Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:SUZ12-TAC4

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: SUZ12-TAC4
	FusionPDB ID: 88263
	FusionGDB2.0 ID: 88263
		Hgene	Tgene
	Gene symbol	SUZ12	TAC4
	Gene ID	23512	255061
	Gene name	SUZ12 polycomb repressive complex 2 subunit	tachykinin precursor 4
	Synonyms	CHET9\|IMMAS\|JJAZ1	EK\|HK-1\|HK1\|PPT-C
	Cytomap	17q11.2	17q21.33
	Type of gene	protein-coding	protein-coding
	Description	polycomb protein SUZ12chET 9 proteinchromatin precipitated E2F target 9 proteinjoined to JAZF1 proteinsuppressor of zeste 12 protein homolog	tachykinin-4endokininpreprotachykinin-Ctachykinin 4 (hemokinin)
	Modification date	20200313	20200313
	UniProtAcc	Q15022 Main function of 5'-partner protein: FUNCTION: Polycomb group (PcG) protein. Component of the PRC2 complex, which methylates 'Lys-9' (H3K9me) and 'Lys-27' (H3K27me) of histone H3, leading to transcriptional repression of the affected target gene (PubMed:15225548, PubMed:15231737, PubMed:15385962, PubMed:16618801, PubMed:17344414, PubMed:18285464, PubMed:28229514, PubMed:29499137, PubMed:31959557). The PRC2 complex may also serve as a recruiting platform for DNA methyltransferases, thereby linking two epigenetic repression systems (PubMed:12435631, PubMed:12351676, PubMed:15385962, PubMed:15099518, PubMed:15225548, PubMed:15684044, PubMed:16431907, PubMed:18086877, PubMed:18285464). Genes repressed by the PRC2 complex include HOXC8, HOXA9, MYT1 and CDKN2A (PubMed:15231737, PubMed:16618801, PubMed:17200670, PubMed:31959557). {ECO:0000269\|PubMed:12351676, ECO:0000269\|PubMed:12435631, ECO:0000269\|PubMed:15099518, ECO:0000269\|PubMed:15225548, ECO:0000269\|PubMed:15231737, ECO:0000269\|PubMed:15385962, ECO:0000269\|PubMed:15684044, ECO:0000269\|PubMed:16431907, ECO:0000269\|PubMed:16618801, ECO:0000269\|PubMed:17200670, ECO:0000269\|PubMed:17344414, ECO:0000269\|PubMed:18086877, ECO:0000269\|PubMed:18285464, ECO:0000269\|PubMed:28229514, ECO:0000269\|PubMed:29499137, ECO:0000269\|PubMed:31959557}.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000322652, ENST00000580398,	ENST00000326219, ENST00000334568, ENST00000352793, ENST00000398154, ENST00000436235,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	15 X 12 X 10=1800	3 X 2 X 2=12
	# samples	15	4
	** MAII score	log2(15/1800*10)=-3.58496250072116 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(4/12*10)=1.73696559416621 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0
Fusion gene context	PubMed: SUZ12 [Title/Abstract] AND TAC4 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: SUZ12 [Title/Abstract] AND TAC4 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	SUZ12(30320352)-TAC4(47921519), # samples:1
Anticipated loss of major functional domain due to fusion event.	SUZ12-TAC4 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. SUZ12-TAC4 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. SUZ12-TAC4 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. SUZ12-TAC4 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Tgene	TAC4	GO:1902093	positive regulation of flagellated sperm motility	17437961

