Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:TANK-MARCH7

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: TANK-MARCH7
	FusionPDB ID: 88993
	FusionGDB2.0 ID: 88993
		Hgene	Tgene
	Gene symbol	TANK	MARCH7
	Gene ID	10010	64844
	Gene name	TRAF family member associated NFKB activator	membrane associated ring-CH-type finger 7
	Synonyms	I-TRAF\|ITRAF\|TRAF2	AXO\|AXOT\|MARCH-VII\|MARCH7\|RNF177
	Cytomap	2q24.2	2q24.2
	Type of gene	protein-coding	protein-coding
	Description	TRAF family member-associated NF-kappa-B activatorTRAF-interacting protein	E3 ubiquitin-protein ligase MARCH7RING finger protein 177RING-type E3 ubiquitin transferase MARCH7axotrophinmembrane associated ring finger 7membrane-associated RING finger protein 7membrane-associated RING-CH protein VIImembrane-associated ring fi
	Modification date	20200313	20200313
	UniProtAcc	TBKBP1 Main function of 5'-partner protein: 615	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000259075, ENST00000392749, ENST00000402568, ENST00000403609, ENST00000405852, ENST00000406287, ENST00000457476, ENST00000461338,	ENST00000409591, ENST00000473749, ENST00000259050, ENST00000409175, ENST00000539065,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	9 X 8 X 6=432	9 X 7 X 9=567
	# samples	9	12
	** MAII score	log2(9/432*10)=-2.26303440583379 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(12/567*10)=-2.24031432933371 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: TANK [Title/Abstract] AND MARCH7 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: TANK [Title/Abstract] AND MARCH7 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	TANK(162061304)-MARCH7(160623795), # samples:3
Anticipated loss of major functional domain due to fusion event.	TANK-MARCH7 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. TANK-MARCH7 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. TANK-MARCH7 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. TANK-MARCH7 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. TANK-MARCH7 seems lost the major protein functional domain in Hgene partner, which is a essential gene due to the frame-shifted ORF. TANK-MARCH7 seems lost the major protein functional domain in Hgene partner, which is a tumor suppressor due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Tgene	MARCH7	GO:0006513	protein monoubiquitination	24905733

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr2:162061304/chr2:160623795)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across TANK (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across MARCH7 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000259075	TANK	chr2	162061304	+	ENST00000409175	MARCH7	chr2	160623795	+	618	532	97	600	167
ENST00000259075	TANK	chr2	162061304	+	ENST00000539065	MARCH7	chr2	160623795	+	931	532	97	600	167
ENST00000457476	TANK	chr2	162061304	+	ENST00000409175	MARCH7	chr2	160623795	+	638	552	50	412	120
ENST00000457476	TANK	chr2	162061304	+	ENST00000539065	MARCH7	chr2	160623795	+	951	552	50	412	120
ENST00000392749	TANK	chr2	162061304	+	ENST00000409175	MARCH7	chr2	160623795	+	652	566	239	634	131
ENST00000392749	TANK	chr2	162061304	+	ENST00000539065	MARCH7	chr2	160623795	+	965	566	239	634	131
ENST00000402568	TANK	chr2	162061304	+	ENST00000409175	MARCH7	chr2	160623795	+	731	645	36	713	225
ENST00000402568	TANK	chr2	162061304	+	ENST00000539065	MARCH7	chr2	160623795	+	1044	645	36	713	225
ENST00000406287	TANK	chr2	162061304	+	ENST00000409175	MARCH7	chr2	160623795	+	728	642	36	710	224
ENST00000406287	TANK	chr2	162061304	+	ENST00000539065	MARCH7	chr2	160623795	+	1041	642	36	710	224
ENST00000405852	TANK	chr2	162061304	+	ENST00000409175	MARCH7	chr2	160623795	+	510	424	97	492	131
ENST00000405852	TANK	chr2	162061304	+	ENST00000539065	MARCH7	chr2	160623795	+	823	424	97	492	131
ENST00000403609	TANK	chr2	162061304	+	ENST00000409175	MARCH7	chr2	160623795	+	522	436	42	296	84
ENST00000403609	TANK	chr2	162061304	+	ENST00000539065	MARCH7	chr2	160623795	+	835	436	42	296	84

