Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:TAB3-DMD

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: TAB3-DMD
	FusionPDB ID: 88644
	FusionGDB2.0 ID: 88644
		Hgene	Tgene
	Gene symbol	TAB3	DMD
	Gene ID	257397	1756
	Gene name	TGF-beta activated kinase 1 (MAP3K7) binding protein 3	dystrophin
	Synonyms	MAP3K7IP3\|NAP1	BMD\|CMD3B\|DXS142\|DXS164\|DXS206\|DXS230\|DXS239\|DXS268\|DXS269\|DXS270\|DXS272\|MRX85
	Cytomap	Xp21.2	Xp21.2-p21.1
	Type of gene	protein-coding	protein-coding
	Description	TGF-beta-activated kinase 1 and MAP3K7-binding protein 3NF-kappa-B-activating protein 1NFkB activating protein 1TAB-3TAK1-binding protein 3TGF-beta activated kinase 1 and MAP3K7 binding protein 3TGF-beta-activated kinase 1-binding protein 3mitogen-	dystrophin
	Modification date	20200313	20200329
	UniProtAcc	.	P11532 Main function of 5'-partner protein: FUNCTION: Anchors the extracellular matrix to the cytoskeleton via F-actin. Ligand for dystroglycan. Component of the dystrophin-associated glycoprotein complex which accumulates at the neuromuscular junction (NMJ) and at a variety of synapses in the peripheral and central nervous systems and has a structural function in stabilizing the sarcolemma. Also implicated in signaling events and synaptic transmission. {ECO:0000250\|UniProtKB:P11531, ECO:0000269\|PubMed:16710609}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000288422, ENST00000378928, ENST00000378930, ENST00000378932, ENST00000378933,	ENST00000288447, ENST00000361471, ENST00000378680, ENST00000378702, ENST00000378723, ENST00000445312, ENST00000343523, ENST00000357033, ENST00000359836, ENST00000378677, ENST00000378707, ENST00000474231, ENST00000541735,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	2 X 3 X 4=24	35 X 39 X 12=16380
	# samples	4	41
	** MAII score	log2(4/24*10)=0.736965594166206 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0	log2(41/16380*10)=-5.32016763702292 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: TAB3 [Title/Abstract] AND DMD [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: TAB3 [Title/Abstract] AND DMD [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	TAB3(30877604)-DMD(31241238), # samples:2
Anticipated loss of major functional domain due to fusion event.	TAB3-DMD seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. TAB3-DMD seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. TAB3-DMD seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. TAB3-DMD seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. TAB3-DMD seems lost the major protein functional domain in Hgene partner, which is a essential gene due to the frame-shifted ORF. TAB3-DMD seems lost the major protein functional domain in Tgene partner, which is a tumor suppressor due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Tgene	DMD	GO:0043043	peptide biosynthetic process	16000376

