Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:SZRD1-PRDM2

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: SZRD1-PRDM2
	FusionPDB ID: 88602
	FusionGDB2.0 ID: 88602
		Hgene	Tgene
	Gene symbol	SZRD1	PRDM2
	Gene ID	26099	7799
	Gene name	SUZ RNA binding domain containing 1	PR/SET domain 2
	Synonyms	C1orf144	HUMHOXY1\|KMT8\|KMT8A\|MTB-ZF\|RIZ\|RIZ1\|RIZ2
	Cytomap	1p36.13	1p36.21
	Type of gene	protein-coding	protein-coding
	Description	SUZ domain-containing protein 1UPF0485 protein C1orf144putative MAPK activating protein PM20,PM21putative MAPK-activating protein PM18/PM20/PM22	PR domain zinc finger protein 2GATA-3 binding protein G3BMTE-binding proteinPR domain 2PR domain containing 2, with ZNF domainPR domain-containing protein 2lysine N-methyltransferase 8retinoblastoma protein-binding zinc finger proteinretinoblastom
	Modification date	20200313	20200313
	UniProtAcc	.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000375590, ENST00000401088, ENST00000401089, ENST00000471507, ENST00000492354, ENST00000472461,	ENST00000502727, ENST00000343137, ENST00000413440, ENST00000503842, ENST00000505823, ENST00000235372, ENST00000311066, ENST00000376048,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	5 X 4 X 3=60	10 X 8 X 4=320
	# samples	5	11
	** MAII score	log2(5/60*10)=-0.263034405833794 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(11/320*10)=-1.5405683813627 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: SZRD1 [Title/Abstract] AND PRDM2 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: SZRD1 [Title/Abstract] AND PRDM2 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	SZRD1(16693803)-PRDM2(14075856), # samples:2
Anticipated loss of major functional domain due to fusion event.	SZRD1-PRDM2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. SZRD1-PRDM2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. SZRD1-PRDM2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. SZRD1-PRDM2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. SZRD1-PRDM2 seems lost the major protein functional domain in Hgene partner, which is a essential gene due to the frame-shifted ORF. SZRD1-PRDM2 seems lost the major protein functional domain in Tgene partner, which is a CGC due to the frame-shifted ORF. SZRD1-PRDM2 seems lost the major protein functional domain in Tgene partner, which is a epigenetic factor due to the frame-shifted ORF. SZRD1-PRDM2 seems lost the major protein functional domain in Tgene partner, which is a IUPHAR drug target due to the frame-shifted ORF. SZRD1-PRDM2 seems lost the major protein functional domain in Tgene partner, which is a transcription factor due to the frame-shifted ORF. SZRD1-PRDM2 seems lost the major protein functional domain in Tgene partner, which is a tumor suppressor due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Tgene	PRDM2	GO:0045944	positive regulation of transcription by RNA polymerase II	8654390

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr1:16693803/chr1:14075856)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across SZRD1 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across PRDM2 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000401088	SZRD1	chr1	16693803	+	ENST00000376048	PRDM2	chr1	14075856	+	2404	226	820	353	155
ENST00000401088	SZRD1	chr1	16693803	+	ENST00000311066	PRDM2	chr1	14075856	+	6423	226	175	4890	1571
ENST00000401088	SZRD1	chr1	16693803	+	ENST00000235372	PRDM2	chr1	14075856	+	6943	226	175	4998	1607
ENST00000471507	SZRD1	chr1	16693803	+	ENST00000376048	PRDM2	chr1	14075856	+	2399	221	815	348	155
ENST00000471507	SZRD1	chr1	16693803	+	ENST00000311066	PRDM2	chr1	14075856	+	6418	221	170	4885	1571
ENST00000471507	SZRD1	chr1	16693803	+	ENST00000235372	PRDM2	chr1	14075856	+	6938	221	170	4993	1607

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000401088	ENST00000376048	SZRD1	chr1	16693803	+	PRDM2	chr1	14075856	+	0.60277385	0.39722618
ENST00000401088	ENST00000311066	SZRD1	chr1	16693803	+	PRDM2	chr1	14075856	+	0.000245806	0.99975425
ENST00000401088	ENST00000235372	SZRD1	chr1	16693803	+	PRDM2	chr1	14075856	+	0.000368747	0.9996313
ENST00000471507	ENST00000376048	SZRD1	chr1	16693803	+	PRDM2	chr1	14075856	+	0.59893197	0.401068
ENST00000471507	ENST00000311066	SZRD1	chr1	16693803	+	PRDM2	chr1	14075856	+	0.000243302	0.99975675
ENST00000471507	ENST00000235372	SZRD1	chr1	16693803	+	PRDM2	chr1	14075856	+	0.000365259	0.99963474

