Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:TET3-C2orf78

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: TET3-C2orf78
	FusionPDB ID: 90181
	FusionGDB2.0 ID: 90181
		Hgene	Tgene
	Gene symbol	TET3	C2orf78
	Gene ID	200424	388960
	Gene name	tet methylcytosine dioxygenase 3	chromosome 2 open reading frame 78
	Synonyms	BEFAHRS\|hCG_40738	COG5373\|hCG1989538
	Cytomap	2p13.1	2p13.1
	Type of gene	protein-coding	protein-coding
	Description	methylcytosine dioxygenase TET3probable methylcytosine dioxygenase TET3putative methylcytosine dioxygenasetet oncogene family member 3	uncharacterized protein C2orf78
	Modification date	20200314	20200313
	UniProtAcc	.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000409262,	ENST00000409561,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	17 X 13 X 11=2431	3 X 2 X 3=18
	# samples	26	5
	** MAII score	log2(26/2431*10)=-3.22496636500027 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(5/18*10)=1.47393118833241 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0
Fusion gene context	PubMed: TET3 [Title/Abstract] AND C2orf78 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: TET3 [Title/Abstract] AND C2orf78 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	TET3(74275538)-C2orf78(74040604), # samples:3
Anticipated loss of major functional domain due to fusion event.	TET3-C2orf78 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. TET3-C2orf78 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. TET3-C2orf78 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. TET3-C2orf78 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner

Gene

GO ID

GO term

PubMed ID

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr2:74275538/chr2:74040604)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across TET3 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across C2orf78 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst

Tenst

Hgene

Hchr

Hbp

Hstrand

Tgene

Tchr

Tbp

Tstrand

Seq length
(transcript)

BP loci
(transcript)

Predicted start
(transcript)

Predicted stop
(transcript)

Seq length
(amino acids)

ENST00000409262

TET3

chr2

74275538

ENST00000409561

C2orf78

chr2

74040604

4916

2089

4760

1586

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000409262	ENST00000409561	TET3	chr2	74275538	+	C2orf78	chr2	74040604	+	0.001876951	0.998123

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for TET3-C2orf78

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
TET3	chr2	74275538	C2orf78	chr2	74040604	2089	696	KRAQAEFPTCDCVEYFQNTSLPGTAN

Top

Potential FusionNeoAntigen Information of TET3-C2orf78 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

