![]() |
|||||||
|
Fusion Protein:THRA-CDK12 |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: THRA-CDK12 | FusionPDB ID: 90696 | FusionGDB2.0 ID: 90696 | Hgene | Tgene | Gene symbol | THRA | CDK12 | Gene ID | 7067 | 51755 |
Gene name | thyroid hormone receptor alpha | cyclin dependent kinase 12 | |
Synonyms | AR7|CHNG6|EAR7|ERB-T-1|ERBA|ERBA1|NR1A1|THRA1|THRA2|c-ERBA-1 | CRK7|CRKR|CRKRS | |
Cytomap | 17q21.1 | 17q12 | |
Type of gene | protein-coding | protein-coding | |
Description | thyroid hormone receptor alphaEAR-7ERBA-related 7V-erbA-related protein 7c-erbA-alphanuclear receptor subfamily 1 group A member 1thyroid hormone receptor alpha 1thyroid hormone receptor, alpha (erythroblastic leukemia viral (v-erb-a) oncogene homo | cyclin-dependent kinase 12CDC2-related protein kinase 7Cdc2-related kinase, arginine/serine-richcell division cycle 2-related protein kinase 7cell division protein kinase 12 | |
Modification date | 20200313 | 20200313 | |
UniProtAcc | . | Q9NYV4 Main function of 5'-partner protein: FUNCTION: Cyclin-dependent kinase that phosphorylates the C-terminal domain (CTD) of the large subunit of RNA polymerase II (POLR2A), thereby acting as a key regulator of transcription elongation. Regulates the expression of genes involved in DNA repair and is required for the maintenance of genomic stability. Preferentially phosphorylates 'Ser-5' in CTD repeats that are already phosphorylated at 'Ser-7', but can also phosphorylate 'Ser-2'. Required for RNA splicing, possibly by phosphorylating SRSF1/SF2. Involved in regulation of MAP kinase activity, possibly leading to affect the response to estrogen inhibitors. {ECO:0000269|PubMed:11683387, ECO:0000269|PubMed:19651820, ECO:0000269|PubMed:20952539, ECO:0000269|PubMed:22012619, ECO:0000269|PubMed:24662513}. | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000264637, ENST00000394121, ENST00000450525, ENST00000546243, ENST00000584985, | ENST00000430627, ENST00000447079, ENST00000559545, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 14 X 10 X 10=1400 | 36 X 30 X 14=15120 |
# samples | 23 | 55 | |
** MAII score | log2(23/1400*10)=-2.60572106088795 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(55/15120*10)=-4.78088271069641 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: THRA [Title/Abstract] AND CDK12 [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: THRA [Title/Abstract] AND CDK12 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | THRA(38245586)-CDK12(37686884), # samples:3 | ||
Anticipated loss of major functional domain due to fusion event. | THRA-CDK12 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. THRA-CDK12 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. THRA-CDK12 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. THRA-CDK12 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. THRA-CDK12 seems lost the major protein functional domain in Hgene partner, which is a IUPHAR drug target due to the frame-shifted ORF. THRA-CDK12 seems lost the major protein functional domain in Hgene partner, which is a transcription factor due to the frame-shifted ORF. THRA-CDK12 seems lost the major protein functional