Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:STIM1-WT1

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: STIM1-WT1
	FusionPDB ID: 87410
	FusionGDB2.0 ID: 87410
		Hgene	Tgene
	Gene symbol	STIM1	WT1
	Gene ID	6786	7490
	Gene name	stromal interaction molecule 1	WT1 transcription factor
	Synonyms	D11S4896E\|GOK\|IMD10\|STRMK\|TAM\|TAM1	AWT1\|GUD\|NPHS4\|WAGR\|WIT-2\|WT33
	Cytomap	11p15.4	11p13
	Type of gene	protein-coding	protein-coding
	Description	stromal interaction molecule 1	Wilms tumor proteinWilms tumor 1
	Modification date	20200329	20200320
	UniProtAcc	.	P19544 Main function of 5'-partner protein: FUNCTION: Transcription factor that plays an important role in cellular development and cell survival (PubMed:7862533). Recognizes and binds to the DNA sequence 5'-GCG(T/G)GGGCG-3' (PubMed:7862533, PubMed:17716689, PubMed:25258363). Regulates the expression of numerous target genes, including EPO. Plays an essential role for development of the urogenital system. It has a tumor suppressor as well as an oncogenic role in tumor formation. Function may be isoform-specific: isoforms lacking the KTS motif may act as transcription factors (PubMed:15520190). Isoforms containing the KTS motif may bind mRNA and play a role in mRNA metabolism or splicing (PubMed:16934801). Isoform 1 has lower affinity for DNA, and can bind RNA (PubMed:19123921). {ECO:0000269\|PubMed:15520190, ECO:0000269\|PubMed:16934801, ECO:0000269\|PubMed:17716689, ECO:0000269\|PubMed:19123921, ECO:0000269\|PubMed:19416806, ECO:0000269\|PubMed:25258363, ECO:0000269\|PubMed:7862533}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000527484, ENST00000300737, ENST00000527651, ENST00000533977,	ENST00000332351, ENST00000379079, ENST00000448076, ENST00000530998,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	21 X 13 X 12=3276	3 X 6 X 5=90
	# samples	23	4
	** MAII score	log2(23/3276*10)=-3.83222959069663 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(4/90*10)=-1.16992500144231 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: STIM1 [Title/Abstract] AND WT1 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: STIM1 [Title/Abstract] AND WT1 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	STIM1(4076867)-WT1(32421590), # samples:1
Anticipated loss of major functional domain due to fusion event.	STIM1-WT1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. STIM1-WT1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. STIM1-WT1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. STIM1-WT1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	STIM1	GO:0002115	store-operated calcium entry	28219928
Hgene	STIM1	GO:0005513	detection of calcium ion	16005298
Hgene	STIM1	GO:0032237	activation of store-operated calcium channel activity	16005298\|26322679\|28219928
Hgene	STIM1	GO:0045762	positive regulation of adenylate cyclase activity	19171672
Hgene	STIM1	GO:0051924	regulation of calcium ion transport	16005298
Tgene	WT1	GO:0000122	negative regulation of transcription by RNA polymerase II	7585606
Tgene	WT1	GO:0007530	sex determination	9815658
Tgene	WT1	GO:0008285	negative regulation of cell proliferation	9553041\|9765217
Tgene	WT1	GO:0030308	negative regulation of cell growth	9553041\|9765217
Tgene	WT1	GO:0045892	negative regulation of transcription, DNA-templated	1332065\|7585606\|7720589\|8119964\|12802290\|14701728\|19050011
Tgene	WT1	GO:0045893	positive regulation of transcription, DNA-templated	8132626\|9178767\|9553041\|9765217\|12802290\|14701728\|16467207\|21390327
Tgene	WT1	GO:0045944	positive regulation of transcription by RNA polymerase II	23042785
Tgene	WT1	GO:0071371	cellular response to gonadotropin stimulus	15961562