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chrX:30877604/chrX:31241238)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across TAB3 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across DMD (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000378933	TAB3	chrX	30877604	-	ENST00000378707	DMD	chrX	31241238	-	4743	280	285	2051	588
ENST00000378933	TAB3	chrX	30877604	-	ENST00000359836	DMD	chrX	31241238	-	4672	280	285	2066	593
ENST00000378933	TAB3	chrX	30877604	-	ENST00000541735	DMD	chrX	31241238	-	4413	280	285	1721	478
ENST00000378933	TAB3	chrX	30877604	-	ENST00000343523	DMD	chrX	31241238	-	4381	280	285	1775	496
ENST00000378933	TAB3	chrX	30877604	-	ENST00000378677	DMD	chrX	31241238	-	4743	280	285	2051	588
ENST00000378933	TAB3	chrX	30877604	-	ENST00000357033	DMD	chrX	31241238	-	4743	280	285	2051	588
ENST00000378933	TAB3	chrX	30877604	-	ENST00000474231	DMD	chrX	31241238	-	2542	280	285	2105	606
ENST00000378933	TAB3	chrX	30877604	-	ENST00000378723	DMD	chrX	31241238	-	4720	280	285	2105	606
ENST00000378933	TAB3	chrX	30877604	-	ENST00000378702	DMD	chrX	31241238	-	2787	280	285	2051	588
ENST00000378933	TAB3	chrX	30877604	-	ENST00000361471	DMD	chrX	31241238	-	2344	280	285	2066	593
ENST00000378933	TAB3	chrX	30877604	-	ENST00000378680	DMD	chrX	31241238	-	1936	280	285	1775	496
ENST00000378932	TAB3	chrX	30877604	-	ENST00000378707	DMD	chrX	31165635	-	3845	649	542	1153	203
ENST00000378932	TAB3	chrX	30877604	-	ENST00000359836	DMD	chrX	31165635	-	3813	649	542	1207	221
ENST00000378932	TAB3	chrX	30877604	-	ENST00000541735	DMD	chrX	31165635	-	3845	649	542	1153	203
ENST00000378932	TAB3	chrX	30877604	-	ENST00000343523	DMD	chrX	31165635	-	3813	649	542	1207	221
ENST00000378932	TAB3	chrX	30877604	-	ENST00000378677	DMD	chrX	31165635	-	3845	649	542	1153	203
ENST00000378932	TAB3	chrX	30877604	-	ENST00000357033	DMD	chrX	31165635	-	3845	649	542	1153	203
ENST00000378932	TAB3	chrX	30877604	-	ENST00000474231	DMD	chrX	31165635	-	1644	649	542	1207	221
ENST00000378932	TAB3	chrX	30877604	-	ENST00000378723	DMD	chrX	31165635	-	3822	649	542	1207	221
ENST00000378932	TAB3	chrX	30877604	-	ENST00000378702	DMD	chrX	31165635	-	1889	649	542	1153	203
ENST00000378932	TAB3	chrX	30877604	-	ENST00000361471	DMD	chrX	31165635	-	1485	649	542	1207	221
ENST00000378932	TAB3	chrX	30877604	-	ENST00000378680	DMD	chrX	31165635	-	1368	649	542	1207	221
ENST00000288422	TAB3	chrX	30877604	-	ENST00000378707	DMD	chrX	31165635	-	3845	649	542	1153	203
ENST00000288422	TAB3	chrX	30877604	-	ENST00000359836	DMD	chrX	31165635	-	3813	649	542	1207	221
ENST00000288422	TAB3	chrX	30877604	-	ENST00000541735	DMD	chrX	31165635	-	3845	649	542	1153	203
ENST00000288422	TAB3	chrX	30877604	-	ENST00000343523	DMD	chrX	31165635	-	3813	649	542	1207	221
ENST00000288422	TAB3	chrX	30877604	-	ENST00000378677	DMD	chrX	31165635	-	3845	649	542	1153	203
ENST00000288422	TAB3	chrX	30877604	-	ENST00000357033	DMD	chrX	31165635	-	3845	649	542	1153	203
ENST00000288422	TAB3	chrX	30877604	-	ENST00000474231	DMD	chrX	31165635	-	1644	649	542	1207	221
ENST00000288422	TAB3	chrX	30877604	-	ENST00000378723	DMD	chrX	31165635	-	3822	649	542	1207	221
ENST00000288422	TAB3	chrX	30877604	-	ENST00000378702	DMD	chrX	31165635	-	1889	649	542	1153	203
ENST00000288422	TAB3	chrX	30877604	-	ENST00000361471	DMD	chrX	31165635	-	1485	649	542	1207	221
ENST00000288422	TAB3	chrX	30877604	-	ENST00000378680	DMD	chrX	31165635	-	1368	649	542	1207	221
ENST00000378930	TAB3	chrX	30870895	-	ENST00000378707	DMD	chrX	31366751	-	6507	1842	111	3815	1234
ENST00000378930	TAB3	chrX	30870895	-	ENST00000359836	DMD	chrX	31366751	-	6436	1842	111	3830	1239
ENST00000378930	TAB3	chrX	30870895	-	ENST00000541735	DMD	chrX	31366751	-	6177	1842	111	3485	1124
ENST00000378930	TAB3	chrX	30870895	-	ENST00000343523	DMD	chrX	31366751	-	6145	1842	111	3539	1142
ENST00000378930	TAB3	chrX	30870895	-	ENST00000378677	DMD	chrX	31366751	-	6507	1842	111	3815	1234
ENST00000378930	TAB3	chrX	30870895	-	ENST00000357033	DMD	chrX	31366751	-	6507	1842	111	3815	1234
ENST00000378930	TAB3	chrX	30870895	-	ENST00000474231	DMD	chrX	31366751	-	4306	1842	111	3869	1252
ENST00000378928	TAB3	chrX	30870895	-	ENST00000378707	DMD	chrX	31366751	-	4775	110	26	2083	685
ENST00000378928	TAB3	chrX	30870895	-	ENST00000359836	DMD	chrX	31366751	-	4704	110	26	2098	690
ENST00000378928	TAB3	chrX	30870895	-	ENST00000541735	DMD	chrX	31366751	-	4445	110	26	1753	575
ENST00000378928	TAB3	chrX	30870895	-	ENST00000343523	DMD	chrX	31366751	-	4413	110	26	1807	593
ENST00000378928	TAB3	chrX	30870895	-	ENST00000378677	DMD	chrX	31366751	-	4775	110	26	2083	685
ENST00000378928	TAB3	chrX	30870895	-	ENST00000357033	DMD	chrX	31366751	-	4775	110	26	2083	685
ENST00000378928	TAB3	chrX	30870895	-	ENST00000474231	DMD	chrX	31366751	-	2574	110	26	2137	703

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000378933	ENST00000378707	TAB3	chrX	30877604	-	DMD	chrX	31241238	-	0.000294211	0.99970573
ENST00000378933	ENST00000359836	TAB3	chrX	30877604	-	DMD	chrX	31241238	-	0.000205	0.999795
ENST00000378933	ENST00000541735	TAB3	chrX	30877604	-	DMD	chrX	31241238	-	0.000297457	0.9997025
ENST00000378933	ENST00000343523	TAB3	chrX	30877604	-	DMD	chrX	31241238	-	0.000202622	0.9997974
ENST00000378933	ENST00000378677	TAB3	chrX	30877604	-	DMD	chrX	31241238	-	0.000294211	0.99970573
ENST00000378933	ENST00000357033	TAB3	chrX	30877604	-	DMD	chrX	31241238	-	0.000294211	0.99970573
ENST00000378933	ENST00000474231	TAB3	chrX	30877604	-	DMD	chrX	31241238	-	0.001089158	0.9989109
ENST00000378933	ENST00000378723	TAB3	chrX	30877604	-	DMD	chrX	31241238	-	0.000209606	0.9997904
ENST00000378933	ENST00000378702	TAB3	chrX	30877604	-	DMD	chrX	31241238	-	0.001520562	0.9984794
ENST00000378933	ENST00000361471	TAB3	chrX	30877604	-	DMD	chrX	31241238	-	0.001572921	0.99842715
ENST00000378933	ENST00000378680	TAB3	chrX	30877604	-	DMD	chrX	31241238	-	0.001624323	0.99837565
ENST00000378932	ENST00000378707	TAB3	chrX	30877604	-	DMD	chrX	31165635	-	0.001361741	0.9986382
ENST00000378932	ENST00000359836	TAB3	chrX	30877604	-	DMD	chrX	31165635	-	0.000643843	0.9993562
ENST00000378932	ENST00000541735	TAB3	chrX	30877604	-	DMD	chrX	31165635	-	0.001361741	0.9986382
ENST00000378932	ENST00000343523	TAB3	chrX	30877604	-	DMD	chrX	31165635	-	0.000643843	0.9993562
ENST00000378932	ENST00000378677	TAB3	chrX	30877604	-	DMD	chrX	31165635	-	0.001361741	0.9986382
ENST00000378932	ENST00000357033	TAB3	chrX	30877604	-	DMD	chrX	31165635	-	0.001361741	0.9986382
ENST00000378932	ENST00000474231	TAB3	chrX	30877604	-	DMD	chrX	31165635	-	0.001490797	0.9985092
ENST00000378932	ENST00000378723	TAB3	chrX	30877604	-	DMD	chrX	31165635	-	0.000640914	0.9993591
ENST00000378932	ENST00000378702	TAB3	chrX	30877604	-	DMD	chrX	31165635	-	0.004623008	0.99537694
ENST00000378932	ENST00000361471	TAB3	chrX	30877604	-	DMD	chrX	31165635	-	0.001964161	0.99803585
ENST00000378932	ENST00000378680	TAB3	chrX	30877604	-	DMD	chrX	31165635	-	0.002528799	0.9974712
ENST00000288422	ENST00000378707	TAB3	chrX	30877604	-	DMD	chrX	31165635	-	0.001361741	0.9986382
ENST00000288422	ENST00000359836	TAB3	chrX	30877604	-	DMD	chrX	31165635	-	0.000643843	0.9993562
ENST00000288422	ENST00000541735	TAB3	chrX	30877604	-	DMD	chrX	31165635	-	0.001361741	0.9986382
ENST00000288422	ENST00000343523	TAB3	chrX	30877604	-	DMD	chrX	31165635	-	0.000643843	0.9993562
ENST00000288422	ENST00000378677	TAB3	chrX	30877604	-	DMD	chrX	31165635	-	0.001361741	0.9986382
ENST00000288422	ENST00000357033	TAB3	chrX	30877604	-	DMD	chrX	31165635	-	0.001361741	0.9986382
ENST00000288422	ENST00000474231	TAB3	chrX	30877604	-	DMD	chrX	31165635	-	0.001490797	0.9985092
ENST00000288422	ENST00000378723	TAB3	chrX	30877604	-	DMD	chrX	31165635	-	0.000640914	0.9993591
ENST00000288422	ENST00000378702	TAB3	chrX	30877604	-	DMD	chrX	31165635	-	0.004623008	0.99537694
ENST00000288422	ENST00000361471	TAB3	chrX	30877604	-	DMD	chrX	31165635	-	0.001964161	0.99803585
ENST00000288422	ENST00000378680	TAB3	chrX	30877604	-	DMD	chrX	31165635	-	0.002528799	0.9974712
ENST00000378930	ENST00000378707	TAB3	chrX	30870895	-	DMD	chrX	31366751	-	0.000394151	0.99960583
ENST00000378930	ENST00000359836	TAB3	chrX	30870895	-	DMD	chrX	31366751	-	0.000273117	0.99972683
ENST00000378930	ENST00000541735	TAB3	chrX	30870895	-	DMD	chrX	31366751	-	0.000133421	0.9998666
ENST00000378930	ENST00000343523	TAB3	chrX	30870895	-	DMD	chrX	31366751	-	0.000292173	0.99970776
ENST00000378930	ENST00000378677	TAB3	chrX	30870895	-	DMD	chrX	31366751	-	0.000394151	0.99960583
ENST00000378930	ENST00000357033	TAB3	chrX	30870895	-	DMD	chrX	31366751	-	0.000394151	0.99960583
ENST00000378930	ENST00000474231	TAB3	chrX	30870895	-	DMD	chrX	31366751	-	0.00108828	0.99891174
ENST00000378928	ENST00000378707	TAB3	chrX	30870895	-	DMD	chrX	31366751	-	0.001280616	0.99871945
ENST00000378928	ENST00000359836	TAB3	chrX	30870895	-	DMD	chrX	31366751	-	0.00080135	0.9991986
ENST00000378928	ENST00000541735	TAB3	chrX	30870895	-	DMD	chrX	31366751	-	0.001043292	0.9989567
ENST00000378928	ENST00000343523	TAB3	chrX	30870895	-	DMD	chrX	31366751	-	0.000866579	0.9991334
ENST00000378928	ENST00000378677	TAB3	chrX	30870895	-	DMD	chrX	31366751	-	0.001280616	0.99871945
ENST00000378928	ENST00000357033	TAB3	chrX	30870895	-	DMD	chrX	31366751	-	0.001280616	0.99871945
ENST00000378928	ENST00000474231	TAB3	chrX	30870895	-	DMD	chrX	31366751	-	0.006351305	0.9936487

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for TAB3-DMD

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
TAB3	chrX	30870895	DMD	chrX	31366751	110	28	RLRRVSCTTAIPTVAVEDRVRQLHEA
TAB3	chrX	30870895	DMD	chrX	31366751	1842	577	RLRRVSCTTAIPTVAVEDRVRQLHEA
TAB3	chrX	30877604	DMD	chrX	31165635	649	35	LKFQRAWCLSACYRNLQAEYDRLKQQ

Top

Potential FusionNeoAntigen Information of TAB3-DMD in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

TAB3-DMD_30870895_31366751.msa
TAB3-DMD_30877604_31165635.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
TAB3-DMD	chrX	30870895	chrX	31366751	110	HLA-B51:01	TAIPTVAV	0.9998	0.9485	8	16
TAB3-DMD	chrX	30870895	chrX	31366751	110	HLA-B51:02	TAIPTVAV	0.9998	0.9152	8	16
TAB3-DMD	chrX	30870895	chrX	31366751	110	HLA-A68:06	TTAIPTVAV	0.9947	0.6952	7	16
TAB3-DMD	chrX	30870895	chrX	31366751	110	HLA-A66:01	TTAIPTVAV	0.9941	0.5732	7	16
TAB3-DMD	chrX	30870895	chrX	31366751	110	HLA-A34:05	TTAIPTVAV	0.9864	0.724	7	16
TAB3-DMD	chrX	30870895	chrX	31366751	110	HLA-A34:01	TTAIPTVAV	0.9864	0.724	7	16
TAB3-DMD	chrX	30870895	chrX	31366751	110	HLA-B78:01	TAIPTVAV	0.9997	0.9891	8	16
TAB3-DMD	chrX	30870895	chrX	31366751	110	HLA-B51:07	TAIPTVAV	0.9997	0.9891	8	16
TAB3-DMD	chrX	30870895	chrX	31366751	110	HLA-C03:19	TAIPTVAV	0.9996	0.9934	8	16
TAB3-DMD	chrX	30870895	chrX	31366751	110	HLA-B51:08	TAIPTVAV	0.9987	0.7983	8	16
TAB3-DMD	chrX	30870895	chrX	31366751	110	HLA-C15:06	TTAIPTVAV	0.9994	0.9663	7	16
TAB3-DMD	chrX	30870895	chrX	31366751	110	HLA-C03:08	TTAIPTVAV	0.9851	0.9442	7	16
TAB3-DMD	chrX	30870895	chrX	31366751	110	HLA-C02:06	TTAIPTVAV	0.9644	0.9872	7	16
TAB3-DMD	chrX	30870895	chrX	31366751	110	HLA-A02:05	TTAIPTVAV	0.9589	0.6664	7	16
TAB3-DMD	chrX	30870895	chrX	31366751	110	HLA-B78:02	TAIPTVAV	0.9998	0.9901	8	16
TAB3-DMD	chrX	30870895	chrX	31366751	110	HLA-B51:13	TAIPTVAV	0.9998	0.9027	8	16
TAB3-DMD	chrX	30870895	chrX	31366751	110	HLA-B51:14	TAIPTVAV	0.9997	0.8944	8	16
TAB3-DMD	chrX	30870895	chrX	31366751	110	HLA-B51:09	TAIPTVAV	0.9995	0.9332	8	16
TAB3-DMD	chrX	30870895	chrX	31366751	110	HLA-B51:21	TAIPTVAV	0.9994	0.9237	8	16
TAB3-DMD	chrX	30870895	chrX	31366751	110	HLA-C12:03	TAIPTVAV	0.9989	0.9929	8	16
TAB3-DMD	chrX	30870895	chrX	31366751	110	HLA-B51:29	TAIPTVAV	0.9987	0.8313	8	16