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr17:30320352/chr17:47921519)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across SUZ12 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across TAC4 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000322652	SUZ12	chr17	30320352	+	ENST00000326219	TAC4	chr17	47921519	-	2014	1522	37	1680	547
ENST00000322652	SUZ12	chr17	30320352	+	ENST00000352793	TAC4	chr17	47921519	-	1981	1522	37	1647	536
ENST00000322652	SUZ12	chr17	30320352	+	ENST00000436235	TAC4	chr17	47921519	-	2074	1522	37	1740	567
ENST00000322652	SUZ12	chr17	30320352	+	ENST00000398154	TAC4	chr17	47921519	-	2041	1522	37	1707	556
ENST00000322652	SUZ12	chr17	30320352	+	ENST00000334568	TAC4	chr17	47921519	-	2074	1522	37	1740	567
ENST00000580398	SUZ12	chr17	30320352	+	ENST00000326219	TAC4	chr17	47921519	-	1896	1404	108	1562	484
ENST00000580398	SUZ12	chr17	30320352	+	ENST00000352793	TAC4	chr17	47921519	-	1863	1404	108	1529	473
ENST00000580398	SUZ12	chr17	30320352	+	ENST00000436235	TAC4	chr17	47921519	-	1956	1404	108	1622	504
ENST00000580398	SUZ12	chr17	30320352	+	ENST00000398154	TAC4	chr17	47921519	-	1923	1404	108	1589	493
ENST00000580398	SUZ12	chr17	30320352	+	ENST00000334568	TAC4	chr17	47921519	-	1956	1404	108	1622	504

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000322652	ENST00000326219	SUZ12	chr17	30320352	+	TAC4	chr17	47921519	-	0.003813458	0.99618655
ENST00000322652	ENST00000352793	SUZ12	chr17	30320352	+	TAC4	chr17	47921519	-	0.003047454	0.99695253
ENST00000322652	ENST00000436235	SUZ12	chr17	30320352	+	TAC4	chr17	47921519	-	0.004149931	0.9958501
ENST00000322652	ENST00000398154	SUZ12	chr17	30320352	+	TAC4	chr17	47921519	-	0.003357105	0.99664295
ENST00000322652	ENST00000334568	SUZ12	chr17	30320352	+	TAC4	chr17	47921519	-	0.004149931	0.9958501
ENST00000580398	ENST00000326219	SUZ12	chr17	30320352	+	TAC4	chr17	47921519	-	0.003362428	0.9966376
ENST00000580398	ENST00000352793	SUZ12	chr17	30320352	+	TAC4	chr17	47921519	-	0.002508929	0.9974911
ENST00000580398	ENST00000436235	SUZ12	chr17	30320352	+	TAC4	chr17	47921519	-	0.004833436	0.99516654
ENST00000580398	ENST00000398154	SUZ12	chr17	30320352	+	TAC4	chr17	47921519	-	0.003507758	0.9964922
ENST00000580398	ENST00000334568	SUZ12	chr17	30320352	+	TAC4	chr17	47921519	-	0.004833436	0.99516654

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for SUZ12-TAC4

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
SUZ12	chr17	30320352	TAC4	chr17	47921519	1404	431	TPNENRQKLRIFYQEGAGPSIQLQLQ

Top

Potential FusionNeoAntigen Information of SUZ12-TAC4 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

SUZ12-TAC4_30320352_47921519.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
SUZ12-TAC4	chr17	30320352	chr17	47921519	1404	HLA-B48:01	YQEGAGPSI	0.9479	0.9513	12	21
SUZ12-TAC4	chr17	30320352	chr17	47921519	1404	HLA-B39:06	LRIFYQEGA	0.9469	0.981	8	17
SUZ12-TAC4	chr17	30320352	chr17	47921519	1404	HLA-B39:01	YQEGAGPSI	0.7726	0.9717	12	21
SUZ12-TAC4	chr17	30320352	chr17	47921519	1404	HLA-B39:13	YQEGAGPSI	0.7188	0.983	12	21
SUZ12-TAC4	chr17	30320352	chr17	47921519	1404	HLA-B38:01	YQEGAGPSI	0.6818	0.9929	12	21
SUZ12-TAC4	chr17	30320352	chr17	47921519	1404	HLA-B38:02	YQEGAGPSI	0.676	0.9927	12	21
SUZ12-TAC4	chr17	30320352	chr17	47921519	1404	HLA-B15:10	YQEGAGPSI	0.6433	0.7744	12	21
SUZ12-TAC4	chr17	30320352	chr17	47921519	1404	HLA-B13:02	YQEGAGPSI	0.6399	0.9915	12	21
SUZ12-TAC4	chr17	30320352	chr17	47921519	1404	HLA-B13:01	YQEGAGPSI	0.6008	0.9974	12	21
SUZ12-TAC4	chr17	30320352	chr17	47921519	1404	HLA-B15:37	YQEGAGPSI	0.346	0.797	12	21
SUZ12-TAC4	chr17	30320352	chr17	47921519	1404	HLA-B52:01	YQEGAGPSI	0.1526	0.9977	12	21
SUZ12-TAC4	chr17	30320352	chr17	47921519	1404	HLA-A24:25	FYQEGAGPSI	0.997	0.699	11	21
SUZ12-TAC4	chr17	30320352	chr17	47921519	1404	HLA-A24:20	FYQEGAGPSI	0.9965	0.6966	11	21
SUZ12-TAC4	chr17	30320352	chr17	47921519	1404	HLA-A24:31	FYQEGAGPSI	0.9962	0.647	11	21
SUZ12-TAC4	chr17	30320352	chr17	47921519	1404	HLA-A24:15	FYQEGAGPSI	0.9962	0.6986	11	21
SUZ12-TAC4	chr17	30320352	chr17	47921519	1404	HLA-A24:14	FYQEGAGPSI	0.9479	0.7434	11	21
SUZ12-TAC4	chr17	30320352	chr17	47921519	1404	HLA-B48:01	YQEGAGPSIQL	0.999	0.699	12	23
SUZ12-TAC4	chr17	30320352	chr17	47921519	1404	HLA-B39:01	YQEGAGPSIQL	0.9969	0.9144	12	23
SUZ12-TAC4	chr17	30320352	chr17	47921519	1404	HLA-B39:13	YQEGAGPSIQL	0.9952	0.9232	12	23
SUZ12-TAC4	chr17	30320352	chr17	47921519	1404	HLA-B13:01	YQEGAGPSIQL	0.982	0.9709	12	23
SUZ12-TAC4	chr17	30320352	chr17	47921519	1404	HLA-C05:09	YQEGAGPSI	0.9976	0.9807	12	21
SUZ12-TAC4	chr17	30320352	chr17	47921519	1404	HLA-C08:15	YQEGAGPSI	0.995	0.9894	12	21
SUZ12-TAC4	chr17	30320352	chr17	47921519	1404	HLA-B73:01	LRIFYQEGA	0.9846	0.9317	8	17
SUZ12-TAC4	chr17	30320352	chr17	47921519	1404	HLA-C08:13	YQEGAGPSI	0.8662	0.9927	12	21
SUZ12-TAC4	chr17	30320352	chr17	47921519	1404	HLA-C08:04	YQEGAGPSI	0.8662	0.9927	12	21
SUZ12-TAC4	chr17	30320352	chr17	47921519	1404	HLA-C08:03	YQEGAGPSI	0.8578	0.9953	12	21
SUZ12-TAC4	chr17	30320352	chr17	47921519	1404	HLA-B39:09	YQEGAGPSI	0.8324	0.9377	12	21
SUZ12-TAC4	chr17	30320352	chr17	47921519	1404	HLA-B48:03	YQEGAGPSI	0.7626	0.9329	12	21
SUZ12-TAC4	chr17	30320352	chr17	47921519	1404	HLA-B39:08	YQEGAGPSI	0.7569	0.8887	12	21
SUZ12-TAC4	chr17	30320352	chr17	47921519	1404	HLA-B39:05	YQEGAGPSI	0.654	0.9662	12	21
SUZ12-TAC4	chr17	30320352	chr17	47921519	1404	HLA-B51:07	YQEGAGPSI	0.0728	0.9968	12	21
SUZ12-TAC4	chr17	30320352	chr17	47921519	1404	HLA-A24:02	FYQEGAGPSI	0.9965	0.6966	11	21
SUZ12-TAC4	chr17	30320352	chr17	47921519	1404	HLA-B39:05	YQEGAGPSIQL	0.9959	0.897	12	23
SUZ12-TAC4	chr17	30320352	chr17	47921519	1404	HLA-B48:03	YQEGAGPSIQL	0.9919	0.6719	12	23
SUZ12-TAC4	chr17	30320352	chr17	47921519	1404	HLA-B39:08	YQEGAGPSIQL	0.9838	0.8666	12	23
SUZ12-TAC4	chr17	30320352	chr17	47921519	1404	HLA-C05:01	YQEGAGPSI	0.9976	0.9807	12	21
SUZ12-TAC4	chr17	30320352	chr17	47921519	1404	HLA-C04:03	YQEGAGPSI	0.9976	0.9444	12	21
SUZ12-TAC4	chr17	30320352	chr17	47921519	1404	HLA-C08:02	YQEGAGPSI	0.995	0.9894	12	21
SUZ12-TAC4	chr17	30320352	chr17	47921519	1404	HLA-B40:40	YQEGAGPSI	0.9906	0.6035	12	21
SUZ12-TAC4	chr17	30320352	chr17	47921519	1404	HLA-C08:01	YQEGAGPSI	0.8578	0.9953	12	21
SUZ12-TAC4	chr17	30320352	chr17	47921519	1404	HLA-C03:06	YQEGAGPSI	0.8299	0.9927	12	21
SUZ12-TAC4	chr17	30320352	chr17	47921519	1404	HLA-B39:02	YQEGAGPSI	0.8249	0.9818	12	21
SUZ12-TAC4	chr17	30320352	chr17	47921519	1404	HLA-B39:31	YQEGAGPSI	0.8175	0.9714	12	21
SUZ12-TAC4	chr17	30320352	chr17	47921519	1404	HLA-B40:12	YQEGAGPSI	0.7626	0.9329	12	21
SUZ12-TAC4	chr17	30320352	chr17	47921519	1404	HLA-B15:73	YQEGAGPSI	0.7621	0.9875	12	21
SUZ12-TAC4	chr17	30320352	chr17	47921519	1404	HLA-B15:30	YQEGAGPSI	0.7202	0.98	12	21
SUZ12-TAC4	chr17	30320352	chr17	47921519	1404	HLA-B39:11	YQEGAGPSI	0.6856	0.8738	12	21
SUZ12-TAC4	chr17	30320352	chr17	47921519	1404	HLA-B38:05	YQEGAGPSI	0.6818	0.9929	12	21
SUZ12-TAC4	chr17	30320352	chr17	47921519	1404	HLA-B40:49	YQEGAGPSI	0.6492	0.9168	12	21
SUZ12-TAC4	chr17	30320352	chr17	47921519	1404	HLA-A02:14	YQEGAGPSI	0.6489	0.6528	12	21
SUZ12-TAC4	chr17	30320352	chr17	47921519	1404	HLA-B40:21	YQEGAGPSI	0.6166	0.936	12	21
SUZ12-TAC4	chr17	30320352	chr17	47921519	1404	HLA-B15:09	YQEGAGPSI	0.3953	0.9495	12	21
SUZ12-TAC4	chr17	30320352	chr17	47921519	1404	HLA-B48:05	YQEGAGPSI	0.0942	0.5066	12	21
SUZ12-TAC4	chr17	30320352	chr17	47921519	1404	HLA-B07:13	YQEGAGPSI	0.0257	0.8755	12	21
SUZ12-TAC4	chr17	30320352	chr17	47921519	1404	HLA-C14:02	FYQEGAGPSI	0.8354	0.9806	11	21
SUZ12-TAC4	chr17	30320352	chr17	47921519	1404	HLA-C14:03	FYQEGAGPSI	0.8354	0.9806	11	21
SUZ12-TAC4	chr17	30320352	chr17	47921519	1404	HLA-B15:73	YQEGAGPSIQL	0.9982	0.9162	12	23
SUZ12-TAC4	chr17	30320352	chr17	47921519	1404	HLA-B15:30	YQEGAGPSIQL	0.998	0.9232	12	23
SUZ12-TAC4	chr17	30320352	chr17	47921519	1404	HLA-B39:02	YQEGAGPSIQL	0.9971	0.9272	12	23
SUZ12-TAC4	chr17	30320352	chr17	47921519	1404	HLA-B39:11	YQEGAGPSIQL	0.9937	0.8443	12	23
SUZ12-TAC4	chr17	30320352	chr17	47921519	1404	HLA-B40:12	YQEGAGPSIQL	0.9919	0.6719	12	23
SUZ12-TAC4	chr17	30320352	chr17	47921519	1404	HLA-B40:49	YQEGAGPSIQL	0.9893	0.6266	12	23
SUZ12-TAC4	chr17	30320352	chr17	47921519	1404	HLA-B40:21	YQEGAGPSIQL	0.9818	0.6833	12	23