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for SZRD1-PRDM2

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
SZRD1	chr1	16693803	PRDM2	chr1	14075856	221	17	EVAESWEEAADSGPIAPGEELLVWYN
SZRD1	chr1	16693803	PRDM2	chr1	14075856	226	17	EVAESWEEAADSGPIAPGEELLVWYN

Top

Potential FusionNeoAntigen Information of SZRD1-PRDM2 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

SZRD1-PRDM2_16693803_14075856.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B07:05	GPIAPGEEL	0.9993	0.5481	12	21
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B07:10	GPIAPGEEL	0.9993	0.5809	12	21
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B07:02	GPIAPGEEL	0.9993	0.5304	12	21
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B35:01	GPIAPGEEL	0.9638	0.9349	12	21
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B35:08	GPIAPGEEL	0.9625	0.9496	12	21
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B35:03	GPIAPGEEL	0.9619	0.9277	12	21
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B35:05	GPIAPGEEL	0.8693	0.7917	12	21
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B35:04	GPIAPGEEL	0.8558	0.9757	12	21
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B35:02	GPIAPGEEL	0.8558	0.9757	12	21
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B81:01	GPIAPGEEL	0.3029	0.6301	12	21
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B82:01	GPIAPGEEL	0.0649	0.562	12	21
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B45:01	EEAADSGPIA	0.9732	0.8786	6	16
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B35:03	SGPIAPGEEL	0.9131	0.8321	11	21
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B50:02	EEAADSGPIA	0.9094	0.6505	6	16
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B81:01	SGPIAPGEEL	0.8729	0.6031	11	21
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B35:03	GPIAPGEELL	0.8611	0.8975	12	22
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B07:05	SGPIAPGEEL	0.8533	0.5204	11	21
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B35:02	SGPIAPGEEL	0.8031	0.9547	11	21
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B35:04	SGPIAPGEEL	0.8031	0.9547	11	21
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B41:01	EEAADSGPIA	0.7176	0.9176	6	16
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B81:01	GPIAPGEELL	0.692	0.6061	12	22
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B35:02	GPIAPGEELL	0.6373	0.9552	12	22
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B35:04	GPIAPGEELL	0.6373	0.9552	12	22
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B82:01	SGPIAPGEEL	0.6326	0.6308	11	21
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B82:01	GPIAPGEELL	0.5285	0.5131	12	22
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B35:03	DSGPIAPGEEL	0.9986	0.8548	10	21
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B35:04	DSGPIAPGEEL	0.9982	0.9499	10	21
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B35:02	DSGPIAPGEEL	0.9982	0.9499	10	21
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B45:01	EEAADSGPIAP	0.9968	0.9667	6	17
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B50:01	WEEAADSGPIA	0.995	0.9138	5	16
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B41:01	WEEAADSGPIA	0.994	0.9226	5	16
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B82:01	DSGPIAPGEEL	0.9758	0.5872	10	21
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B07:12	GPIAPGEEL	0.9967	0.6977	12	21
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B35:12	GPIAPGEEL	0.8558	0.9757	12	21
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B39:10	GPIAPGEEL	0.7513	0.9639	12	21
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B39:08	GPIAPGEEL	0.6888	0.9091	12	21
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B78:01	EAADSGPIA	0.4675	0.764	7	16
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B42:02	GPIAPGEEL	0.2651	0.8504	12	21
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B42:01	GPIAPGEEL	0.2396	0.8434	12	21
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-C01:17	SGPIAPGEEL	0.9978	0.9451	11	21
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B07:12	GPIAPGEELL	0.9675	0.6411	12	22
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B07:12	SGPIAPGEEL	0.8883	0.6702	11	21
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B42:02	SGPIAPGEEL	0.8058	0.7415	11	21
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B35:12	SGPIAPGEEL	0.8031	0.9547	11	21
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B39:10	SGPIAPGEEL	0.7939	0.9503	11	21
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B42:01	SGPIAPGEEL	0.7212	0.7365	11	21
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B39:10	GPIAPGEELL	0.6626	0.9498	12	22
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B35:12	GPIAPGEELL	0.6373	0.9552	12	22
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B35:12	DSGPIAPGEEL	0.9982	0.9499	10	21
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B39:10	DSGPIAPGEEL	0.9928	0.9501	10	21
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B07:09	GPIAPGEEL	0.9993	0.5379	12	21
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B07:22	GPIAPGEEL	0.9993	0.5304	12	21
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B35:77	GPIAPGEEL	0.9638	0.9349	12	21
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B35:23	GPIAPGEEL	0.9586	0.9371	12	21
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B35:13	GPIAPGEEL	0.9505	0.9307	12	21
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B35:11	GPIAPGEEL	0.8993	0.9338	12	21
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B35:22	GPIAPGEEL	0.8816	0.5545	12	21
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B35:17	GPIAPGEEL	0.8634	0.8843	12	21
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B35:30	GPIAPGEEL	0.8634	0.8843	12	21
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B35:09	GPIAPGEEL	0.8558	0.9757	12	21
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B55:04	GPIAPGEEL	0.839	0.5011	12	21
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B67:01	GPIAPGEEL	0.8042	0.9092	12	21
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B39:11	GPIAPGEEL	0.6829	0.8837	12	21
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B15:09	GPIAPGEEL	0.4872	0.8843	12	21
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B78:02	EAADSGPIA	0.4207	0.8435	7	16
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B82:02	GPIAPGEEL	0.0649	0.562	12	21
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B35:43	GPIAPGEEL	0.0208	0.9096	12	21
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-C01:02	SGPIAPGEEL	0.9984	0.9474	11	21
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-C01:03	SGPIAPGEEL	0.998	0.9489	11	21
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B35:13	SGPIAPGEEL	0.8928	0.8395	11	21
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B35:22	SGPIAPGEEL	0.874	0.6654	11	21
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B07:09	SGPIAPGEEL	0.8351	0.5084	11	21
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B55:04	SGPIAPGEEL	0.8309	0.5624	11	21
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B35:13	GPIAPGEELL	0.8293	0.9	12	22
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B67:01	SGPIAPGEEL	0.8123	0.9252	11	21
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B35:09	SGPIAPGEEL	0.8031	0.9547	11	21
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B35:09	GPIAPGEELL	0.6373	0.9552	12	22
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B82:02	SGPIAPGEEL	0.6326	0.6308	11	21
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B67:01	GPIAPGEELL	0.5975	0.8902	12	22
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B82:02	GPIAPGEELL	0.5285	0.5131	12	22
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B35:09	DSGPIAPGEEL	0.9982	0.9499	10	21
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B50:04	WEEAADSGPIA	0.995	0.9138	5	16
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B50:05	WEEAADSGPIA	0.995	0.9138	5	16
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	HLA-B82:02	DSGPIAPGEEL	0.9758	0.5872	10	21

Top

Potential FusionNeoAntigen Information of SZRD1-PRDM2 in HLA II

SZRD1-PRDM2_16693803_14075856.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
SZRD1-PRDM2	chr1	16693803	chr1	14075856	226	DRB1-0906	SGPIAPGEELLVWYN	11	26

Top

Fusion breakpoint peptide structures of SZRD1-PRDM2

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
1626	EEAADSGPIAPGEE	SZRD1	PRDM2	chr1	16693803	chr1	14075856	226

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of SZRD1-PRDM2

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B52:01	3W39	1626	EEAADSGPIAPGEE	-6.65674	-6.65674
HLA-B44:05	3DX8	1626	EEAADSGPIAPGEE	-6.36866	-6.36866

Top

Vaccine Design for the FusionNeoAntigens of SZRD1-PRDM2

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
SZRD1-PRDM2	chr1	16693803	chr1	14075856	10	21	DSGPIAPGEEL	GACAGCGGGCCAATCGCGCCGGGCGAGGAGCTC
SZRD1-PRDM2	chr1	16693803	chr1	14075856	11	21	SGPIAPGEEL	AGCGGGCCAATCGCGCCGGGCGAGGAGCTC
SZRD1-PRDM2	chr1	16693803	chr1	14075856	12	21	GPIAPGEEL	GGGCCAATCGCGCCGGGCGAGGAGCTC
SZRD1-PRDM2	chr1	16693803	chr1	14075856	12	22	GPIAPGEELL	GGGCCAATCGCGCCGGGCGAGGAGCTCCTG
SZRD1-PRDM2	chr1	16693803	chr1	14075856	5	16	WEEAADSGPIA	TGGGAAGAGGCGGCAGACAGCGGGCCAATCGCG
SZRD1-PRDM2	chr1	16693803	chr1	14075856	6	16	EEAADSGPIA	GAAGAGGCGGCAGACAGCGGGCCAATCGCG
SZRD1-PRDM2	chr1	16693803	chr1	14075856	6	17	EEAADSGPIAP	GAAGAGGCGGCAGACAGCGGGCCAATCGCGCCG
SZRD1-PRDM2	chr1	16693803	chr1	14075856	7	16	EAADSGPIA	GAGGCGGCAGACAGCGGGCCAATCGCG

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
SZRD1-PRDM2	chr1	16693803	chr1	14075856	11	26	SGPIAPGEELLVWYN	AGCGGGCCAATCGCGCCGGGCGAGGAGCTCCTGGTCTGGTACAAT

Top

Information of the samples that have these potential fusion neoantigens of SZRD1-PRDM2

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
STAD	SZRD1-PRDM2	chr1	16693803	ENST00000401088	chr1	14075856	ENST00000235372	TCGA-VQ-A8PM-01A

Top

Potential target of CAR-T therapy development for SZRD1-PRDM2

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to SZRD1-PRDM2

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to SZRD1-PRDM2

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)