domain in Hgene partner, which is a tumor suppressor due to the frame-shifted ORF. THRA-CDK12 seems lost the major protein functional domain in Tgene partner, which is a CGC due to the frame-shifted ORF. THRA-CDK12 seems lost the major protein functional domain in Tgene partner, which is a essential gene due to the frame-shifted ORF. THRA-CDK12 seems lost the major protein functional domain in Tgene partner, which is a IUPHAR drug target due to the frame-shifted ORF. THRA-CDK12 seems lost the major protein functional domain in Tgene partner, which is a kinase due to the frame-shifted ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Hgene | THRA | GO:0006357 | regulation of transcription by RNA polymerase II | 18052923 |
Hgene | THRA | GO:0006366 | transcription by RNA polymerase II | 8710870|9653119 |
Hgene | THRA | GO:0009755 | hormone-mediated signaling pathway | 18052923 |
Hgene | THRA | GO:0017055 | negative regulation of RNA polymerase II transcriptional preinitiation complex assembly | 8524305 |
Hgene | THRA | GO:0045892 | negative regulation of transcription, DNA-templated | 8710870 |
Hgene | THRA | GO:2000143 | negative regulation of DNA-templated transcription, initiation | 8524305 |
Tgene | CDK12 | GO:0046777 | protein autophosphorylation | 11683387 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr17:38245586/chr17:37686884) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000394121 | THRA | chr17 | 38245586 | + | ENST00000430627 | CDK12 | chr17 | 37686884 | + | 3513 | 1666 | 556 | 1758 | 400 |
ENST00000264637 | THRA | chr17 | 38245586 | + | ENST00000430627 | CDK12 | chr17 | 37686884 | + | 3537 | 1690 | 580 | 1782 | 400 |
ENST00000584985 | THRA | chr17 | 38245586 | + | ENST00000430627 | CDK12 | chr17 | 37686884 | + | 3537 | 1690 | 580 | 1782 | 400 |
ENST00000450525 | THRA | chr17 | 38245586 | + | ENST00000430627 | CDK12 | chr17 | 37686884 | + | 6614 | 4767 | 491 | 1480 | 329 |
ENST00000546243 | THRA | chr17 | 38245586 | + | ENST00000447079 | CDK12 | chr17 | 37686884 | + | 6296 | 1781 | 402 | 1391 | 329 |
ENST00000394121 | THRA | chr17 | 38245586 | + | ENST00000430627 | CDK12 | chr17 | 37686883 | + | 3513 | 1666 | 556 | 1758 | 400 |
ENST00000264637 | THRA | chr17 | 38245586 | + | ENST00000430627 | CDK12 | chr17 | 37686883 | + | 3537 | 1690 | 580 | 1782 | 400 |
ENST00000584985 | THRA | chr17 | 38245586 | + | ENST00000430627 | CDK12 | chr17 | 37686883 | + | 3537 | 1690 | 580 | 1782 | 400 |
ENST00000450525 | THRA | chr17 | 38245586 | + | ENST00000430627 | CDK12 | chr17 | 37686883 | + | 6614 | 4767 | 491 | 1480 | 329 |
ENST00000546243 | THRA | chr17 | 38245586 | + | ENST00000447079 | CDK12 | chr17 | 37686883 | + | 6297 | 1781 | 402 | 1391 | 329 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000394121 | ENST00000430627 | THRA | chr17 | 38245586 | + | CDK12 | chr17 | 37686884 | + | 0.006844374 | 0.99315566 |
ENST00000264637 | ENST00000430627 | THRA | chr17 | 38245586 | + | CDK12 | chr17 | 37686884 | + | 0.009688801 | 0.99031115 |
ENST00000584985 | ENST00000430627 | THRA | chr17 | 38245586 | + | CDK12 | chr17 | 37686884 | + | 0.009688801 | 0.99031115 |