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr11:4076867/chr11:32421590)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across STIM1 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across WT1 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000300737	STIM1	chr11	4076867	+	ENST00000379079	WT1	chr11	32421590	-	2893	1066	554	1609	351
ENST00000300737	STIM1	chr11	4076867	+	ENST00000332351	WT1	chr11	32421590	-	2902	1066	554	1618	354
ENST00000300737	STIM1	chr11	4076867	+	ENST00000530998	WT1	chr11	32421590	-	2899	1066	554	1618	354
ENST00000300737	STIM1	chr11	4076867	+	ENST00000448076	WT1	chr11	32421590	-	1989	1066	554	1609	351
ENST00000527651	STIM1	chr11	4076867	+	ENST00000379079	WT1	chr11	32421590	-	2413	586	74	1129	351
ENST00000527651	STIM1	chr11	4076867	+	ENST00000332351	WT1	chr11	32421590	-	2422	586	74	1138	354
ENST00000527651	STIM1	chr11	4076867	+	ENST00000530998	WT1	chr11	32421590	-	2419	586	74	1138	354
ENST00000527651	STIM1	chr11	4076867	+	ENST00000448076	WT1	chr11	32421590	-	1509	586	74	1129	351

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000300737	ENST00000379079	STIM1	chr11	4076867	+	WT1	chr11	32421590	-	0.00281895	0.99718106
ENST00000300737	ENST00000332351	STIM1	chr11	4076867	+	WT1	chr11	32421590	-	0.002580013	0.99741995
ENST00000300737	ENST00000530998	STIM1	chr11	4076867	+	WT1	chr11	32421590	-	0.002614367	0.9973857
ENST00000300737	ENST00000448076	STIM1	chr11	4076867	+	WT1	chr11	32421590	-	0.023239242	0.97676075
ENST00000527651	ENST00000379079	STIM1	chr11	4076867	+	WT1	chr11	32421590	-	0.001381308	0.9986187
ENST00000527651	ENST00000332351	STIM1	chr11	4076867	+	WT1	chr11	32421590	-	0.001304796	0.9986952
ENST00000527651	ENST00000530998	STIM1	chr11	4076867	+	WT1	chr11	32421590	-	0.001309107	0.9986909
ENST00000527651	ENST00000448076	STIM1	chr11	4076867	+	WT1	chr11	32421590	-	0.008601601	0.99139833

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for STIM1-WT1

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
STIM1	chr11	4076867	WT1	chr11	32421590	1066	170	TFRKLQLSGHAMPSHSTGYESDNHTT
STIM1	chr11	4076867	WT1	chr11	32421590	586	170	TFRKLQLSGHAMPSHSTGYESDNHTT

Top

Potential FusionNeoAntigen Information of STIM1-WT1 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