Top

Potential FusionNeoAntigen Information of SUZ12-TAC4 in HLA II

SUZ12-TAC4_30320352_47921519.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
SUZ12-TAC4	chr17	30320352	chr17	47921519	1404	DRB1-1503	RQKLRIFYQEGAGPS	5	20
SUZ12-TAC4	chr17	30320352	chr17	47921519	1404	DRB1-1503	NRQKLRIFYQEGAGP	4	19
SUZ12-TAC4	chr17	30320352	chr17	47921519	1404	DRB1-1504	RQKLRIFYQEGAGPS	5	20
SUZ12-TAC4	chr17	30320352	chr17	47921519	1404	DRB1-1518	RQKLRIFYQEGAGPS	5	20
SUZ12-TAC4	chr17	30320352	chr17	47921519	1404	DRB1-1521	RQKLRIFYQEGAGPS	5	20
SUZ12-TAC4	chr17	30320352	chr17	47921519	1404	DRB1-1523	RQKLRIFYQEGAGPS	5	20
SUZ12-TAC4	chr17	30320352	chr17	47921519	1404	DRB1-1523	NRQKLRIFYQEGAGP	4	19

Top

Fusion breakpoint peptide structures of SUZ12-TAC4

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
7353	QKLRIFYQEGAGPS	SUZ12	TAC4	chr17	30320352	chr17	47921519	1404

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of SUZ12-TAC4

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	7353	QKLRIFYQEGAGPS	-7.9962	-8.1096
HLA-B14:02	3BVN	7353	QKLRIFYQEGAGPS	-5.70842	-6.74372
HLA-B52:01	3W39	7353	QKLRIFYQEGAGPS	-6.83737	-6.95077
HLA-B52:01	3W39	7353	QKLRIFYQEGAGPS	-4.4836	-5.5189
HLA-A11:01	4UQ2	7353	QKLRIFYQEGAGPS	-10.0067	-10.1201
HLA-A11:01	4UQ2	7353	QKLRIFYQEGAGPS	-9.03915	-10.0745
HLA-A24:02	5HGA	7353	QKLRIFYQEGAGPS	-6.56204	-6.67544
HLA-A24:02	5HGA	7353	QKLRIFYQEGAGPS	-5.42271	-6.45801
HLA-B44:05	3DX8	7353	QKLRIFYQEGAGPS	-7.85648	-8.89178
HLA-B44:05	3DX8	7353	QKLRIFYQEGAGPS	-5.3978	-5.5112
HLA-A02:01	6TDR	7353	QKLRIFYQEGAGPS	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of SUZ12-TAC4

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
SUZ12-TAC4	chr17	30320352	chr17	47921519	11	21	FYQEGAGPSI	TATCAGGAAGGCGCTGGCCCCAGCATTCAG
SUZ12-TAC4	chr17	30320352	chr17	47921519	12	21	YQEGAGPSI	CAGGAAGGCGCTGGCCCCAGCATTCAG
SUZ12-TAC4	chr17	30320352	chr17	47921519	12	23	YQEGAGPSIQL	CAGGAAGGCGCTGGCCCCAGCATTCAGCTCCAG
SUZ12-TAC4	chr17	30320352	chr17	47921519	8	17	LRIFYQEGA	AGAATATTTTATCAGGAAGGCGCTGGC

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
SUZ12-TAC4	chr17	30320352	chr17	47921519	4	19	NRQKLRIFYQEGAGP	CGACAAAAATTAAGAATATTTTATCAGGAAGGCGCTGGCCCCAGC
SUZ12-TAC4	chr17	30320352	chr17	47921519	5	20	RQKLRIFYQEGAGPS	CAAAAATTAAGAATATTTTATCAGGAAGGCGCTGGCCCCAGCATT

Top

Information of the samples that have these potential fusion neoantigens of SUZ12-TAC4

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
BRCA	SUZ12-TAC4	chr17	30320352	ENST00000580398	chr17	47921519	ENST00000326219	TCGA-A8-A06Q-01A

Top

Potential target of CAR-T therapy development for SUZ12-TAC4

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to SUZ12-TAC4

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to SUZ12-TAC4

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner	Gene	Disease ID	Disease name	# pubmeds	Source
Hgene	SUZ12	C0206727	Nerve Sheath Tumors	2	CTD_human
Hgene	SUZ12	C0751689	Peripheral Nerve Sheath Neoplasm	2	CTD_human
Hgene	SUZ12	C0751691	Perineurioma	2	CTD_human
Hgene	SUZ12	C0001430	Adenoma	1	CTD_human
Hgene	SUZ12	C0014170	Endometrial Neoplasms	1	CTD_human
Hgene	SUZ12	C0017636	Glioblastoma	1	CTD_human
Hgene	SUZ12	C0017638	Glioma	1	CTD_human
Hgene	SUZ12	C0025202	melanoma	1	CTD_human
Hgene	SUZ12	C0027809	Neurilemmoma	1	CTD_human
Hgene	SUZ12	C0027830	neurofibroma	1	CTD_human
Hgene	SUZ12	C0027962	Melanocytic nevus	1	CTD_human
Hgene	SUZ12	C0042063	Urogenital Abnormalities	1	GENOMICS_ENGLAND
Hgene	SUZ12	C0205646	Adenoma, Basal Cell	1	CTD_human
Hgene	SUZ12	C0205647	Follicular adenoma	1	CTD_human
Hgene	SUZ12	C0205648	Adenoma, Microcystic	1	CTD_human
Hgene	SUZ12	C0205649	Adenoma, Monomorphic	1	CTD_human
Hgene	SUZ12	C0205650	Papillary adenoma	1	CTD_human
Hgene	SUZ12	C0205651	Adenoma, Trabecular	1	CTD_human
Hgene	SUZ12	C0206630	Endometrial Stromal Sarcoma	1	ORPHANET
Hgene	SUZ12	C0259783	mixed gliomas	1	CTD_human
Hgene	SUZ12	C0265210	Weaver syndrome	1	ORPHANET
Hgene	SUZ12	C0334588	Giant Cell Glioblastoma	1	CTD_human
Hgene	SUZ12	C0476089	Endometrial Carcinoma	1	CTD_human
Hgene	SUZ12	C0545053	Advanced bone age	1	GENOMICS_ENGLAND
Hgene	SUZ12	C0555198	Malignant Glioma	1	CTD_human
Hgene	SUZ12	C0557874	Global developmental delay	1	GENOMICS_ENGLAND
Hgene	SUZ12	C0751374	Schwannomatosis, Plexiform	1	CTD_human
Hgene	SUZ12	C1621958	Glioblastoma Multiforme	1	CTD_human
Hgene	SUZ12	C1842581	Abnormal corpus callosum morphology	1	GENOMICS_ENGLAND
Hgene	SUZ12	C1849265	Overgrowth	1	GENOMICS_ENGLAND
Hgene	SUZ12	C3714756	Intellectual Disability	1	GENOMICS_ENGLAND
Hgene	SUZ12	C4018871	Abnormality of the respiratory system	1	GENOMICS_ENGLAND
Hgene	SUZ12	C4021664	Abnormality of the abdominal wall	1	GENOMICS_ENGLAND
Hgene	SUZ12	C4021790	Abnormality of the skeletal system	1	GENOMICS_ENGLAND

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)