3383	626	50	1666	538
ENST00000490107	SMYD3	chr1	246490502	-	ENST00000366481	TRIM58	chr1	248023918	+	3328	571	16	1611	531
ENST00000388985	SMYD3	chr1	246490502	-	ENST00000366481	TRIM58	chr1	248023918	+	3288	531	0	1571	523
ENST00000403792	SMYD3	chr1	246490502	-	ENST00000366481	TRIM58	chr1	248023918	+	3383	626	50	1666	538

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000490107	ENST00000366481	SMYD3	chr1	246490503	-	TRIM58	chr1	248023919	+	0.001536636	0.9984634
ENST00000388985	ENST00000366481	SMYD3	chr1	246490503	-	TRIM58	chr1	248023919	+	0.001459163	0.9985409
ENST00000403792	ENST00000366481	SMYD3	chr1	246490503	-	TRIM58	chr1	248023919	+	0.001507996	0.998492
ENST00000490107	ENST00000366481	SMYD3	chr1	246490502	-	TRIM58	chr1	248023918	+	0.001536636	0.9984634
ENST00000388985	ENST00000366481	SMYD3	chr1	246490502	-	TRIM58	chr1	248023918	+	0.001459163	0.9985409
ENST00000403792	ENST00000366481	SMYD3	chr1	246490502	-	TRIM58	chr1	248023918	+	0.001507996	0.998492

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for SMYD3-TRIM58

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
SMYD3	chr1	246490502	TRIM58	chr1	248023918	531	177	LPPAFDLFEAFAKVKLQMALELMRKE
SMYD3	chr1	246490502	TRIM58	chr1	248023918	571	185	LPPAFDLFEAFAKVKLQMALELMRKE
SMYD3	chr1	246490502	TRIM58	chr1	248023918	626	192	LPPAFDLFEAFAKVKLQMALELMRKE
SMYD3	chr1	246490503	TRIM58	chr1	248023919	531	177	LPPAFDLFEAFAKVKLQMALELMRKE
SMYD3	chr1	246490503	TRIM58	chr1	248023919	571	185	LPPAFDLFEAFAKVKLQMALELMRKE
SMYD3	chr1	246490503	TRIM58	chr1	248023919	626	192	LPPAFDLFEAFAKVKLQMALELMRKE

Top

Potential FusionNeoAntigen Information of SMYD3-TRIM58 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