ENST00000450525 | ENST00000430627 | THRA | chr17 | 38245586 | + | CDK12 | chr17 | 37686884 | + | 0.00724151 | 0.9927585 |
ENST00000546243 | ENST00000447079 | THRA | chr17 | 38245586 | + | CDK12 | chr17 | 37686884 | + | 0.001789458 | 0.99821055 |
ENST00000394121 | ENST00000430627 | THRA | chr17 | 38245586 | + | CDK12 | chr17 | 37686883 | + | 0.006844374 | 0.99315566 |
ENST00000264637 | ENST00000430627 | THRA | chr17 | 38245586 | + | CDK12 | chr17 | 37686883 | + | 0.009688801 | 0.99031115 |
ENST00000584985 | ENST00000430627 | THRA | chr17 | 38245586 | + | CDK12 | chr17 | 37686883 | + | 0.009688801 | 0.99031115 |
ENST00000450525 | ENST00000430627 | THRA | chr17 | 38245586 | + | CDK12 | chr17 | 37686883 | + | 0.00724151 | 0.9927585 |
ENST00000546243 | ENST00000447079 | THRA | chr17 | 38245586 | + | CDK12 | chr17 | 37686883 | + | 0.001823954 | 0.9981761 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for THRA-CDK12 |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
THRA | chr17 | 38245586 | CDK12 | chr17 | 37686883 | 1666 | 370 | HNIPHFWPKLLMKRRGPLSPPDLHRR |
THRA | chr17 | 38245586 | CDK12 | chr17 | 37686883 | 1690 | 370 | HNIPHFWPKLLMKRRGPLSPPDLHRR |
THRA | chr17 | 38245586 | CDK12 | chr17 | 37686884 | 1666 | 370 | HNIPHFWPKLLMKRRGPLSPPDLHRR |
THRA | chr17 | 38245586 | CDK12 | chr17 | 37686884 | 1690 | 370 | HNIPHFWPKLLMKRRGPLSPPDLHRR |
Top |
Potential FusionNeoAntigen Information of THRA-CDK12 in HLA I |
![]() |
THRA-CDK12_38245586_37686883.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
THRA-CDK12 | chr17 | 38245586 | chr17 | 37686883 | 1690 | HLA-B08:01 | LMKRRGPL | 0.9991 | 0.5126 | 10 | 18 |
THRA-CDK12 | chr17 | 38245586 | chr17 | 37686883 | 1690 | HLA-B08:01 | LLMKRRGPL | 0.9958 | 0.6274 | 9 | 18 |
THRA-CDK12 | chr17 | 38245586 | chr17 | 37686883 | 1690 | HLA-B08:09 | LLMKRRGPL | 0.9921 | 0.6146 | 9 | 18 |
THRA-CDK12 | chr17 | 38245586 | chr17 | 37686883 | 1690 | HLA-A31:02 | HFWPKLLMKR | 0.9888 | 0.8597 | 4 | 14 |
THRA-CDK12 | chr17 | 38245586 | chr17 | 37686883 | 1690 | HLA-A31:06 | HFWPKLLMKR | 0.9603 | 0.6147 | 4 | 14 |
THRA-CDK12 | chr17 | 38245586 | chr17 | 37686883 | 1690 | HLA-A31:02 | HFWPKLLMKRR | 0.9857 | 0.9007 | 4 | 15 |
THRA-CDK12 | chr17 | 38245586 | chr17 | 37686883 | 1690 | HLA-A31:06 | HFWPKLLMKRR | 0.9466 | 0.7156 | 4 | 15 |
THRA-CDK12 | chr17 | 38245586 | chr17 | 37686883 | 1690 | HLA-A31:01 | HFWPKLLMKR | 0.9911 | 0.842 | 4 | 14 |
THRA-CDK12 | chr17 | 38245586 | chr17 | 37686883 | 1690 | HLA-A31:01 | HFWPKLLMKRR | 0.9885 | 0.8863 | 4 | 15 |
THRA-CDK12 | chr17 | 38245586 | chr17 | 37686883 | 1690 | HLA-B08:18 | LMKRRGPL | 0.9991 | 0.5126 | 10 | 18 |
THRA-CDK12 | chr17 | 38245586 | chr17 | 37686883 | 1690 | HLA-B08:12 | LMKRRGPL | 0.8593 | 0.6843 | 10 | 18 |
THRA-CDK12 | chr17 | 38245586 | chr17 | 37686883 | 1690 | HLA-B08:18 | LLMKRRGPL | 0.9958 | 0.6274 | 9 | 18 |
THRA-CDK12 | chr17 | 38245586 | chr17 | 37686883 | 1690 | HLA-B08:12 | LLMKRRGPL | 0.6842 | 0.6828 | 9 | 18 |
THRA-CDK12 | chr17 | 38245586 | chr17 | 37686883 | 1690 | HLA-B27:06 | KRRGPLSPPDL | 0.9999 | 0.7085 | 12 | 23 |
Top |
Potential FusionNeoAntigen Information of THRA-CDK12 in HLA II |
![]() |
THRA-CDK12_38245586_37686883.msa |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