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000259075	ENST00000409175	TANK	chr2	162061304	+	MARCH7	chr2	160623795	+	0.015169783	0.98483026
ENST00000259075	ENST00000539065	TANK	chr2	162061304	+	MARCH7	chr2	160623795	+	0.016441304	0.9835587
ENST00000457476	ENST00000409175	TANK	chr2	162061304	+	MARCH7	chr2	160623795	+	0.049552247	0.95044774
ENST00000457476	ENST00000539065	TANK	chr2	162061304	+	MARCH7	chr2	160623795	+	0.09950748	0.9004925
ENST00000392749	ENST00000409175	TANK	chr2	162061304	+	MARCH7	chr2	160623795	+	0.010701212	0.9892988
ENST00000392749	ENST00000539065	TANK	chr2	162061304	+	MARCH7	chr2	160623795	+	0.011993759	0.9880063
ENST00000402568	ENST00000409175	TANK	chr2	162061304	+	MARCH7	chr2	160623795	+	0.003707887	0.9962921
ENST00000402568	ENST00000539065	TANK	chr2	162061304	+	MARCH7	chr2	160623795	+	0.00200771	0.9979923
ENST00000406287	ENST00000409175	TANK	chr2	162061304	+	MARCH7	chr2	160623795	+	0.004734834	0.9952651
ENST00000406287	ENST00000539065	TANK	chr2	162061304	+	MARCH7	chr2	160623795	+	0.002787394	0.9972126
ENST00000405852	ENST00000409175	TANK	chr2	162061304	+	MARCH7	chr2	160623795	+	0.012372802	0.9876272
ENST00000405852	ENST00000539065	TANK	chr2	162061304	+	MARCH7	chr2	160623795	+	0.011854757	0.98814523
ENST00000403609	ENST00000409175	TANK	chr2	162061304	+	MARCH7	chr2	160623795	+	0.024249298	0.97575074
ENST00000403609	ENST00000539065	TANK	chr2	162061304	+	MARCH7	chr2	160623795	+	0.061073273	0.93892676

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for TANK-MARCH7

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
TANK	chr2	162061304	MARCH7	chr2	160623795	424	109	KVISGIAREKLPKLQRMIPKKTETIT
TANK	chr2	162061304	MARCH7	chr2	160623795	532	145	KVISGIAREKLPKLQRMIPKKTETIT
TANK	chr2	162061304	MARCH7	chr2	160623795	566	109	KVISGIAREKLPKLQRMIPKKTETIT
TANK	chr2	162061304	MARCH7	chr2	160623795	642	202	KVISGIAREKLPKLQRMIPKKTETIT
TANK	chr2	162061304	MARCH7	chr2	160623795	645	203	KVISGIAREKLPKLQRMIPKKTETIT

Top

Potential FusionNeoAntigen Information of TANK-MARCH7 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

TANK-MARCH7_162061304_160623795.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
TANK-MARCH7	chr2	162061304	chr2	160623795	532	HLA-A30:08	KLQRMIPKK	0.9929	0.6455	12	21
TANK-MARCH7	chr2	162061304	chr2	160623795	532	HLA-B14:02	EKLPKLQRM	0.9853	0.8026	8	17
TANK-MARCH7	chr2	162061304	chr2	160623795	532	HLA-B14:01	EKLPKLQRM	0.9853	0.8026	8	17
TANK-MARCH7	chr2	162061304	chr2	160623795	532	HLA-B08:09	LPKLQRMIP	0.9595	0.6841	10	19
TANK-MARCH7	chr2	162061304	chr2	160623795	532	HLA-B14:01	IAREKLPKL	0.9462	0.5596	5	14
TANK-MARCH7	chr2	162061304	chr2	160623795	532	HLA-B14:02	IAREKLPKL	0.9462	0.5596	5	14
TANK-MARCH7	chr2	162061304	chr2	160623795	532	HLA-B52:01	IAREKLPKL	0.7015	0.6409	5	14
TANK-MARCH7	chr2	162061304	chr2	160623795	532	HLA-B15:37	EKLPKLQRM	0.2799	0.5748	8	17
TANK-MARCH7	chr2	162061304	chr2	160623795	532	HLA-B27:05	AREKLPKLQR	0.9981	0.7451	6	16
TANK-MARCH7	chr2	162061304	chr2	160623795	532	HLA-B47:01	REKLPKLQRM	0.9829	0.5329	7	17
TANK-MARCH7	chr2	162061304	chr2	160623795	532	HLA-B27:04	AREKLPKLQRM	0.9999	0.6993	6	17
TANK-MARCH7	chr2	162061304	chr2	160623795	532	HLA-B27:05	AREKLPKLQRM	0.9999	0.6393	6	17
TANK-MARCH7	chr2	162061304	chr2	160623795	532	HLA-C01:30	KLPKLQRM	0.8663	0.9655	9	17
TANK-MARCH7	chr2	162061304	chr2	160623795	532	HLA-C15:04	IAREKLPKL	0.9968	0.8912	5	14
TANK-MARCH7	chr2	162061304	chr2	160623795	532	HLA-C03:08	IAREKLPKL	0.996	0.8569	5	14
TANK-MARCH7	chr2	162061304	chr2	160623795	532	HLA-C03:19	IAREKLPKL	0.9959	0.9821	5	14
TANK-MARCH7	chr2	162061304	chr2	160623795	532	HLA-C03:07	IAREKLPKL	0.9934	0.9739	5	14
TANK-MARCH7	chr2	162061304	chr2	160623795	532	HLA-C15:06	IAREKLPKL	0.9925	0.9081	5	14
TANK-MARCH7	chr2	162061304	chr2	160623795	532	HLA-C06:03	IAREKLPKL	0.992	0.9896	5	14
TANK-MARCH7	chr2	162061304	chr2	160623795	532	HLA-C12:12	IAREKLPKL	0.992	0.905	5	14
TANK-MARCH7	chr2	162061304	chr2	160623795	532	HLA-C12:04	IAREKLPKL	0.9919	0.9904	5	14
TANK-MARCH7	chr2	162061304	chr2	160623795	532	HLA-C12:16	IAREKLPKL	0.9684	0.9309	5	14
TANK-MARCH7	chr2	162061304	chr2	160623795	532	HLA-B39:12	EKLPKLQRM	0.9076	0.9161	8	17
TANK-MARCH7	chr2	162061304	chr2	160623795	532	HLA-B14:03	IAREKLPKL	0.7884	0.7362	5	14
TANK-MARCH7	chr2	162061304	chr2	160623795	532	HLA-C02:06	IAREKLPKL	0.7465	0.9276	5	14
TANK-MARCH7	chr2	162061304	chr2	160623795	532	HLA-B51:07	IAREKLPKL	0.6714	0.6068	5	14
TANK-MARCH7	chr2	162061304	chr2	160623795	532	HLA-C07:05	IAREKLPKL	0.5293	0.9513	5	14
TANK-MARCH7	chr2	162061304	chr2	160623795	532	HLA-C07:13	IAREKLPKL	0.4254	0.864	5	14
TANK-MARCH7	chr2	162061304	chr2	160623795	532	HLA-C01:30	IAREKLPKL	0.4022	0.9185	5	14
TANK-MARCH7	chr2	162061304	chr2	160623795	532	HLA-C03:14	IAREKLPKL	0.3588	0.9768	5	14
TANK-MARCH7	chr2	162061304	chr2	160623795	532	HLA-B14:03	EKLPKLQRM	0.3544	0.8508	8	17
TANK-MARCH7	chr2	162061304	chr2	160623795	532	HLA-C07:29	IAREKLPKL	0.3409	0.9391	5	14
TANK-MARCH7	chr2	162061304	chr2	160623795	532	HLA-C01:17	IAREKLPKL	0.2131	0.8596	5	14
TANK-MARCH7	chr2	162061304	chr2	160623795	532	HLA-C01:30	KLPKLQRMI	0.1019	0.9511	9	18
TANK-MARCH7	chr2	162061304	chr2	160623795	532	HLA-C01:17	KLPKLQRMI	0.0724	0.9483	9	18
TANK-MARCH7	chr2	162061304	chr2	160623795	532	HLA-B27:03	AREKLPKLQRM	0.9966	0.666	6	17
TANK-MARCH7	chr2	162061304	chr2	160623795	532	HLA-C15:09	IAREKLPKL	0.9968	0.8912	5	14
TANK-MARCH7	chr2	162061304	chr2	160623795	532	HLA-C03:03	IAREKLPKL	0.9954	0.9749	5	14
TANK-MARCH7	chr2	162061304	chr2	160623795	532	HLA-C03:04	IAREKLPKL	0.9954	0.9749	5	14
TANK-MARCH7	chr2	162061304	chr2	160623795	532	HLA-A30:01	KLQRMIPKK	0.9934	0.8054	12	21
TANK-MARCH7	chr2	162061304	chr2	160623795	532	HLA-C03:05	IAREKLPKL	0.9922	0.9115	5	14
TANK-MARCH7	chr2	162061304	chr2	160623795	532	HLA-C06:02	IAREKLPKL	0.9922	0.9898	5	14
TANK-MARCH7	chr2	162061304	chr2	160623795	532	HLA-C06:17	IAREKLPKL	0.9922	0.9898	5	14
TANK-MARCH7	chr2	162061304	chr2	160623795	532	HLA-C03:17	IAREKLPKL	0.9919	0.9357	5	14
TANK-MARCH7	chr2	162061304	chr2	160623795	532	HLA-C15:05	IAREKLPKL	0.9913	0.9175	5	14
TANK-MARCH7	chr2	162061304	chr2	160623795	532	HLA-C03:67	IAREKLPKL	0.9909	0.9559	5	14
TANK-MARCH7	chr2	162061304	chr2	160623795	532	HLA-C15:02	IAREKLPKL	0.9908	0.8934	5	14
TANK-MARCH7	chr2	162061304	chr2	160623795	532	HLA-C12:03	IAREKLPKL	0.9883	0.967	5	14
TANK-MARCH7	chr2	162061304	chr2	160623795	532	HLA-C03:02	IAREKLPKL	0.9878	0.9398	5	14
TANK-MARCH7	chr2	162061304	chr2	160623795	532	HLA-C12:02	IAREKLPKL	0.9591	0.9338	5	14
TANK-MARCH7	chr2	162061304	chr2	160623795	532	HLA-C16:04	IAREKLPKL	0.9161	0.9592	5	14
TANK-MARCH7	chr2	162061304	chr2	160623795	532	HLA-C03:06	IAREKLPKL	0.8878	0.9767	5	14
TANK-MARCH7	chr2	162061304	chr2	160623795	532	HLA-B07:13	IAREKLPKL	0.8344	0.6504	5	14
TANK-MARCH7	chr2	162061304	chr2	160623795	532	HLA-C07:04	IAREKLPKL	0.7453	0.8993	5	14
TANK-MARCH7	chr2	162061304	chr2	160623795	532	HLA-C16:01	IAREKLPKL	0.7007	0.9672	5	14
TANK-MARCH7	chr2	162061304	chr2	160623795	532	HLA-C07:22	IAREKLPKL	0.6849	0.6888	5	14
TANK-MARCH7	chr2	162061304	chr2	160623795	532	HLA-C06:08	IAREKLPKL	0.6442	0.977	5	14
TANK-MARCH7	chr2	162061304	chr2	160623795	532	HLA-C16:02	IAREKLPKL	0.6356	0.9877	5	14
TANK-MARCH7	chr2	162061304	chr2	160623795	532	HLA-C06:06	IAREKLPKL	0.6042	0.9844	5	14
TANK-MARCH7	chr2	162061304	chr2	160623795	532	HLA-C02:02	IAREKLPKL	0.5886	0.9645	5	14
TANK-MARCH7	chr2	162061304	chr2	160623795	532	HLA-C02:10	IAREKLPKL	0.5886	0.9645	5	14
TANK-MARCH7	chr2	162061304	chr2	160623795	532	HLA-C07:01	IAREKLPKL	0.2806	0.5847	5	14
TANK-MARCH7	chr2	162061304	chr2	160623795	532	HLA-C01:02	IAREKLPKL	0.2132	0.8568	5	14
TANK-MARCH7	chr2	162061304	chr2	160623795	532	HLA-C01:02	KLPKLQRMI	0.0738	0.945	9	18
TANK-MARCH7	chr2	162061304	chr2	160623795	532	HLA-C17:01	IAREKLPKL	0.0227	0.8319	5	14
TANK-MARCH7	chr2	162061304	chr2	160623795	532	HLA-B27:10	AREKLPKLQR	0.9965	0.848	6	16
TANK-MARCH7	chr2	162061304	chr2	160623795	532	HLA-B15:53	REKLPKLQRM	0.9756	0.8712	7	17
TANK-MARCH7	chr2	162061304	chr2	160623795	532	HLA-B27:09	AREKLPKLQRM	0.9996	0.6247	6	17

Top

Potential FusionNeoAntigen Information of TANK-MARCH7 in HLA II

TANK-MARCH7_162061304_160623795.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
TANK-MARCH7	chr2	162061304	chr2	160623795	532	DRB1-1401	KVISGIAREKLPKLQ	0	15
TANK-MARCH7	chr2	162061304	chr2	160623795	532	DRB1-1404	KVISGIAREKLPKLQ	0	15
TANK-MARCH7	chr2	162061304	chr2	160623795	532	DRB1-1418	KVISGIAREKLPKLQ	0	15
TANK-MARCH7	chr2	162061304	chr2	160623795	532	DRB1-1426	KVISGIAREKLPKLQ	0	15
TANK-MARCH7	chr2	162061304	chr2	160623795	532	DRB1-1428	KVISGIAREKLPKLQ	0	15
TANK-MARCH7	chr2	162061304	chr2	160623795	532	DRB1-1432	KVISGIAREKLPKLQ	0	15
TANK-MARCH7	chr2	162061304	chr2	160623795	532	DRB1-1435	KVISGIAREKLPKLQ	0	15
TANK-MARCH7	chr2	162061304	chr2	160623795	532	DRB1-1438	KVISGIAREKLPKLQ	0	15
TANK-MARCH7	chr2	162061304	chr2	160623795	532	DRB1-1443	KVISGIAREKLPKLQ	0	15
TANK-MARCH7	chr2	162061304	chr2	160623795	532	DRB1-1445	KVISGIAREKLPKLQ	0	15
TANK-MARCH7	chr2	162061304	chr2	160623795	532	DRB1-1450	KVISGIAREKLPKLQ	0	15
TANK-MARCH7	chr2	162061304	chr2	160623795	532	DRB1-1454	KVISGIAREKLPKLQ	0	15
TANK-MARCH7	chr2	162061304	chr2	160623795	532	DRB1-1455	KVISGIAREKLPKLQ	0	15
TANK-MARCH7	chr2	162061304	chr2	160623795	532	DRB1-1458	KVISGIAREKLPKLQ	0	15
TANK-MARCH7	chr2	162061304	chr2	160623795	532	DRB1-1460	KVISGIAREKLPKLQ	0	15
TANK-MARCH7	chr2	162061304	chr2	160623795	532	DRB1-1461	KVISGIAREKLPKLQ	0	15
TANK-MARCH7	chr2	162061304	chr2	160623795	532	DRB1-1462	KVISGIAREKLPKLQ	0	15
TANK-MARCH7	chr2	162061304	chr2	160623795	532	DRB1-1464	KVISGIAREKLPKLQ	0	15
TANK-MARCH7	chr2	162061304	chr2	160623795	532	DRB1-1470	KVISGIAREKLPKLQ	0	15
TANK-MARCH7	chr2	162061304	chr2	160623795	532	DRB1-1471	KVISGIAREKLPKLQ	0	15
TANK-MARCH7	chr2	162061304	chr2	160623795	532	DRB1-1472	KVISGIAREKLPKLQ	0	15
TANK-MARCH7	chr2	162061304	chr2	160623795	532	DRB1-1475	KVISGIAREKLPKLQ	0	15
TANK-MARCH7	chr2	162061304	chr2	160623795	532	DRB1-1482	KVISGIAREKLPKLQ	0	15
TANK-MARCH7	chr2	162061304	chr2	160623795	532	DRB1-1486	KVISGIAREKLPKLQ	0	15
TANK-MARCH7	chr2	162061304	chr2	160623795	532	DRB1-1487	KVISGIAREKLPKLQ	0	15
TANK-MARCH7	chr2	162061304	chr2	160623795	532	DRB1-1488	KVISGIAREKLPKLQ	0	15
TANK-MARCH7	chr2	162061304	chr2	160623795	532	DRB1-1490	KVISGIAREKLPKLQ	0	15
TANK-MARCH7	chr2	162061304	chr2	160623795	532	DRB1-1495	KVISGIAREKLPKLQ	0	15
TANK-MARCH7	chr2	162061304	chr2	160623795	532	DRB1-1497	KVISGIAREKLPKLQ	0	15
TANK-MARCH7	chr2	162061304	chr2	160623795	532	DRB1-1499	KVISGIAREKLPKLQ	0	15

Top

Fusion breakpoint peptide structures of TANK-MARCH7

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
545	AREKLPKLQRMIPK	TANK	MARCH7	chr2	162061304	chr2	160623795	532

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of TANK-MARCH7

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	545	AREKLPKLQRMIPK	-7.9962	-8.1096
HLA-B14:02	3BVN	545	AREKLPKLQRMIPK	-5.70842	-6.74372
HLA-B52:01	3W39	545	AREKLPKLQRMIPK	-6.83737	-6.95077
HLA-B52:01	3W39	545	AREKLPKLQRMIPK	-4.4836	-5.5189
HLA-A11:01	4UQ2	545	AREKLPKLQRMIPK	-10.0067	-10.1201
HLA-A11:01	4UQ2	545	AREKLPKLQRMIPK	-9.03915	-10.0745
HLA-A24:02	5HGA	545	AREKLPKLQRMIPK	-6.56204	-6.67544
HLA-A24:02	5HGA	545	AREKLPKLQRMIPK	-5.42271	-6.45801
HLA-B44:05	3DX8	545	AREKLPKLQRMIPK	-7.85648	-8.89178
HLA-B44:05	3DX8	545	AREKLPKLQRMIPK	-5.3978	-5.5112
HLA-A02:01	6TDR	545	AREKLPKLQRMIPK	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of TANK-MARCH7

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
TANK-MARCH7	chr2	162061304	chr2	160623795	10	19	LPKLQRMIP	CTACCAAAGCTTCAGAGGATGATTCCG
TANK-MARCH7	chr2	162061304	chr2	160623795	12	21	KLQRMIPKK	AAGCTTCAGAGGATGATTCCGAAGAAG
TANK-MARCH7	chr2	162061304	chr2	160623795	5	14	IAREKLPKL	ATAGCAAGAGAAAAACTACCAAAGCTT
TANK-MARCH7	chr2	162061304	chr2	160623795	6	16	AREKLPKLQR	GCAAGAGAAAAACTACCAAAGCTTCAGAGG
TANK-MARCH7	chr2	162061304	chr2	160623795	6	17	AREKLPKLQRM	GCAAGAGAAAAACTACCAAAGCTTCAGAGGATG
TANK-MARCH7	chr2	162061304	chr2	160623795	7	17	REKLPKLQRM	AGAGAAAAACTACCAAAGCTTCAGAGGATG
TANK-MARCH7	chr2	162061304	chr2	160623795	8	17	EKLPKLQRM	GAAAAACTACCAAAGCTTCAGAGGATG
TANK-MARCH7	chr2	162061304	chr2	160623795	9	17	KLPKLQRM	AAACTACCAAAGCTTCAGAGGATG
TANK-MARCH7	chr2	162061304	chr2	160623795	9	18	KLPKLQRMI	AAACTACCAAAGCTTCAGAGGATGATT

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
TANK-MARCH7	chr2	162061304	chr2	160623795	0	15	KVISGIAREKLPKLQ	AAAGTGATTTCAGGAATAGCAAGAGAAAAACTACCAAAGCTTCAG

Top

Information of the samples that have these potential fusion neoantigens of TANK-MARCH7

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
PAAD	TANK-MARCH7	chr2	162061304	ENST00000259075	chr2	160623795	ENST00000409175	TCGA-F2-6879-01A

Top

Potential target of CAR-T therapy development for TANK-MARCH7

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to TANK-MARCH7

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to TANK-MARCH7

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)