SMYD3-TRIM58_246490502_248023918.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-B08:01	EAFAKVKL	0.9976	0.5929	8	16
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-B08:09	EAFAKVKL	0.9972	0.5669	8	16
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-B13:01	FEAFAKVKL	0.9956	0.7861	7	16
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-A02:22	DLFEAFAKV	0.9842	0.505	5	14
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-B18:01	FEAFAKVKL	0.9841	0.7644	7	16
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-B39:01	AKVKLQMAL	0.9791	0.8153	11	20
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-B47:01	FEAFAKVKL	0.9628	0.5053	7	16
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-B14:02	AKVKLQMAL	0.9582	0.7718	11	20
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-B14:01	AKVKLQMAL	0.9582	0.7718	11	20
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-B39:13	AKVKLQMAL	0.8852	0.8678	11	20
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-B15:10	AKVKLQMAL	0.7656	0.5246	11	20
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-B15:03	AKVKLQMAL	0.5905	0.7042	11	20
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-B41:01	FEAFAKVKL	0.3732	0.8532	7	16
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-B15:37	AKVKLQMAL	0.3311	0.5653	11	20
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-B39:13	FEAFAKVKL	0.3282	0.7742	7	16
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-A02:22	FDLFEAFAKV	0.7406	0.5767	4	14
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-A02:04	FDLFEAFAKV	0.6702	0.6949	4	14
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-A02:13	FDLFEAFAKV	0.5209	0.5374	4	14
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-C12:12	FAKVKLQM	0.9998	0.8465	10	18
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-C06:03	FAKVKLQM	0.9995	0.9834	10	18
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-C12:04	FAKVKLQM	0.9994	0.9875	10	18
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-B51:07	EAFAKVKL	0.9991	0.5159	8	16
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-C03:14	FAKVKLQM	0.9479	0.9532	10	18
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-B40:06	FEAFAKVKL	0.9992	0.5555	7	16
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-B39:09	AKVKLQMAL	0.9857	0.5391	11	20
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-B39:12	AKVKLQMAL	0.9801	0.8273	11	20
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-B51:07	DLFEAFAKV	0.9081	0.8605	5	14
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-B39:05	AKVKLQMAL	0.7726	0.7891	11	20
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-B39:08	FEAFAKVKL	0.4845	0.7818	7	16
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-B39:05	FEAFAKVKL	0.2872	0.7725	7	16
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-C04:14	AFAKVKLQM	0.122	0.8179	9	18
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-C03:03	FAKVKLQM	0.9999	0.9841	10	18
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-C03:04	FAKVKLQM	0.9999	0.9841	10	18
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-C12:03	FAKVKLQM	0.9997	0.9651	10	18
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-C03:67	FAKVKLQM	0.9997	0.9724	10	18
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-C03:02	FAKVKLQM	0.9996	0.9532	10	18
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-C03:17	FAKVKLQM	0.9996	0.9427	10	18
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-C03:05	FAKVKLQM	0.9995	0.874	10	18
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-C12:02	FAKVKLQM	0.9993	0.9352	10	18
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-C16:04	FAKVKLQM	0.9991	0.9626	10	18
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-B08:18	EAFAKVKL	0.9976	0.5929	8	16
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-C16:01	FAKVKLQM	0.9963	0.9649	10	18
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-C02:10	FAKVKLQM	0.9917	0.9666	10	18
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-C02:02	FAKVKLQM	0.9917	0.9666	10	18
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-C16:02	FAKVKLQM	0.984	0.9805	10	18
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-B08:12	EAFAKVKL	0.9639	0.7096	8	16
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-B40:04	FEAFAKVKL	0.9983	0.5787	7	16
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-B27:06	AKVKLQMAL	0.9972	0.6413	11	20
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-A68:02	DLFEAFAKV	0.9971	0.804	5	14
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-A69:01	DLFEAFAKV	0.9907	0.6384	5	14
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-B18:07	FEAFAKVKL	0.9868	0.7279	7	16
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-B18:04	FEAFAKVKL	0.9846	0.7812	7	16
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-B18:06	FEAFAKVKL	0.9845	0.7783	7	16
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-B18:05	FEAFAKVKL	0.9841	0.7644	7	16
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-B18:08	FEAFAKVKL	0.9831	0.6961	7	16
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-B39:02	AKVKLQMAL	0.9829	0.8667	11	20
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-B18:03	FEAFAKVKL	0.9737	0.7515	7	16
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-B39:31	AKVKLQMAL	0.9733	0.8187	11	20
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-B18:11	FEAFAKVKL	0.7792	0.7564	7	16
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-B15:09	AKVKLQMAL	0.6074	0.6153	11	20
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-C07:17	AFAKVKLQM	0.5979	0.9093	9	18
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-B41:03	FEAFAKVKL	0.5773	0.5769	7	16
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-B39:11	FEAFAKVKL	0.5342	0.7684	7	16
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-B48:02	AKVKLQMAL	0.435	0.8424	11	20
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-B39:31	FEAFAKVKL	0.4051	0.7892	7	16
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-B39:02	FEAFAKVKL	0.3866	0.7801	7	16
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-C03:67	AFAKVKLQM	0.3412	0.9633	9	18
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-B15:54	AKVKLQMAL	0.1201	0.7387	11	20
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-C04:04	AFAKVKLQM	0.1097	0.8017	9	18
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-C14:03	AFAKVKLQM	0.0807	0.9504	9	18
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-C14:02	AFAKVKLQM	0.0807	0.9504	9	18
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-C06:06	AFAKVKLQM	0.075	0.9859	9	18
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-B08:12	FAKVKLQMAL	0.9195	0.5098	10	20
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-A02:03	FDLFEAFAKV	0.6753	0.5833	4	14
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	HLA-A02:03	AFDLFEAFAKV	0.7155	0.582	3	14

Top

Potential FusionNeoAntigen Information of SMYD3-TRIM58 in HLA II

SMYD3-TRIM58_246490502_248023918.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	DRB5-0101	LPPAFDLFEAFAKVK	0	15
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	DRB5-0101	PPAFDLFEAFAKVKL	1	16
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	DRB5-0102	LPPAFDLFEAFAKVK	0	15
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	DRB5-0102	PPAFDLFEAFAKVKL	1	16
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	DRB5-0103	LPPAFDLFEAFAKVK	0	15
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	DRB5-0103	PPAFDLFEAFAKVKL	1	16
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	DRB5-0104	LPPAFDLFEAFAKVK	0	15
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	DRB5-0104	PPAFDLFEAFAKVKL	1	16
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	DRB5-0105	LPPAFDLFEAFAKVK	0	15
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	DRB5-0105	PPAFDLFEAFAKVKL	1	16
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	DRB5-0108N	LPPAFDLFEAFAKVK	0	15
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	DRB5-0108N	PPAFDLFEAFAKVKL	1	16
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	DRB5-0111	LPPAFDLFEAFAKVK	0	15
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	DRB5-0111	PPAFDLFEAFAKVKL	1	16
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	DRB5-0113	LPPAFDLFEAFAKVK	0	15
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	DRB5-0113	PPAFDLFEAFAKVKL	1	16
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	DRB5-0114	LPPAFDLFEAFAKVK	0	15
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	DRB5-0114	PPAFDLFEAFAKVKL	1	16
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	DRB5-0203	LPPAFDLFEAFAKVK	0	15
SMYD3-TRIM58	chr1	246490502	chr1	248023918	531	DRB5-0203	PPAFDLFEAFAKVKL	1	16

Top

Fusion breakpoint peptide structures of SMYD3-TRIM58

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
4952	LFEAFAKVKLQMAL	SMYD3	TRIM58	chr1	246490502	chr1	248023918	531

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of SMYD3-TRIM58

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	4952	LFEAFAKVKLQMAL	-7.9962	-8.1096
HLA-B14:02	3BVN	4952	LFEAFAKVKLQMAL	-5.70842	-6.74372
HLA-B52:01	3W39	4952	LFEAFAKVKLQMAL	-6.83737	-6.95077
HLA-B52:01	3W39	4952	LFEAFAKVKLQMAL	-4.4836	-5.5189
HLA-A11:01	4UQ2	4952	LFEAFAKVKLQMAL	-10.0067	-10.1201
HLA-A11:01	4UQ2	4952	LFEAFAKVKLQMAL	-9.03915	-10.0745
HLA-A24:02	5HGA	4952	LFEAFAKVKLQMAL	-6.56204	-6.67544
HLA-A24:02	5HGA	4952	LFEAFAKVKLQMAL	-5.42271	-6.45801
HLA-B44:05	3DX8	4952	LFEAFAKVKLQMAL	-7.85648	-8.89178
HLA-B44:05	3DX8	4952	LFEAFAKVKLQMAL	-5.3978	-5.5112
HLA-A02:01	6TDR	4952	LFEAFAKVKLQMAL	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of SMYD3-TRIM58

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
SMYD3-TRIM58	chr1	246490502	chr1	248023918	10	18	FAKVKLQM	TTTGCAAAAGTAAAGCTCCAGATG
SMYD3-TRIM58	chr1	246490502	chr1	248023918	10	20	FAKVKLQMAL	TTTGCAAAAGTAAAGCTCCAGATGGCTCTG
SMYD3-TRIM58	chr1	246490502	chr1	248023918	11	20	AKVKLQMAL	GCAAAAGTAAAGCTCCAGATGGCTCTG
SMYD3-TRIM58	chr1	246490502	chr1	248023918	3	14	AFDLFEAFAKV	GCCTTTGACCTTTTTGAAGCCTTTGCAAAAGTA
SMYD3-TRIM58	chr1	246490502	chr1	248023918	4	14	FDLFEAFAKV	TTTGACCTTTTTGAAGCCTTTGCAAAAGTA
SMYD3-TRIM58	chr1	246490502	chr1	248023918	5	14	DLFEAFAKV	GACCTTTTTGAAGCCTTTGCAAAAGTA
SMYD3-TRIM58	chr1	246490502	chr1	248023918	7	16	FEAFAKVKL	TTTGAAGCCTTTGCAAAAGTAAAGCTC
SMYD3-TRIM58	chr1	246490502	chr1	248023918	8	16	EAFAKVKL	GAAGCCTTTGCAAAAGTAAAGCTC
SMYD3-TRIM58	chr1	246490502	chr1	248023918	9	18	AFAKVKLQM	GCCTTTGCAAAAGTAAAGCTCCAGATG

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
SMYD3-TRIM58	chr1	246490502	chr1	248023918	0	15	LPPAFDLFEAFAKVK	CTGCCACCTGCCTTTGACCTTTTTGAAGCCTTTGCAAAAGTAAAG
SMYD3-TRIM58	chr1	246490502	chr1	248023918	1	16	PPAFDLFEAFAKVKL	CCACCTGCCTTTGACCTTTTTGAAGCCTTTGCAAAAGTAAAGCTC

Top

Information of the samples that have these potential fusion neoantigens of SMYD3-TRIM58

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
PRAD	SMYD3-TRIM58	chr1	246490502	ENST00000388985	chr1	248023918	ENST00000366481	TCGA-EJ-7789

Top

Potential target of CAR-T therapy development for SMYD3-TRIM58

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to SMYD3-TRIM58

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to SMYD3-TRIM58

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)