Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:SYNDIG1-MYH9

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: SYNDIG1-MYH9
	FusionPDB ID: 88400
	FusionGDB2.0 ID: 88400
		Hgene	Tgene
	Gene symbol	SYNDIG1	MYH9
	Gene ID	79953	4627
	Gene name	synapse differentiation inducing 1	myosin heavy chain 9
	Synonyms	C20orf39\|DSPC2\|IFITMD5\|TMEM90B	BDPLT6\|DFNA17\|EPSTS\|FTNS\|MATINS\|MHA\|NMHC-II-A\|NMMHC-IIA\|NMMHCA
	Cytomap	20p11.21	22q12.3
	Type of gene	protein-coding	protein-coding
	Description	synapse differentiation-inducing gene protein 1dispanin subfamily C member 2interferon induced transmembrane protein domain containing 5synapse differentiation induced gene 1transmembrane protein 90B	myosin-9cellular myosin heavy chain, type Amyosin, heavy chain 9, non-musclenon-muscle myosin heavy chain 9non-muscle myosin heavy chain Anon-muscle myosin heavy chain IIanon-muscle myosin heavy polypeptide 9nonmuscle myosin heavy chain II-A
	Modification date	20200313	20200315
	UniProtAcc	.	P35579 Main function of 5'-partner protein: FUNCTION: Cellular myosin that appears to play a role in cytokinesis, cell shape, and specialized functions such as secretion and capping. Promotes also cell motility together with S100A4 (PubMed:16707441). During cell spreading, plays an important role in cytoskeleton reorganization, focal contacts formation (in the margins but not the central part of spreading cells), and lamellipodial retraction; this function is mechanically antagonized by MYH10 (PubMed:20052411). {ECO:0000250\|UniProtKB:Q8VDD5, ECO:0000269\|PubMed:16707441, ECO:0000269\|PubMed:20052411}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000482637, ENST00000376862,	ENST00000216181, ENST00000401701, ENST00000475726,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	1 X 1 X 1=1	44 X 46 X 15=30360
	# samples	1	56
	** MAII score	log2(1/1*10)=3.32192809488736	log2(56/30360*10)=-5.76060115335786 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: SYNDIG1 [Title/Abstract] AND MYH9 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: SYNDIG1 [Title/Abstract] AND MYH9 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	SYNDIG1(24565629)-MYH9(36705441), # samples:1
Anticipated loss of major functional domain due to fusion event.	SYNDIG1-MYH9 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. SYNDIG1-MYH9 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. SYNDIG1-MYH9 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. SYNDIG1-MYH9 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	SYNDIG1	GO:0051965	positive regulation of synapse assembly	20152115
Tgene	MYH9	GO:0001525	angiogenesis	16403913
Tgene	MYH9	GO:0001778	plasma membrane repair	27325790
Tgene	MYH9	GO:0006509	membrane protein ectodomain proteolysis	16186248
Tgene	MYH9	GO:0030048	actin filament-based movement	12237319\|15845534
Tgene	MYH9	GO:0031032	actomyosin structure organization	24072716

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr20:24565629/chr22:36705441)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across SYNDIG1 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across MYH9 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst

Tenst

Hgene

Hchr

Hbp

Hstrand

Tgene

Tchr

Tbp

Tstrand

Seq length
(transcript)

BP loci
(transcript)

Predicted start
(transcript)

Predicted stop
(transcript)

Seq length
(amino acids)

ENST00000376862

SYNDIG1

chr20

24565629

ENST00000216181

MYH9

chr22

36705441

6793

1251

606

5405

1599

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000376862	ENST00000216181	SYNDIG1	chr20	24565629	+	MYH9	chr22	36705441	-	0.021031082	0.97896886

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for SYNDIG1-MYH9

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
SYNDIG1	chr20	24565629	MYH9	chr22	36705441	1251	215	WPLGIAAFYLSHEVDYKADEWLMKNM

Top

Potential FusionNeoAntigen Information of SYNDIG1-MYH9 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