THRA-CDK12 | chr17 | 38245586 | chr17 | 37686883 | 1690 | DRB1-1103 | WPKLLMKRRGPLSPP | 6 | 21 |
THRA-CDK12 | chr17 | 38245586 | chr17 | 37686883 | 1690 | DRB1-1155 | WPKLLMKRRGPLSPP | 6 | 21 |
THRA-CDK12 | chr17 | 38245586 | chr17 | 37686883 | 1690 | DRB1-1163 | WPKLLMKRRGPLSPP | 6 | 21 |
THRA-CDK12 | chr17 | 38245586 | chr17 | 37686883 | 1690 | DRB1-1176 | WPKLLMKRRGPLSPP | 6 | 21 |
THRA-CDK12 | chr17 | 38245586 | chr17 | 37686883 | 1690 | DRB1-1185 | WPKLLMKRRGPLSPP | 6 | 21 |
THRA-CDK12 | chr17 | 38245586 | chr17 | 37686883 | 1690 | DRB1-1324 | WPKLLMKRRGPLSPP | 6 | 21 |
THRA-CDK12 | chr17 | 38245586 | chr17 | 37686883 | 1690 | DRB1-1354 | WPKLLMKRRGPLSPP | 6 | 21 |
THRA-CDK12 | chr17 | 38245586 | chr17 | 37686883 | 1690 | DRB1-1375 | WPKLLMKRRGPLSPP | 6 | 21 |
Top |
Fusion breakpoint peptide structures of THRA-CDK12 |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
10520 | WPKLLMKRRGPLSP | THRA | CDK12 | chr17 | 38245586 | chr17 | 37686883 | 1690 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of THRA-CDK12 |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 10520 | WPKLLMKRRGPLSP | -7.9962 | -8.1096 |
HLA-B14:02 | 3BVN | 10520 | WPKLLMKRRGPLSP | -5.70842 | -6.74372 |
HLA-B52:01 | 3W39 | 10520 | WPKLLMKRRGPLSP | -6.83737 | -6.95077 |
HLA-B52:01 | 3W39 | 10520 | WPKLLMKRRGPLSP | -4.4836 | -5.5189 |
HLA-A11:01 | 4UQ2 | 10520 | WPKLLMKRRGPLSP | -10.0067 | -10.1201 |
HLA-A11:01 | 4UQ2 | 10520 | WPKLLMKRRGPLSP | -9.03915 | -10.0745 |
HLA-A24:02 | 5HGA | 10520 | WPKLLMKRRGPLSP | -6.56204 | -6.67544 |
HLA-A24:02 | 5HGA | 10520 | WPKLLMKRRGPLSP | -5.42271 | -6.45801 |
HLA-B44:05 | 3DX8 | 10520 | WPKLLMKRRGPLSP | -7.85648 | -8.89178 |
HLA-B44:05 | 3DX8 | 10520 | WPKLLMKRRGPLSP | -5.3978 | -5.5112 |
HLA-A02:01 | 6TDR | 10520 | WPKLLMKRRGPLSP | -3.37154 | -4.40684 |
Top |
Vaccine Design for the FusionNeoAntigens of THRA-CDK12 |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
THRA-CDK12 | chr17 | 38245586 | chr17 | 37686883 | 10 | 18 | LMKRRGPL | CTGATGAAGAGAAGAGGCCCCCTG |
THRA-CDK12 | chr17 | 38245586 | chr17 | 37686883 | 12 | 23 | KRRGPLSPPDL | AAGAGAAGAGGCCCCCTGAGCCCCCCGGACCTC |
THRA-CDK12 | chr17 | 38245586 | chr17 | 37686883 | 4 | 14 | HFWPKLLMKR | CACTTCTGGCCCAAGCTGCTGATGAAGAGA |
THRA-CDK12 | chr17 | 38245586 | chr17 | 37686883 | 4 | 15 | HFWPKLLMKRR | CACTTCTGGCCCAAGCTGCTGATGAAGAGAAGA |
THRA-CDK12 | chr17 | 38245586 | chr17 | 37686883 | 9 | 18 | LLMKRRGPL | CTGCTGATGAAGAGAAGAGGCCCCCTG |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
THRA-CDK12 | chr17 | 38245586 | chr17 | 37686883 | 6 | 21 | WPKLLMKRRGPLSPP | TGGCCCAAGCTGCTGATGAAGAGAAGAGGCCCCCTGAGCCCCCCG |
Top |
Information of the samples that have these potential fusion neoantigens of THRA-CDK12 |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
STAD | THRA-CDK12 | chr17 | 38245586 | ENST00000264637 | chr17 | 37686883 | ENST00000430627 | TCGA-BR-8289 |
Top |
Potential target of CAR-T therapy development for THRA-CDK12 |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to THRA-CDK12 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to THRA-CDK12 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |