|
|||||||
|
Fusion Protein:TEAD1-CTR9 |
Fusion Gene and Fusion Protein Summary |
 Fusion gene summary |
| Fusion partner gene information | Fusion gene name: TEAD1-CTR9 | FusionPDB ID: 89953 | FusionGDB2.0 ID: 89953 | Hgene | Tgene | Gene symbol | TEAD1 | CTR9 | Gene ID | 7003 | 9646 |
| Gene name | TEA domain transcription factor 1 | CTR9 homolog, Paf1/RNA polymerase II complex component | |
| Synonyms | AA|NTEF-1|REF1|TCF-13|TCF13|TEAD-1|TEF-1 | SH2BP1|TSBP|p150|p150TSP | |
| Cytomap | 11p15.3 | 11p15.4 | |
| Type of gene | protein-coding | protein-coding | |
| Description | transcriptional enhancer factor TEF-1TEA domain family member 1 (SV40 transcriptional enhancer factor)protein GT-IICtranscription factor 13transcriptional enhancer factor 1 | RNA polymerase-associated protein CTR9 homologCtr9, Paf1/RNA polymerase II complex component, homologSH2 domain binding protein 1 (tetratricopeptide repeat containing)TPR-containing, SH2-binding phosphoprotein | |
| Modification date | 20200329 | 20200313 | |
| UniProtAcc | . | Q6PD62 Main function of 5'-partner protein: FUNCTION: Component of the PAF1 complex (PAF1C) which has multiple functions during transcription by RNA polymerase II and is implicated in regulation of development and maintenance of embryonic stem cell pluripotency. PAF1C associates with RNA polymerase II through interaction with POLR2A CTD non-phosphorylated and 'Ser-2'- and 'Ser-5'-phosphorylated forms and is involved in transcriptional elongation, acting both independently and synergistically with TCEA1 and in cooperation with the DSIF complex and HTATSF1. PAF1C is required for transcription of Hox and Wnt target genes. PAF1C is involved in hematopoiesis and stimulates transcriptional activity of KMT2A/MLL1; it promotes leukemogenesis through association with KMT2A/MLL1-rearranged oncoproteins, such as KMT2A/MLL1-MLLT3/AF9 and KMT2A/MLL1-MLLT1/ENL. PAF1C is involved in histone modifications such as ubiquitination of histone H2B and methylation on histone H3 'Lys-4' (H3K4me3). PAF1C recruits the RNF20/40 E3 ubiquitin-protein ligase complex and the E2 enzyme UBE2A or UBE2B to chromatin which mediate monoubiquitination of 'Lys-120' of histone H2B (H2BK120ub1); UB2A/B-mediated H2B ubiquitination is proposed to be coupled to transcription. PAF1C is involved in mRNA 3' end formation probably through association with cleavage and poly(A) factors. In case of infection by influenza A strain H3N2, PAF1C associates with viral NS1 protein, thereby regulating gene transcription. Required for mono- and trimethylation on histone H3 'Lys-4' (H3K4me3) and dimethylation on histone H3 'Lys-79' (H3K4me3). Required for Hox gene transcription. Required for the trimethylation of histone H3 'Lys-4' (H3K4me3) on genes involved in stem cell pluripotency; this function is synergistic with CXXC1 indicative for an involvement of the SET1 complex. Involved in transcriptional regulation of IL6-responsive genes and in JAK-STAT pathway; may regulate DNA-association of STAT3 (By similarity). {ECO:0000250|UniProtKB:Q62018, ECO:0000269|PubMed:16024656, ECO:0000269|PubMed:16307923, ECO:0000269|PubMed:19345177, ECO:0000269|PubMed:19952111, ECO:0000269|PubMed:20178742, ECO:0000269|PubMed:20541477, ECO:0000269|PubMed:21329879}. | |
| Ensembl transtripts involved in fusion gene | ENST ids | ENST00000361905, ENST00000361985, ENST00000526600, ENST00000527636, ENST00000334310, ENST00000527575, | ENST00000361367, |
| Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 19 X 11 X 12=2508 | 6 X 6 X 4=144 |
| # samples | 23 | 6 | |
| ** MAII score | log2(23/2508*10)=-3.44683158185766 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(6/144*10)=-1.26303440583379 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
| Fusion gene context | PubMed: TEAD1 [Title/Abstract] AND CTR9 [Title/Abstract] AND fusion [Title/Abstract] | ||
| Fusion neoantigen context | PubMed: TEAD1 [Title/Abstract] AND CTR9 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
| Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | TEAD1(12923660)-CTR9(10784978), # samples:3 | ||
| Anticipated loss of major functional domain due to fusion event. | TEAD1-CTR9 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. TEAD1-CTR9 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. TEAD1-CTR9 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. TEAD1-CTR9 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. | ||
| * DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
| Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Partner | Gene | GO ID | GO term | PubMed ID |
| Hgene | TEAD1 | GO:0035329 | hippo signaling | 18579750|19324877 |
| Tgene | CTR9 | GO:0010390 | histone monoubiquitination | 16307923 |
| Tgene | CTR9 | GO:0019827 | stem cell population maintenance | 19345177 |
| Tgene | CTR9 | GO:0032968 | positive regulation of transcription elongation from RNA polymerase II promoter | 20178742 |
| Tgene | CTR9 | GO:0033523 | histone H2B ubiquitination | 16307923 |
| Tgene | CTR9 | GO:0045638 | negative regulation of myeloid cell differentiation | 20541477 |
| Tgene | CTR9 | GO:0045944 | positive regulation of transcription by RNA polymerase II | 20178742 |
| Four levels of functional features of fusion genes Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr11:12923660/chr11:10784978) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
 |
| Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here. |
| Fusion gene breakpoints across TEAD1 (5'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
| Fusion gene breakpoints across CTR9 (3'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Fusion Amino Acid Sequences |
| Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
| ENST00000361905 | TEAD1 | chr11 | 12923660 | + | ENST00000361367 | CTR9 | chr11 | 10784978 | + | 4804 | 1493 | 542 | 4165 | 1207 |
| ENST00000527636 | TEAD1 | chr11 | 12923660 | + | ENST00000361367 | CTR9 | chr11 | 10784978 | + | 4635 | 1324 | 373 | 3996 | 1207 |
| ENST00000361985 | TEAD1 | chr11 | 12923660 | + | ENST00000361367 | CTR9 | chr11 | 10784978 | + | 4338 | 1027 | 133 | 3699 | 1188 |
| ENST00000526600 | TEAD1 | chr11 | 12923660 | + | ENST00000361367 | CTR9 | chr11 | 10784978 | + | 4119 | 808 | 115 | 3480 | 1121 |
| DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
| ENST00000361905 | ENST00000361367 | TEAD1 | chr11 | 12923660 | + | CTR9 | chr11 | 10784978 | + | 0.001895307 | 0.9981047 |
| ENST00000527636 | ENST00000361367 | TEAD1 | chr11 | 12923660 | + | CTR9 | chr11 | 10784978 | + | 0.001524951 | 0.998475 |
| ENST00000361985 | ENST00000361367 | TEAD1 | chr11 | 12923660 | + | CTR9 | chr11 | 10784978 | + | 0.001043332 | 0.9989567 |
| ENST00000526600 | ENST00000361367 | TEAD1 | chr11 | 12923660 | + | CTR9 | chr11 | 10784978 | + | 0.000554534 | 0.9994455 |
| Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones. |
Get the fusion protein sequences from here. |
| Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for TEAD1-CTR9 |
| +/-13 AA sequence from the breakpoints of the fusion protein sequences. |
| Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
| TEAD1 | chr11 | 12923660 | CTR9 | chr11 | 10784978 | 1027 | 298 | KGPQNAFFLVKFWDYSKVQHLALHAF |
| TEAD1 | chr11 | 12923660 | CTR9 | chr11 | 10784978 | 1324 | 317 | KGPQNAFFLVKFWDYSKVQHLALHAF |
| TEAD1 | chr11 | 12923660 | CTR9 | chr11 | 10784978 | 1493 | 317 | KGPQNAFFLVKFWDYSKVQHLALHAF |
| TEAD1 | chr11 | 12923660 | CTR9 | chr11 | 10784978 | 808 | 231 | KGPQNAFFLVKFWDYSKVQHLALHAF |
Top |
Potential FusionNeoAntigen Information of TEAD1-CTR9 in HLA I |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| TEAD1-CTR9_12923660_10784978.msa |
| Potential FusionNeoAntigen Information * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
| TEAD1-CTR9 | chr11 | 12923660 | chr11 | 10784978 | 1493 | HLA-B39:13 | WDYSKVQHL | 0.676 | 0.7771 | 12 | 21 |
| TEAD1-CTR9 | chr11 | 12923660 | chr11 | 10784978 | 1493 | HLA-B13:01 | WDYSKVQHL | 0.6385 | 0.81 | 12 | 21 |
| TEAD1-CTR9 | chr11 | 12923660 | chr11 | 10784978 | 1493 | HLA-B39:08 | WDYSKVQHL | 0.8724 | 0.7723 | 12 | 21 |
| TEAD1-CTR9 | chr11 | 12923660 | chr11 | 10784978 | 1493 | HLA-C04:10 | FWDYSKVQHL | 0.9999 | 0.8742 | 11 | 21 |
| TEAD1-CTR9 | chr11 | 12923660 | chr11 | 10784978 | 1493 | HLA-C04:07 | FWDYSKVQHL | 0.9998 | 0.8764 | 11 | 21 |
| TEAD1-CTR9 | chr11 | 12923660 | chr11 | 10784978 | 1493 | HLA-C07:29 | FWDYSKVQHL | 0.9929 | 0.9142 | 11 | 21 |
| TEAD1-CTR9 | chr11 | 12923660 | chr11 | 10784978 | 1493 | HLA-C07:13 | FWDYSKVQHL | 0.9909 | 0.8818 | 11 | 21 |
| TEAD1-CTR9 | chr11 | 12923660 | chr11 | 10784978 | 1493 | HLA-C04:14 | FWDYSKVQHL | 0.9777 | 0.7945 | 11 | 21 |
| TEAD1-CTR9 | chr11 | 12923660 | chr11 | 10784978 | 1493 | HLA-B39:02 | WDYSKVQHL | 0.8425 | 0.7723 | 12 | 21 |
| TEAD1-CTR9 | chr11 | 12923660 | chr11 | 10784978 | 1493 | HLA-B40:04 | WDYSKVQHL | 0.8177 | 0.5751 | 12 | 21 |
| TEAD1-CTR9 | chr11 | 12923660 | chr11 | 10784978 | 1493 | HLA-C18:01 | FWDYSKVQHL | 0.9998 | 0.8656 | 11 | 21 |
| TEAD1-CTR9 | chr11 | 12923660 | chr11 | 10784978 | 1493 | HLA-C04:01 | FWDYSKVQHL | 0.9998 | 0.8764 | 11 | 21 |
| TEAD1-CTR9 | chr11 | 12923660 | chr11 | 10784978 | 1493 | HLA-C07:04 | FWDYSKVQHL | 0.9955 | 0.9201 | 11 | 21 |
| TEAD1-CTR9 | chr11 | 12923660 | chr11 | 10784978 | 1493 | HLA-C04:04 | FWDYSKVQHL | 0.9919 | 0.827 | 11 | 21 |
Top |
Potential FusionNeoAntigen Information of TEAD1-CTR9 in HLA II |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| Potential FusionNeoAntigen Information * We used NetMHCIIpan v4.1 (%rank<0.5). |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of TEAD1-CTR9 |
| 3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
| File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
| 2364 | FFLVKFWDYSKVQH | TEAD1 | CTR9 | chr11 | 12923660 | chr11 | 10784978 | 1493 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of TEAD1-CTR9 |
| Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens * We used Glide to predict the interaction between HLAs and neoantigens. |
| HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
| HLA-B14:02 | 3BVN | 2364 | FFLVKFWDYSKVQH | -6.6827 | -6.7945 |
| HLA-B14:02 | 3BVN | 2364 | FFLVKFWDYSKVQH | -1.45212 | -2.49522 |
| HLA-B52:01 | 3W39 | 2364 | FFLVKFWDYSKVQH | -6.45613 | -6.56793 |
| HLA-B52:01 | 3W39 | 2364 | FFLVKFWDYSKVQH | -3.70581 | -4.74891 |
| HLA-A11:01 | 4UQ2 | 2364 | FFLVKFWDYSKVQH | -9.38435 | -9.49615 |
| HLA-A24:02 | 5HGA | 2364 | FFLVKFWDYSKVQH | -8.10956 | -8.22136 |
| HLA-A24:02 | 5HGA | 2364 | FFLVKFWDYSKVQH | -6.02437 | -7.06747 |
| HLA-B27:05 | 6PYJ | 2364 | FFLVKFWDYSKVQH | -5.90005 | -6.94315 |
| HLA-B44:05 | 3DX8 | 2364 | FFLVKFWDYSKVQH | -6.67369 | -7.71679 |
| HLA-B44:05 | 3DX8 | 2364 | FFLVKFWDYSKVQH | -5.40805 | -5.51985 |
Top |
Vaccine Design for the FusionNeoAntigens of TEAD1-CTR9 |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
| TEAD1-CTR9 | chr11 | 12923660 | chr11 | 10784978 | 11 | 21 | FWDYSKVQHL | TTCTGGGATTATAGTAAAGTCCAGCATCTG |
| TEAD1-CTR9 | chr11 | 12923660 | chr11 | 10784978 | 12 | 21 | WDYSKVQHL | TGGGATTATAGTAAAGTCCAGCATCTG |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of TEAD1-CTR9 |
| These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens. |
| Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
| UCEC | TEAD1-CTR9 | chr11 | 12923660 | ENST00000361905 | chr11 | 10784978 | ENST00000361367 | TCGA-EO-A3KU-01A |
Top |
Potential target of CAR-T therapy development for TEAD1-CTR9 |
| Predicted 3D structure. We used RoseTTAFold. |
| Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features * Minus value of BPloci means that the break point is located before the CDS. |
| - In-frame and retained 'Transmembrane'. |
| Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
| Subcellular localization prediction of the transmembrane domain retained fusion proteins * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
| Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to TEAD1-CTR9 |
| Drugs used for this fusion-positive patient. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to TEAD1-CTR9 |
| Diseases that have this fusion gene. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Disease | Source | PMID |
| Diseases associated with fusion partners. (DisGeNet 4.0) |
| Partner | Gene | Disease ID | Disease name | # pubmeds | Source |
Copyright 2023-PresentThe University of Texas Health Science Center at Houston (UTHealth)
Web File Viewing | Emergency Information
Campus Carry|Site Policies