SYNDIG1-MYH9_24565629_36705441.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-B39:06	SHEVDYKA	0.9981	0.5672	10	18
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-B51:02	AAFYLSHEV	0.9967	0.7338	5	14
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-B51:01	AAFYLSHEV	0.9865	0.6477	5	14
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-B52:01	AAFYLSHEV	0.9841	0.9748	5	14
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-A02:21	AAFYLSHEV	0.946	0.7136	5	14
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-B13:02	AAFYLSHEV	0.9074	0.8829	5	14
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-B53:01	EVDYKADEW	0.8534	0.5084	12	21
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-B44:03	HEVDYKADEW	0.9988	0.9775	11	21
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-B44:05	HEVDYKADEW	0.9961	0.6001	11	21
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-C15:04	AAFYLSHEV	0.9995	0.9686	5	14
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-C15:06	AAFYLSHEV	0.9995	0.9711	5	14
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-C04:06	AAFYLSHEV	0.999	0.9549	5	14
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-C03:07	AAFYLSHEV	0.9979	0.9925	5	14
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-C03:19	AAFYLSHEV	0.9968	0.9961	5	14
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-C12:04	AAFYLSHEV	0.9949	0.9954	5	14
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-C06:03	AAFYLSHEV	0.9943	0.9952	5	14
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-B78:01	AAFYLSHEV	0.9915	0.7035	5	14
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-C12:12	AAFYLSHEV	0.991	0.9696	5	14
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-C03:08	AAFYLSHEV	0.9903	0.9465	5	14
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-B51:07	AAFYLSHEV	0.9864	0.9754	5	14
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-C08:04	AAFYLSHEV	0.9844	0.9836	5	14
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-C08:13	AAFYLSHEV	0.9844	0.9836	5	14
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-A02:05	AAFYLSHEV	0.9641	0.5932	5	14
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-C02:06	AAFYLSHEV	0.954	0.9894	5	14
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-B51:08	AAFYLSHEV	0.9237	0.5954	5	14
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-C08:03	AAFYLSHEV	0.8566	0.9928	5	14
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-B15:21	FYLSHEVDY	0.7277	0.8401	7	16
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-C12:16	FYLSHEVDY	0.3515	0.9499	7	16
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-C07:80	FYLSHEVDY	0.3412	0.8717	7	16
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-C07:67	FYLSHEVDY	0.3412	0.8717	7	16
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-C07:10	FYLSHEVDY	0.2996	0.9031	7	16
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-C07:27	FYLSHEVDY	0.2875	0.919	7	16
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-C07:46	FYLSHEVDY	0.2287	0.6953	7	16
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-C07:05	FYLSHEVDY	0.1377	0.9006	7	16
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-B44:08	HEVDYKADEW	0.9974	0.5364	11	21
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-B44:09	HEVDYKADEW	0.9961	0.6118	11	21
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-B44:10	HEVDYKADEW	0.853	0.7074	11	21
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-C15:02	AAFYLSHEV	0.9997	0.9673	5	14
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-C15:09	AAFYLSHEV	0.9995	0.9686	5	14
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-C15:05	AAFYLSHEV	0.9995	0.9781	5	14
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-C03:17	AAFYLSHEV	0.9983	0.9898	5	14
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-C03:05	AAFYLSHEV	0.998	0.9646	5	14
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-C16:02	AAFYLSHEV	0.9935	0.9948	5	14
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-C06:17	AAFYLSHEV	0.992	0.9954	5	14
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-C06:02	AAFYLSHEV	0.992	0.9954	5	14
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-C12:03	AAFYLSHEV	0.9913	0.9895	5	14
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-C16:04	AAFYLSHEV	0.9912	0.9896	5	14
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-B78:02	AAFYLSHEV	0.9904	0.7341	5	14
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-B51:13	AAFYLSHEV	0.986	0.5629	5	14
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-B51:14	AAFYLSHEV	0.9834	0.5862	5	14
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-C03:06	AAFYLSHEV	0.9816	0.9964	5	14
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-C03:04	AAFYLSHEV	0.9811	0.9952	5	14
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-C03:03	AAFYLSHEV	0.9811	0.9952	5	14
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-B51:09	AAFYLSHEV	0.9783	0.5407	5	14
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-A68:02	AAFYLSHEV	0.9636	0.7808	5	14
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-A69:01	AAFYLSHEV	0.9517	0.7424	5	14
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-A02:06	AAFYLSHEV	0.946	0.7136	5	14
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-C16:01	AAFYLSHEV	0.9454	0.9874	5	14
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-A02:14	AAFYLSHEV	0.9449	0.6749	5	14
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-B35:13	AAFYLSHEV	0.9403	0.9418	5	14
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-C12:02	AAFYLSHEV	0.9159	0.9858	5	14
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-C17:01	AAFYLSHEV	0.9086	0.9848	5	14
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-B51:21	AAFYLSHEV	0.8913	0.5931	5	14
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-C02:02	AAFYLSHEV	0.8619	0.9925	5	14
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-C02:10	AAFYLSHEV	0.8619	0.9925	5	14
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-C08:01	AAFYLSHEV	0.8566	0.9928	5	14
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-A25:01	EVDYKADEW	0.8222	0.8762	12	21
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-C06:08	AAFYLSHEV	0.8106	0.996	5	14
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-B53:02	EVDYKADEW	0.6479	0.6688	12	21
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-B07:13	AAFYLSHEV	0.485	0.8913	5	14
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-C07:02	FYLSHEVDY	0.3412	0.8717	7	16
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-C07:17	FYLSHEVDY	0.3246	0.9594	7	16
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-C06:06	FYLSHEVDY	0.0028	0.9765	7	16
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-C14:02	FYLSHEVDY	0.0005	0.8813	7	16
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-C14:03	FYLSHEVDY	0.0005	0.8813	7	16
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-B44:13	HEVDYKADEW	0.9988	0.9775	11	21
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-B44:07	HEVDYKADEW	0.9988	0.9775	11	21
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	HLA-B44:26	HEVDYKADEW	0.9988	0.9775	11	21

Top

Potential FusionNeoAntigen Information of SYNDIG1-MYH9 in HLA II

SYNDIG1-MYH9_24565629_36705441.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	DRB1-0904	IAAFYLSHEVDYKAD	4	19
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	1251	DRB1-0905	IAAFYLSHEVDYKAD	4	19

Top

Fusion breakpoint peptide structures of SYNDIG1-MYH9

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
210	AFYLSHEVDYKADE	SYNDIG1	MYH9	chr20	24565629	chr22	36705441	1251

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of SYNDIG1-MYH9

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	210	AFYLSHEVDYKADE	-7.15543	-7.26883
HLA-B14:02	3BVN	210	AFYLSHEVDYKADE	-4.77435	-5.80965
HLA-B52:01	3W39	210	AFYLSHEVDYKADE	-6.80875	-6.92215
HLA-B52:01	3W39	210	AFYLSHEVDYKADE	-4.20386	-5.23916
HLA-A11:01	4UQ2	210	AFYLSHEVDYKADE	-7.5194	-8.5547
HLA-A11:01	4UQ2	210	AFYLSHEVDYKADE	-6.9601	-7.0735
HLA-A24:02	5HGA	210	AFYLSHEVDYKADE	-7.52403	-7.63743
HLA-A24:02	5HGA	210	AFYLSHEVDYKADE	-5.82433	-6.85963
HLA-B27:05	6PYJ	210	AFYLSHEVDYKADE	-3.28285	-4.31815
HLA-B44:05	3DX8	210	AFYLSHEVDYKADE	-5.91172	-6.94702
HLA-B44:05	3DX8	210	AFYLSHEVDYKADE	-4.24346	-4.35686

Top

Vaccine Design for the FusionNeoAntigens of SYNDIG1-MYH9

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	10	18	SHEVDYKA	TCCCATGAGGTGGATTACAAAGCT
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	11	21	HEVDYKADEW	CATGAGGTGGATTACAAAGCTGACGAGTGG
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	12	21	EVDYKADEW	GAGGTGGATTACAAAGCTGACGAGTGG
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	5	14	AAFYLSHEV	GCAGCCTTCTACTTGTCCCATGAGGTG
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	7	16	FYLSHEVDY	TTCTACTTGTCCCATGAGGTGGATTAC

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
SYNDIG1-MYH9	chr20	24565629	chr22	36705441	4	19	IAAFYLSHEVDYKAD	ATCGCAGCCTTCTACTTGTCCCATGAGGTGGATTACAAAGCTGAC

Top

Information of the samples that have these potential fusion neoantigens of SYNDIG1-MYH9

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
COAD	SYNDIG1-MYH9	chr20	24565629	ENST00000376862	chr22	36705441	ENST00000216181	TCGA-D5-5537

Top

Potential target of CAR-T therapy development for SYNDIG1-MYH9

Predicted 3D structure. We used RoseTTAFold.

485_SYNDIG1-MYH9_t000_.e2e.pdb

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Hgene

SYNDIG1

chr20:24565629

chr22:36705441

ENST00000376862

182_202

206

259.0

Transmembrane

Helical

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene	Hchr	Hbp	Henst	Tgene	Tchr	Tbp	Tenst	DeepLoc result
SYNDIG1	chr20	24565629	ENST00000376862	MYH9	chr22	36705441	ENST00000216181

Top

Related Drugs to SYNDIG1-MYH9

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to SYNDIG1-MYH9

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)