TAB3-DMD	chrX	30870895	chrX	31366751	110	HLA-C15:02	TTAIPTVAV	0.9995	0.9655	7	16
TAB3-DMD	chrX	30870895	chrX	31366751	110	HLA-C15:05	TTAIPTVAV	0.9994	0.9826	7	16
TAB3-DMD	chrX	30870895	chrX	31366751	110	HLA-A68:02	TTAIPTVAV	0.9985	0.7341	7	16
TAB3-DMD	chrX	30870895	chrX	31366751	110	HLA-A69:01	TTAIPTVAV	0.9965	0.8439	7	16
TAB3-DMD	chrX	30870895	chrX	31366751	110	HLA-A66:02	TTAIPTVAV	0.9841	0.7831	7	16
TAB3-DMD	chrX	30870895	chrX	31366751	110	HLA-C03:06	TTAIPTVAV	0.9782	0.9915	7	16
TAB3-DMD	chrX	30870895	chrX	31366751	110	HLA-A68:02	SCTTAIPTVAV	0.9492	0.8759	5	16
TAB3-DMD	chrX	30877604	chrX	31165635	649	HLA-B15:18	YRNLQAEY	0.9602	0.7941	12	20
TAB3-DMD	chrX	30877604	chrX	31165635	649	HLA-C07:95	YRNLQAEY	0.998	0.6973	12	20
TAB3-DMD	chrX	30877604	chrX	31165635	649	HLA-C07:05	YRNLQAEY	0.9978	0.962	12	20
TAB3-DMD	chrX	30877604	chrX	31165635	649	HLA-C07:27	YRNLQAEY	0.9976	0.9468	12	20
TAB3-DMD	chrX	30877604	chrX	31165635	649	HLA-C07:19	YRNLQAEY	0.9974	0.6852	12	20
TAB3-DMD	chrX	30877604	chrX	31165635	649	HLA-C07:67	YRNLQAEY	0.9963	0.9127	12	20
TAB3-DMD	chrX	30877604	chrX	31165635	649	HLA-C07:80	YRNLQAEY	0.9963	0.9127	12	20
TAB3-DMD	chrX	30877604	chrX	31165635	649	HLA-C07:46	YRNLQAEY	0.9953	0.8087	12	20
TAB3-DMD	chrX	30877604	chrX	31165635	649	HLA-C07:10	YRNLQAEY	0.9951	0.9355	12	20
TAB3-DMD	chrX	30877604	chrX	31165635	649	HLA-C12:16	YRNLQAEY	0.9355	0.9652	12	20
TAB3-DMD	chrX	30877604	chrX	31165635	649	HLA-C07:80	CYRNLQAEY	0.3738	0.926	11	20
TAB3-DMD	chrX	30877604	chrX	31165635	649	HLA-C07:67	CYRNLQAEY	0.3738	0.926	11	20
TAB3-DMD	chrX	30877604	chrX	31165635	649	HLA-C07:10	CYRNLQAEY	0.3499	0.9163	11	20
TAB3-DMD	chrX	30877604	chrX	31165635	649	HLA-C07:01	YRNLQAEY	0.9981	0.6258	12	20
TAB3-DMD	chrX	30877604	chrX	31165635	649	HLA-C07:22	YRNLQAEY	0.9964	0.773	12	20
TAB3-DMD	chrX	30877604	chrX	31165635	649	HLA-C07:02	YRNLQAEY	0.9963	0.9127	12	20
TAB3-DMD	chrX	30877604	chrX	31165635	649	HLA-C07:17	YRNLQAEY	0.9962	0.9686	12	20
TAB3-DMD	chrX	30877604	chrX	31165635	649	HLA-C07:02	CYRNLQAEY	0.3738	0.926	11	20
TAB3-DMD	chrX	30877604	chrX	31165635	649	HLA-C14:02	CYRNLQAEY	0.0029	0.9428	11	20
TAB3-DMD	chrX	30877604	chrX	31165635	649	HLA-C14:03	CYRNLQAEY	0.0029	0.9428	11	20

Top

Potential FusionNeoAntigen Information of TAB3-DMD in HLA II

TAB3-DMD_30870895_31366751.msa
TAB3-DMD_30877604_31165635.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-0307	IPTVAVEDRVRQLHE	10	25
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-0315	IPTVAVEDRVRQLHE	10	25
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-0324	IPTVAVEDRVRQLHE	10	25
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-0820	IPTVAVEDRVRQLHE	10	25
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-0831	IPTVAVEDRVRQLHE	10	25
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1104	IPTVAVEDRVRQLHE	10	25
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1104	AIPTVAVEDRVRQLH	9	24
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1106	IPTVAVEDRVRQLHE	10	25
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1107	IPTVAVEDRVRQLHE	10	25
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1113	IPTVAVEDRVRQLHE	10	25
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1118	IPTVAVEDRVRQLHE	10	25
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1125	IPTVAVEDRVRQLHE	10	25
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1134	IPTVAVEDRVRQLHE	10	25
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1134	AIPTVAVEDRVRQLH	9	24
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1135	IPTVAVEDRVRQLHE	10	25
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1135	AIPTVAVEDRVRQLH	9	24
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1138	IPTVAVEDRVRQLHE	10	25
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1138	AIPTVAVEDRVRQLH	9	24
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1141	IPTVAVEDRVRQLHE	10	25
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1142	IPTVAVEDRVRQLHE	10	25
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1142	AIPTVAVEDRVRQLH	9	24
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1143	IPTVAVEDRVRQLHE	10	25
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1143	AIPTVAVEDRVRQLH	9	24
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1144	IPTVAVEDRVRQLHE	10	25
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1144	AIPTVAVEDRVRQLH	9	24
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1146	IPTVAVEDRVRQLHE	10	25
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1146	AIPTVAVEDRVRQLH	9	24
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1147	IPTVAVEDRVRQLHE	10	25
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1148	IPTVAVEDRVRQLHE	10	25
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1150	IPTVAVEDRVRQLHE	10	25
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1150	AIPTVAVEDRVRQLH	9	24
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1156	IPTVAVEDRVRQLHE	10	25
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1156	AIPTVAVEDRVRQLH	9	24
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1157	IPTVAVEDRVRQLHE	10	25
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1157	AIPTVAVEDRVRQLH	9	24
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1158	IPTVAVEDRVRQLHE	10	25
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1158	AIPTVAVEDRVRQLH	9	24
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1159	IPTVAVEDRVRQLHE	10	25
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1160	IPTVAVEDRVRQLHE	10	25
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1160	AIPTVAVEDRVRQLH	9	24
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1177	IPTVAVEDRVRQLHE	10	25
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1177	AIPTVAVEDRVRQLH	9	24
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1178	IPTVAVEDRVRQLHE	10	25
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1178	AIPTVAVEDRVRQLH	9	24
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1179	IPTVAVEDRVRQLHE	10	25
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1183	IPTVAVEDRVRQLHE	10	25
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1183	AIPTVAVEDRVRQLH	9	24
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1184	IPTVAVEDRVRQLHE	10	25
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1184	AIPTVAVEDRVRQLH	9	24
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1188	IPTVAVEDRVRQLHE	10	25
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1188	AIPTVAVEDRVRQLH	9	24
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1306	IPTVAVEDRVRQLHE	10	25