STIM1-WT1_4076867_32421590.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B35:01	MPSHSTGY	0.9936	0.9185	11	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B35:08	MPSHSTGY	0.9835	0.9426	11	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B35:05	MPSHSTGY	0.9451	0.5636	11	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B15:01	AMPSHSTGY	0.9986	0.8738	10	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B15:25	AMPSHSTGY	0.9775	0.8937	10	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B15:02	AMPSHSTGY	0.9624	0.9076	10	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B39:01	GHAMPSHST	0.9308	0.9645	8	17
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B39:06	GHAMPSHST	0.9223	0.9234	8	17
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B15:10	GHAMPSHST	0.5462	0.6593	8	17
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B15:03	AMPSHSTGY	0.3719	0.7572	10	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B15:01	HAMPSHSTGY	0.9997	0.8702	9	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B15:25	HAMPSHSTGY	0.9996	0.892	9	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B15:02	HAMPSHSTGY	0.9991	0.9028	9	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B35:08	HAMPSHSTGY	0.9983	0.8913	9	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B15:17	HAMPSHSTGY	0.9977	0.85	9	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B35:01	HAMPSHSTGY	0.9962	0.8965	9	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B35:05	HAMPSHSTGY	0.9852	0.5584	9	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B15:03	HAMPSHSTGY	0.9847	0.7404	9	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B15:16	HAMPSHSTGY	0.9735	0.8105	9	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B39:06	SGHAMPSHST	0.4129	0.8941	7	17
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B15:18	GHAMPSHSTGY	0.9111	0.7509	8	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B15:07	AMPSHSTGY	0.9909	0.6454	10	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B15:21	AMPSHSTGY	0.9641	0.893	10	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B39:05	GHAMPSHST	0.8883	0.9581	8	17
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B15:05	AMPSHSTGY	0.882	0.9094	10	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B15:31	AMPSHSTGY	0.8627	0.9164	10	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B15:04	AMPSHSTGY	0.8142	0.8871	10	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B15:07	HAMPSHSTGY	0.9993	0.6654	9	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B15:21	HAMPSHSTGY	0.9991	0.8809	9	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B15:05	HAMPSHSTGY	0.9983	0.8713	9	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-C15:04	HAMPSHSTGY	0.9967	0.9307	9	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B15:31	HAMPSHSTGY	0.9965	0.8789	9	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B15:04	HAMPSHSTGY	0.981	0.8975	9	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-C03:14	HAMPSHSTGY	0.9633	0.9814	9	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-C12:12	HAMPSHSTGY	0.9491	0.8878	9	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-C12:04	HAMPSHSTGY	0.934	0.9933	9	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-C06:03	HAMPSHSTGY	0.9297	0.9885	9	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B35:23	MPSHSTGY	0.9937	0.9011	11	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B35:77	MPSHSTGY	0.9936	0.9185	11	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B35:11	MPSHSTGY	0.9857	0.9036	11	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B35:24	MPSHSTGY	0.979	0.8703	11	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B35:30	MPSHSTGY	0.9733	0.7855	11	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B35:17	MPSHSTGY	0.9733	0.7855	11	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B15:08	MPSHSTGY	0.9459	0.8105	11	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B15:11	MPSHSTGY	0.945	0.8004	11	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B35:43	MPSHSTGY	0.9349	0.815	11	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B18:07	MPSHSTGY	0.7074	0.859	11	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B15:27	AMPSHSTGY	0.9986	0.8927	10	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B15:33	AMPSHSTGY	0.9986	0.8738	10	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B15:34	AMPSHSTGY	0.9986	0.8738	10	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B15:125	AMPSHSTGY	0.9986	0.8738	10	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B15:50	AMPSHSTGY	0.9986	0.9143	10	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B15:135	AMPSHSTGY	0.9985	0.8848	10	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B15:12	AMPSHSTGY	0.996	0.8978	10	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B15:53	AMPSHSTGY	0.9936	0.8654	10	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B15:35	AMPSHSTGY	0.9926	0.8603	10	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B15:39	AMPSHSTGY	0.9758	0.8099	10	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B15:20	AMPSHSTGY	0.8848	0.9389	10	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B15:54	AMPSHSTGY	0.8499	0.8412	10	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B35:28	AMPSHSTGY	0.8291	0.9389	10	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B15:09	GHAMPSHST	0.5873	0.9373	8	17
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B39:11	GHAMPSHST	0.4205	0.9367	8	17
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B15:68	AMPSHSTGY	0.3286	0.6125	10	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-C14:02	AMPSHSTGY	0.0125	0.9724	10	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-C14:03	AMPSHSTGY	0.0125	0.9724	10	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B15:33	HAMPSHSTGY	0.9997	0.8702	9	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B15:34	HAMPSHSTGY	0.9997	0.8702	9	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B15:125	HAMPSHSTGY	0.9997	0.8702	9	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B15:27	HAMPSHSTGY	0.9997	0.9037	9	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B15:135	HAMPSHSTGY	0.9997	0.8867	9	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B15:08	HAMPSHSTGY	0.9996	0.833	9	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B15:53	HAMPSHSTGY	0.9996	0.8586	9	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B15:11	HAMPSHSTGY	0.9996	0.8362	9	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B35:43	HAMPSHSTGY	0.9995	0.8321	9	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B15:39	HAMPSHSTGY	0.9995	0.8091	9	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B15:50	HAMPSHSTGY	0.9994	0.904	9	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B35:11	HAMPSHSTGY	0.9992	0.871	9	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B15:35	HAMPSHSTGY	0.9991	0.8875	9	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B15:24	HAMPSHSTGY	0.9987	0.931	9	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B15:12	HAMPSHSTGY	0.9985	0.7752	9	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B15:20	HAMPSHSTGY	0.9984	0.9214	9	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B57:04	HAMPSHSTGY	0.998	0.9013	9	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-C03:02	HAMPSHSTGY	0.9973	0.9674	9	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B35:28	HAMPSHSTGY	0.9971	0.9244	9	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-C15:09	HAMPSHSTGY	0.9967	0.9307	9	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B35:77	HAMPSHSTGY	0.9962	0.8965	9	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B35:20	HAMPSHSTGY	0.9961	0.9275	9	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B35:23	HAMPSHSTGY	0.9957	0.913	9	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B35:17	HAMPSHSTGY	0.9926	0.7802	9	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B35:30	HAMPSHSTGY	0.9926	0.7802	9	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B58:06	HAMPSHSTGY	0.9911	0.9191	9	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B15:13	HAMPSHSTGY	0.9902	0.7223	9	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B15:54	HAMPSHSTGY	0.9895	0.8321	9	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-C12:02	HAMPSHSTGY	0.9753	0.9696	9	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-C16:04	HAMPSHSTGY	0.9751	0.9743	9	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-C02:02	HAMPSHSTGY	0.962	0.9855	9	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-C02:10	HAMPSHSTGY	0.962	0.9855	9	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B35:24	HAMPSHSTGY	0.9542	0.895	9	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-A25:01	HAMPSHSTGY	0.9529	0.9316	9	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-C12:03	HAMPSHSTGY	0.9414	0.9672	9	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-C16:01	HAMPSHSTGY	0.9065	0.9811	9	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-C16:02	HAMPSHSTGY	0.8964	0.9939	9	19
STIM1-WT1	chr11	4076867	chr11	32421590	1066	HLA-B18:04	HAMPSHSTGY	0.6356	0.9238	9	19

Top

Potential FusionNeoAntigen Information of STIM1-WT1 in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of STIM1-WT1

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
5624	LSGHAMPSHSTGYE	STIM1	WT1	chr11	4076867	chr11	32421590	1066

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of STIM1-WT1

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	5624	LSGHAMPSHSTGYE	-6.66111	-6.77451
HLA-B14:02	3BVN	5624	LSGHAMPSHSTGYE	-6.49216	-7.52746
HLA-B52:01	3W39	5624	LSGHAMPSHSTGYE	-5.57342	-5.68682
HLA-B52:01	3W39	5624	LSGHAMPSHSTGYE	-3.59959	-4.63489
HLA-A11:01	4UQ2	5624	LSGHAMPSHSTGYE	-3.54213	-3.65553
HLA-A24:02	5HGA	5624	LSGHAMPSHSTGYE	-7.6647	-7.7781
HLA-A24:02	5HGA	5624	LSGHAMPSHSTGYE	-4.05482	-5.09012
HLA-B44:05	3DX8	5624	LSGHAMPSHSTGYE	-5.24587	-5.35927
HLA-B44:05	3DX8	5624	LSGHAMPSHSTGYE	-4.91507	-5.95037
HLA-A02:01	6TDR	5624	LSGHAMPSHSTGYE	-3.67735	-4.71265

Top

Vaccine Design for the FusionNeoAntigens of STIM1-WT1

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
STIM1-WT1	chr11	4076867	chr11	32421590	10	19	AMPSHSTGY	CATGCCAAGCCACAGCACAGGGTACGA
STIM1-WT1	chr11	4076867	chr11	32421590	11	19	MPSHSTGY	GCCAAGCCACAGCACAGGGTACGA
STIM1-WT1	chr11	4076867	chr11	32421590	7	17	SGHAMPSHST	TGGCCATGCCATGCCAAGCCACAGCACAGG
STIM1-WT1	chr11	4076867	chr11	32421590	8	17	GHAMPSHST	CCATGCCATGCCAAGCCACAGCACAGG
STIM1-WT1	chr11	4076867	chr11	32421590	8	19	GHAMPSHSTGY	CCATGCCATGCCAAGCCACAGCACAGGGTACGA
STIM1-WT1	chr11	4076867	chr11	32421590	9	19	HAMPSHSTGY	TGCCATGCCAAGCCACAGCACAGGGTACGA

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of STIM1-WT1

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
OV	STIM1-WT1	chr11	4076867	ENST00000300737	chr11	32421590	ENST00000332351	TCGA-23-1028

Top

Potential target of CAR-T therapy development for STIM1-WT1

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to STIM1-WT1

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to STIM1-WT1

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner	Gene	Disease ID	Disease name	# pubmeds	Source
Tgene	WT1	C0950121	Denys-Drash Syndrome	20	CTD_human;GENOMICS_ENGLAND;ORPHANET;UNIPROT
Tgene	WT1	C0027708	Nephroblastoma	8	CGI;CTD_human;GENOMICS_ENGLAND;ORPHANET;UNIPROT
Tgene	WT1	C3151568	NEPHROTIC SYNDROME, TYPE 4	6	CTD_human;GENOMICS_ENGLAND;UNIPROT
Tgene	WT1	C0950122	Frasier Syndrome	4	CTD_human;GENOMICS_ENGLAND;ORPHANET;UNIPROT
Tgene	WT1	C1837026	MEACHAM SYNDROME (disorder)	3	CTD_human;GENOMICS_ENGLAND;ORPHANET;UNIPROT
Tgene	WT1	C0023467	Leukemia, Myelocytic, Acute	2	CGI;CTD_human
Tgene	WT1	C0026998	Acute Myeloid Leukemia, M1	2	CTD_human
Tgene	WT1	C0345967	Malignant mesothelioma	2	CTD_human;GENOMICS_ENGLAND
Tgene	WT1	C1879321	Acute Myeloid Leukemia (AML-M2)	2	CTD_human
Tgene	WT1	C2930471	Bilateral Wilms Tumor	2	CTD_human
Tgene	WT1	C0006142	Malignant neoplasm of breast	1	CTD_human
Tgene	WT1	C0007102	Malignant tumor of colon	1	CTD_human
Tgene	WT1	C0009375	Colonic Neoplasms	1	CTD_human
Tgene	WT1	C0017636	Glioblastoma	1	CTD_human
Tgene	WT1	C0017658	Glomerulonephritis	1	CTD_human
Tgene	WT1	C0018054	Gonadal Dysgenesis, 46,XY	1	ORPHANET
Tgene	WT1	C0019284	Diaphragmatic Hernia	1	CTD_human
Tgene	WT1	C0023418	leukemia	1	CTD_human
Tgene	WT1	C0023473	Myeloid Leukemia, Chronic	1	CTD_human
Tgene	WT1	C0023487	Acute Promyelocytic Leukemia	1	CTD_human
Tgene	WT1	C0024121	Lung Neoplasms	1	CTD_human
Tgene	WT1	C0027809	Neurilemmoma	1	CTD_human
Tgene	WT1	C0029463	Osteosarcoma	1	CTD_human
Tgene	WT1	C0030297	Pancreatic Neoplasm	1	CTD_human
Tgene	WT1	C0031149	Peritoneal Neoplasms	1	CTD_human
Tgene	WT1	C0085215	Ovarian Failure, Premature	1	CTD_human
Tgene	WT1	C0086367	Gonadotropin-Resistant Ovary Syndrome	1	CTD_human
Tgene	WT1	C0206115	WAGR Syndrome	1	CTD_human;GENOMICS_ENGLAND;ORPHANET
Tgene	WT1	C0235833	Congenital diaphragmatic hernia	1	CTD_human
Tgene	WT1	C0242379	Malignant neoplasm of lung	1	CTD_human
Tgene	WT1	C0265699	Congenital hernia of foramen of Morgagni	1	CTD_human
Tgene	WT1	C0265700	Congenital hernia of foramen of Bochdalek	1	CTD_human
Tgene	WT1	C0334588	Giant Cell Glioblastoma	1	CTD_human
Tgene	WT1	C0346647	Malignant neoplasm of pancreas	1	CTD_human
Tgene	WT1	C0346990	Carcinomatosis of peritoneal cavity	1	CTD_human
Tgene	WT1	C0678222	Breast Carcinoma	1	CTD_human
Tgene	WT1	C0751374	Schwannomatosis, Plexiform	1	CTD_human
Tgene	WT1	C1257931	Mammary Neoplasms, Human	1	CTD_human
Tgene	WT1	C1458155	Mammary Neoplasms	1	CTD_human
Tgene	WT1	C1621958	Glioblastoma Multiforme	1	CTD_human
Tgene	WT1	C1704377	Bright Disease	1	CTD_human
Tgene	WT1	C1840452	Hyaloideoretinal degeneration of Wagner	1	GENOMICS_ENGLAND
Tgene	WT1	C1868672	NEPHROTIC SYNDROME, STEROID-RESISTANT, AUTOSOMAL RECESSIVE	1	ORPHANET
Tgene	WT1	C2931803	Deletion 11p13	1	ORPHANET
Tgene	WT1	C2936694	Swyer Syndrome	1	ORPHANET
Tgene	WT1	C3494522	Hypergonadotropic Ovarian Failure, X-Linked	1	CTD_human
Tgene	WT1	C4510744	46,XY partial gonadal dysgenesis	1	ORPHANET
Tgene	WT1	C4552079	Premature Ovarian Failure 1	1	CTD_human
Tgene	WT1	C4704874	Mammary Carcinoma, Human	1	CTD_human

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)