TET3-C2orf78_74275538_74040604.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	HLA-B35:01	FPTCDCVEY	0.9986	0.8844	6	15
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	HLA-B35:08	FPTCDCVEY	0.9978	0.8942	6	15
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	HLA-B13:01	VEYFQNTSL	0.9934	0.7885	12	21
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	HLA-B35:05	FPTCDCVEY	0.9569	0.6065	6	15
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	HLA-B18:01	VEYFQNTSL	0.9222	0.9147	12	21
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	HLA-B14:01	VEYFQNTSL	0.9073	0.7403	12	21
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	HLA-B14:02	VEYFQNTSL	0.9073	0.7403	12	21
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	HLA-B39:13	VEYFQNTSL	0.5194	0.9212	12	21
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	HLA-B15:37	VEYFQNTSL	0.4734	0.5743	12	21
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	HLA-B35:02	FPTCDCVEY	0.4614	0.9514	6	15
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	HLA-B35:04	FPTCDCVEY	0.4614	0.9514	6	15
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	HLA-B41:01	VEYFQNTSL	0.3168	0.9231	12	21
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	HLA-B15:03	VEYFQNTSL	0.315	0.6572	12	21
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	HLA-B50:01	VEYFQNTSL	0.3077	0.5331	12	21
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	HLA-B52:01	VEYFQNTSL	0.1634	0.8725	12	21
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	HLA-B35:01	FPTCDCVEYF	0.997	0.9162	6	16
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	HLA-B35:08	FPTCDCVEYF	0.994	0.9082	6	16
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	HLA-B50:01	VEYFQNTSLP	0.8083	0.551	12	22
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	HLA-B44:03	AEFPTCDCVEY	0.9986	0.9738	4	15
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	HLA-B47:01	AEFPTCDCVEY	0.9975	0.6904	4	15
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	HLA-B18:01	AEFPTCDCVEY	0.9334	0.9227	4	15
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	HLA-B40:06	VEYFQNTSL	0.9992	0.5453	12	21
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	HLA-B15:31	FPTCDCVEY	0.9985	0.8954	6	15
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	HLA-B39:09	VEYFQNTSL	0.6141	0.61	12	21
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	HLA-B39:08	VEYFQNTSL	0.61	0.8334	12	21
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	HLA-B14:03	VEYFQNTSL	0.5944	0.8077	12	21
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	HLA-B39:05	VEYFQNTSL	0.4734	0.9189	12	21
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	HLA-B35:12	FPTCDCVEY	0.4614	0.9514	6	15
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	HLA-B51:07	VEYFQNTSL	0.1217	0.7399	12	21
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	HLA-B40:04	VEYFQNTSL	0.9986	0.5717	12	21
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	HLA-B35:77	FPTCDCVEY	0.9986	0.8844	6	15
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	HLA-B35:23	FPTCDCVEY	0.9984	0.8803	6	15
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	HLA-B35:20	FPTCDCVEY	0.9982	0.932	6	15
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	HLA-B35:24	FPTCDCVEY	0.9915	0.9237	6	15
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	HLA-B35:11	FPTCDCVEY	0.9889	0.9075	6	15
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	HLA-B35:30	FPTCDCVEY	0.9848	0.7509	6	15
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	HLA-B35:17	FPTCDCVEY	0.9848	0.7509	6	15
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	HLA-B18:04	VEYFQNTSL	0.9486	0.9223	12	21
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	HLA-B18:07	VEYFQNTSL	0.9334	0.8813	12	21
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	HLA-B18:05	VEYFQNTSL	0.9222	0.9147	12	21
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	HLA-B18:08	VEYFQNTSL	0.9196	0.8295	12	21
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	HLA-B18:06	VEYFQNTSL	0.8968	0.9184	12	21
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	HLA-B18:03	VEYFQNTSL	0.8885	0.9061	12	21
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	HLA-B18:11	VEYFQNTSL	0.6317	0.8478	12	21
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	HLA-B39:02	VEYFQNTSL	0.6099	0.9255	12	21
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	HLA-B39:31	VEYFQNTSL	0.5848	0.9332	12	21
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	HLA-B39:11	VEYFQNTSL	0.5716	0.7977	12	21
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	HLA-B15:54	VEYFQNTSL	0.4953	0.7182	12	21
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	HLA-B15:53	VEYFQNTSL	0.4664	0.7422	12	21
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	HLA-B35:09	FPTCDCVEY	0.4614	0.9514	6	15
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	HLA-B18:07	FPTCDCVEY	0.4293	0.8941	6	15
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	HLA-B41:03	VEYFQNTSL	0.4007	0.5571	12	21
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	HLA-B48:02	VEYFQNTSL	0.3613	0.791	12	21
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	HLA-B15:08	FPTCDCVEY	0.3141	0.8708	6	15
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	HLA-B50:05	VEYFQNTSL	0.3077	0.5331	12	21
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	HLA-B50:04	VEYFQNTSL	0.3077	0.5331	12	21
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	HLA-B15:11	FPTCDCVEY	0.2907	0.8868	6	15
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	HLA-B35:43	FPTCDCVEY	0.2575	0.8746	6	15
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	HLA-B35:77	FPTCDCVEYF	0.997	0.9162	6	16
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	HLA-B35:23	FPTCDCVEYF	0.9967	0.9142	6	16
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	HLA-B50:04	VEYFQNTSLP	0.8083	0.551	12	22
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	HLA-B50:05	VEYFQNTSLP	0.8083	0.551	12	22
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	HLA-B44:07	AEFPTCDCVEY	0.9986	0.9738	4	15
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	HLA-B44:26	AEFPTCDCVEY	0.9986	0.9738	4	15
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	HLA-B44:13	AEFPTCDCVEY	0.9986	0.9738	4	15
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	HLA-B18:11	AEFPTCDCVEY	0.9814	0.8908	4	15
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	HLA-B15:53	AEFPTCDCVEY	0.9735	0.8967	4	15
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	HLA-B35:28	AEFPTCDCVEY	0.9699	0.9111	4	15
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	HLA-B18:08	AEFPTCDCVEY	0.9415	0.8769	4	15
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	HLA-B18:05	AEFPTCDCVEY	0.9334	0.9227	4	15
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	HLA-B18:06	AEFPTCDCVEY	0.9222	0.9335	4	15
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	HLA-B48:02	AEFPTCDCVEY	0.764	0.903	4	15
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	HLA-B18:03	DCVEYFQNTSL	0.747	0.898	10	21

Top

Potential FusionNeoAntigen Information of TET3-C2orf78 in HLA II

TET3-C2orf78_74275538_74040604.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	DRB1-0434	CVEYFQNTSLPGTAN	11	26
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	DRB3-0202	CVEYFQNTSLPGTAN	11	26
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	DRB3-0202	DCVEYFQNTSLPGTA	10	25
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	DRB3-0205	CVEYFQNTSLPGTAN	11	26
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	DRB3-0205	DCVEYFQNTSLPGTA	10	25
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	DRB3-0205	CDCVEYFQNTSLPGT	9	24
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	DRB3-0210	CVEYFQNTSLPGTAN	11	26
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	DRB3-0210	DCVEYFQNTSLPGTA	10	25
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	DRB3-0211	CVEYFQNTSLPGTAN	11	26
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	DRB3-0211	DCVEYFQNTSLPGTA	10	25
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	DRB3-0212	CVEYFQNTSLPGTAN	11	26
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	DRB3-0212	DCVEYFQNTSLPGTA	10	25
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	DRB3-0213	CVEYFQNTSLPGTAN	11	26
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	DRB3-0213	DCVEYFQNTSLPGTA	10	25
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	DRB3-0215	CVEYFQNTSLPGTAN	11	26
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	DRB3-0215	DCVEYFQNTSLPGTA	10	25
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	DRB3-0216	CVEYFQNTSLPGTAN	11	26
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	DRB3-0217	CVEYFQNTSLPGTAN	11	26
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	DRB3-0217	DCVEYFQNTSLPGTA	10	25
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	DRB3-0218	CVEYFQNTSLPGTAN	11	26
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	DRB3-0218	DCVEYFQNTSLPGTA	10	25
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	DRB3-0219	CVEYFQNTSLPGTAN	11	26
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	DRB3-0219	DCVEYFQNTSLPGTA	10	25
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	DRB3-0220	CVEYFQNTSLPGTAN	11	26
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	DRB3-0220	DCVEYFQNTSLPGTA	10	25
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	DRB3-0222	CVEYFQNTSLPGTAN	11	26
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	DRB3-0222	DCVEYFQNTSLPGTA	10	25
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	DRB3-0223	CVEYFQNTSLPGTAN	11	26
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	DRB3-0223	DCVEYFQNTSLPGTA	10	25
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	DRB3-0225	CVEYFQNTSLPGTAN	11	26
TET3-C2orf78	chr2	74275538	chr2	74040604	2089	DRB3-0225	DCVEYFQNTSLPGTA	10	25

Top

Fusion breakpoint peptide structures of TET3-C2orf78

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
2512	FPTCDCVEYFQNTS	TET3	C2orf78	chr2	74275538	chr2	74040604	2089

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of TET3-C2orf78

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	2512	FPTCDCVEYFQNTS	-7.9962	-8.1096
HLA-B14:02	3BVN	2512	FPTCDCVEYFQNTS	-5.70842	-6.74372
HLA-B52:01	3W39	2512	FPTCDCVEYFQNTS	-6.83737	-6.95077
HLA-B52:01	3W39	2512	FPTCDCVEYFQNTS	-4.4836	-5.5189
HLA-A11:01	4UQ2	2512	FPTCDCVEYFQNTS	-10.0067	-10.1201
HLA-A11:01	4UQ2	2512	FPTCDCVEYFQNTS	-9.03915	-10.0745
HLA-A24:02	5HGA	2512	FPTCDCVEYFQNTS	-6.56204	-6.67544
HLA-A24:02	5HGA	2512	FPTCDCVEYFQNTS	-5.42271	-6.45801
HLA-B44:05	3DX8	2512	FPTCDCVEYFQNTS	-7.85648	-8.89178
HLA-B44:05	3DX8	2512	FPTCDCVEYFQNTS	-5.3978	-5.5112
HLA-A02:01	6TDR	2512	FPTCDCVEYFQNTS	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of TET3-C2orf78

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
TET3-C2orf78	chr2	74275538	chr2	74040604	10	21	DCVEYFQNTSL	ATTGCGTCGAATATTTCCAAAATACGTCTTTAC
TET3-C2orf78	chr2	74275538	chr2	74040604	12	21	VEYFQNTSL	TCGAATATTTCCAAAATACGTCTTTAC
TET3-C2orf78	chr2	74275538	chr2	74040604	12	22	VEYFQNTSLP	TCGAATATTTCCAAAATACGTCTTTACCTG
TET3-C2orf78	chr2	74275538	chr2	74040604	4	15	AEFPTCDCVEY	CCGAGTTCCCCACCTGCGATTGCGTCGAATATT
TET3-C2orf78	chr2	74275538	chr2	74040604	6	15	FPTCDCVEY	TCCCCACCTGCGATTGCGTCGAATATT
TET3-C2orf78	chr2	74275538	chr2	74040604	6	16	FPTCDCVEYF	TCCCCACCTGCGATTGCGTCGAATATTTCC

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
TET3-C2orf78	chr2	74275538	chr2	74040604	10	25	DCVEYFQNTSLPGTA	ATTGCGTCGAATATTTCCAAAATACGTCTTTACCTGGAACTGCAA
TET3-C2orf78	chr2	74275538	chr2	74040604	11	26	CVEYFQNTSLPGTAN	GCGTCGAATATTTCCAAAATACGTCTTTACCTGGAACTGCAAATT
TET3-C2orf78	chr2	74275538	chr2	74040604	9	24	CDCVEYFQNTSLPGT	GCGATTGCGTCGAATATTTCCAAAATACGTCTTTACCTGGAACTG

Top

Information of the samples that have these potential fusion neoantigens of TET3-C2orf78

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
BRCA	TET3-C2orf78	chr2	74275538	ENST00000409262	chr2	74040604	ENST00000409561	TCGA-C8-A135-01A

Top

Potential target of CAR-T therapy development for TET3-C2orf78

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to TET3-C2orf78

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to TET3-C2orf78

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)