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1308	IPTVAVEDRVRQLHE	10	25
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1309	IPTVAVEDRVRQLHE	10	25
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1311	IPTVAVEDRVRQLHE	10	25
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1311	AIPTVAVEDRVRQLH	9	24
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1318	IPTVAVEDRVRQLHE	10	25
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1327	IPTVAVEDRVRQLHE	10	25
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1337	IPTVAVEDRVRQLHE	10	25
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1342	IPTVAVEDRVRQLHE	10	25
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1342	AIPTVAVEDRVRQLH	9	24
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1344	IPTVAVEDRVRQLHE	10	25
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1344	AIPTVAVEDRVRQLH	9	24
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1370	IPTVAVEDRVRQLHE	10	25
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1371	IPTVAVEDRVRQLHE	10	25
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1372	IPTVAVEDRVRQLHE	10	25
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1381	IPTVAVEDRVRQLHE	10	25
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1384	IPTVAVEDRVRQLHE	10	25
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1389	IPTVAVEDRVRQLHE	10	25
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1394	IPTVAVEDRVRQLHE	10	25
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1394	AIPTVAVEDRVRQLH	9	24
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1406	IPTVAVEDRVRQLHE	10	25
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1417	IPTVAVEDRVRQLHE	10	25
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1417	AIPTVAVEDRVRQLH	9	24
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1420	IPTVAVEDRVRQLHE	10	25
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1421	IPTVAVEDRVRQLHE	10	25
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1421	AIPTVAVEDRVRQLH	9	24
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1421	PTVAVEDRVRQLHEA	11	26
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1429	IPTVAVEDRVRQLHE	10	25
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1433	IPTVAVEDRVRQLHE	10	25
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1434	IPTVAVEDRVRQLHE	10	25
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1434	AIPTVAVEDRVRQLH	9	24
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1437	IPTVAVEDRVRQLHE	10	25
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1437	AIPTVAVEDRVRQLH	9	24
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1480	IPTVAVEDRVRQLHE	10	25
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1480	AIPTVAVEDRVRQLH	9	24
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1481	IPTVAVEDRVRQLHE	10	25
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1483	IPTVAVEDRVRQLHE	10	25
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1484	IPTVAVEDRVRQLHE	10	25
TAB3-DMD	chrX	30870895	chrX	31366751	110	DRB1-1495	IPTVAVEDRVRQLHE	10	25
TAB3-DMD	chrX	30877604	chrX	31165635	649	DRB1-0405	SACYRNLQAEYDRLK	9	24
TAB3-DMD	chrX	30877604	chrX	31165635	649	DRB1-0424	SACYRNLQAEYDRLK	9	24
TAB3-DMD	chrX	30877604	chrX	31165635	649	DRB1-0429	SACYRNLQAEYDRLK	9	24
TAB3-DMD	chrX	30877604	chrX	31165635	649	DRB1-0430	SACYRNLQAEYDRLK	9	24
TAB3-DMD	chrX	30877604	chrX	31165635	649	DRB1-0445	SACYRNLQAEYDRLK	9	24
TAB3-DMD	chrX	30877604	chrX	31165635	649	DRB1-0448	SACYRNLQAEYDRLK	9	24
TAB3-DMD	chrX	30877604	chrX	31165635	649	DRB1-0457	SACYRNLQAEYDRLK	9	24
TAB3-DMD	chrX	30877604	chrX	31165635	649	DRB1-0477	SACYRNLQAEYDRLK	9	24
TAB3-DMD	chrX	30877604	chrX	31165635	649	DRB1-0480	SACYRNLQAEYDRLK	9	24
TAB3-DMD	chrX	30877604	chrX	31165635	649	DRB1-0483	SACYRNLQAEYDRLK	9	24
TAB3-DMD	chrX	30877604	chrX	31165635	649	DRB1-0484	SACYRNLQAEYDRLK	9	24
TAB3-DMD	chrX	30877604	chrX	31165635	649	DRB1-0489	SACYRNLQAEYDRLK	9	24
TAB3-DMD	chrX	30877604	chrX	31165635	649	DRB1-1001	SACYRNLQAEYDRLK	9	24
TAB3-DMD	chrX	30877604	chrX	31165635	649	DRB1-1003	SACYRNLQAEYDRLK	9	24

Top

Fusion breakpoint peptide structures of TAB3-DMD

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
955	CTTAIPTVAVEDRV	TAB3	DMD	chrX	30870895	chrX	31366751	110

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
10429	WCLSACYRNLQAEY	TAB3	DMD	chrX	30877604	chrX	31165635	649

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of TAB3-DMD

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	955	CTTAIPTVAVEDRV	-7.9962	-8.1096
HLA-B14:02	3BVN	955	CTTAIPTVAVEDRV	-5.70842	-6.74372
HLA-B52:01	3W39	955	CTTAIPTVAVEDRV	-6.83737	-6.95077
HLA-B52:01	3W39	955	CTTAIPTVAVEDRV	-4.4836	-5.5189
HLA-A11:01	4UQ2	955	CTTAIPTVAVEDRV	-10.0067	-10.1201
HLA-A11:01	4UQ2	955	CTTAIPTVAVEDRV	-9.03915	-10.0745
HLA-A24:02	5HGA	955	CTTAIPTVAVEDRV	-6.56204	-6.67544
HLA-A24:02	5HGA	955	CTTAIPTVAVEDRV	-5.42271	-6.45801
HLA-B44:05	3DX8	955	CTTAIPTVAVEDRV	-7.85648	-8.89178
HLA-B44:05	3DX8	955	CTTAIPTVAVEDRV	-5.3978	-5.5112
HLA-A02:01	6TDR	955	CTTAIPTVAVEDRV	-3.37154	-4.40684
HLA-B14:02	3BVN	10429	WCLSACYRNLQAEY	-7.9962	-8.1096
HLA-B14:02	3BVN	10429	WCLSACYRNLQAEY	-5.70842	-6.74372
HLA-B52:01	3W39	10429	WCLSACYRNLQAEY	-6.83737	-6.95077
HLA-B52:01	3W39	10429	WCLSACYRNLQAEY	-4.4836	-5.5189
HLA-A11:01	4UQ2	10429	WCLSACYRNLQAEY	-10.0067	-10.1201
HLA-A11:01	4UQ2	10429	WCLSACYRNLQAEY	-9.03915	-10.0745
HLA-A24:02	5HGA	10429	WCLSACYRNLQAEY	-6.56204	-6.67544
HLA-A24:02	5HGA	10429	WCLSACYRNLQAEY	-5.42271	-6.45801
HLA-B44:05	3DX8	10429	WCLSACYRNLQAEY	-7.85648	-8.89178
HLA-B44:05	3DX8	10429	WCLSACYRNLQAEY	-5.3978	-5.5112
HLA-B35:01	1A1N	10429	WCLSACYRNLQAEY	-6.27422	-6.38762
HLA-B35:01	1A1N	10429	WCLSACYRNLQAEY	-5.27424	-6.30954
HLA-A02:01	6TDR	10429	WCLSACYRNLQAEY	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of TAB3-DMD

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
TAB3-DMD	chrX	30870895	chrX	31366751	5	16	SCTTAIPTVAV	AGCTGCACCACTGCGATCCCTACGGTGGCCGTC
TAB3-DMD	chrX	30870895	chrX	31366751	7	16	TTAIPTVAV	ACCACTGCGATCCCTACGGTGGCCGTC
TAB3-DMD	chrX	30870895	chrX	31366751	8	16	TAIPTVAV	ACTGCGATCCCTACGGTGGCCGTC
TAB3-DMD	chrX	30877604	chrX	31165635	11	20	CYRNLQAEY	TTACAGGAATCTGCAAGCAGAATATGA
TAB3-DMD	chrX	30877604	chrX	31165635	12	20	YRNLQAEY	CAGGAATCTGCAAGCAGAATATGA

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
TAB3-DMD	chrX	30870895	chrX	31366751	10	25	IPTVAVEDRVRQLHE	ATCCCTACGGTGGCCGTCGAGGACCGAGTCAGGCAGCTGCATGAA
TAB3-DMD	chrX	30870895	chrX	31366751	11	26	PTVAVEDRVRQLHEA	CCTACGGTGGCCGTCGAGGACCGAGTCAGGCAGCTGCATGAAGCC
TAB3-DMD	chrX	30870895	chrX	31366751	9	24	AIPTVAVEDRVRQLH	GCGATCCCTACGGTGGCCGTCGAGGACCGAGTCAGGCAGCTGCAT
TAB3-DMD	chrX	30877604	chrX	31165635	9	24	SACYRNLQAEYDRLK	TGCATGTTACAGGAATCTGCAAGCAGAATATGACCGTCTAAAGCA

Top

Information of the samples that have these potential fusion neoantigens of TAB3-DMD

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
COAD	TAB3-DMD	chrX	30877604	ENST00000288422	chrX	31165635	ENST00000343523	TCGA-AA-3678-01A
SARC	TAB3-DMD	chrX	30870895	ENST00000378928	chrX	31366751	ENST00000343523	TCGA-X6-A7WA-01A

Top

Potential target of CAR-T therapy development for TAB3-DMD

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to TAB3-DMD

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to TAB3-DMD

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)