Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:TLK1-SSB

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: TLK1-SSB
	FusionPDB ID: 91146
	FusionGDB2.0 ID: 91146
		Hgene	Tgene
	Gene symbol	TLK1	SSB
	Gene ID	9874	6741
	Gene name	tousled like kinase 1	small RNA binding exonuclease protection factor La
	Synonyms	PKU-beta	LARP3\|La\|La/SSB
	Cytomap	2q31.1	2q31.1
	Type of gene	protein-coding	protein-coding
	Description	serine/threonine-protein kinase tousled-like 1SNARE protein kinase SNAKserine threonine protein kinase	lupus La proteinLa ribonucleoprotein domain family, member 3SS-BSS-B/La proteinSjogren syndrome antigen Bautoantigen Lala autoantigenlupus La antigensjoegren syndrome type B antigen
	Modification date	20200329	20200313
	UniProtAcc	.	P81877 Main function of 5'-partner protein:
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000486857, ENST00000521943, ENST00000360843, ENST00000431350, ENST00000442919, ENST00000434911,	ENST00000260956, ENST00000409333,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	13 X 15 X 6=1170	9 X 12 X 7=756
	# samples	18	15
	** MAII score	log2(18/1170*10)=-2.70043971814109 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(15/756*10)=-2.33342373372519 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: TLK1 [Title/Abstract] AND SSB [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: TLK1 [Title/Abstract] AND SSB [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	TLK1(171939291)-SSB(170661984), # samples:3
Anticipated loss of major functional domain due to fusion event.	TLK1-SSB seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. TLK1-SSB seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. TLK1-SSB seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. TLK1-SSB seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. TLK1-SSB seems lost the major protein functional domain in Hgene partner, which is a epigenetic factor due to the frame-shifted ORF. TLK1-SSB seems lost the major protein functional domain in Hgene partner, which is a essential gene due to the frame-shifted ORF. TLK1-SSB seems lost the major protein functional domain in Hgene partner, which is a IUPHAR drug target due to the frame-shifted ORF. TLK1-SSB seems lost the major protein functional domain in Hgene partner, which is a kinase due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	TLK1	GO:0001672	regulation of chromatin assembly or disassembly	12660173
Hgene	TLK1	GO:0006468	protein phosphorylation	12660173
Hgene	TLK1	GO:0006886	intracellular protein transport	10588641
Hgene	TLK1	GO:0035556	intracellular signal transduction	12660173
Tgene	SSB	GO:0075522	IRES-dependent viral translational initiation	12384597
Tgene	SSB	GO:1903608	protein localization to cytoplasmic stress granule	24965446

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr2:171939291/chr2:170661984)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across TLK1 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across SSB (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000360843	TLK1	chr2	171939291	-	ENST00000260956	SSB	chr2	170661984	+	2204	735	402	1895	497
ENST00000360843	TLK1	chr2	171939291	-	ENST00000409333	SSB	chr2	170661984	+	2204	735	402	1895	497
ENST00000431350	TLK1	chr2	171939291	-	ENST00000260956	SSB	chr2	170661984	+	2204	735	402	1895	497
ENST00000431350	TLK1	chr2	171939291	-	ENST00000409333	SSB	chr2	170661984	+	2204	735	402	1895	497
ENST00000442919	TLK1	chr2	171939291	-	ENST00000260956	SSB	chr2	170661984	+	2271	802	469	1962	497
ENST00000442919	TLK1	chr2	171939291	-	ENST00000409333	SSB	chr2	170661984	+	2271	802	469	1962	497
ENST00000360843	TLK1	chr2	171939290	-	ENST00000260956	SSB	chr2	170661983	+	2204	735	402	1895	497
ENST00000360843	TLK1	chr2	171939290	-	ENST00000409333	SSB	chr2	170661983	+	2204	735	402	1895	497
ENST00000431350	TLK1	chr2	171939290	-	ENST00000260956	SSB	chr2	170661983	+	2204	735	402	1895	497
ENST00000431350	TLK1	chr2	171939290	-	ENST00000409333	SSB	chr2	170661983	+	2204	735	402	1895	497
ENST00000442919	TLK1	chr2	171939290	-	ENST00000260956	SSB	chr2	170661983	+	2271	802	469	1962	497
ENST00000442919	TLK1	chr2	171939290	-	ENST00000409333	SSB	chr2	170661983	+	2271	802	469	1962	497

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000360843	ENST00000260956	TLK1	chr2	171939291	-	SSB	chr2	170661984	+	0.000519413	0.99948066
ENST00000360843	ENST00000409333	TLK1	chr2	171939291	-	SSB	chr2	170661984	+	0.000519413	0.99948066
ENST00000431350	ENST00000260956	TLK1	chr2	171939291	-	SSB	chr2	170661984	+	0.000519413	0.99948066
ENST00000431350	ENST00000409333	TLK1	chr2	171939291	-	SSB	chr2	170661984	+	0.000519413	0.99948066
ENST00000442919	ENST00000260956	TLK1	chr2	171939291	-	SSB	chr2	170661984	+	0.000567582	0.9994324
ENST00000442919	ENST00000409333	TLK1	chr2	171939291	-	SSB	chr2	170661984	+	0.000567582	0.9994324
ENST00000360843	ENST00000260956	TLK1	chr2	171939290	-	SSB	chr2	170661983	+	0.000519413	0.99948066
ENST00000360843	ENST00000409333	TLK1	chr2	171939290	-	SSB	chr2	170661983	+	0.000519413	0.99948066
ENST00000431350	ENST00000260956	TLK1	chr2	171939290	-	SSB	chr2	170661983	+	0.000519413	0.99948066
ENST00000431350	ENST00000409333	TLK1	chr2	171939290	-	SSB	chr2	170661983	+	0.000519413	0.99948066
ENST00000442919	ENST00000260956	TLK1	chr2	171939290	-	SSB	chr2	170661983	+	0.000567582	0.9994324
ENST00000442919	ENST00000409333	TLK1	chr2	171939290	-	SSB	chr2	170661983	+	0.000567582	0.9994324

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for TLK1-SSB

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
TLK1	chr2	171939290	SSB	chr2	170661983	735	109	HSFGSLGSLSDKESEYYFGDFNLPRD
TLK1	chr2	171939290	SSB	chr2	170661983	802	109	HSFGSLGSLSDKESEYYFGDFNLPRD
TLK1	chr2	171939291	SSB	chr2	170661984	735	109	HSFGSLGSLSDKESEYYFGDFNLPRD
TLK1	chr2	171939291	SSB	chr2	170661984	802	109	HSFGSLGSLSDKESEYYFGDFNLPRD

Top

Potential FusionNeoAntigen Information of TLK1-SSB in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

TLK1-SSB_171939290_170661983.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
TLK1-SSB	chr2	171939290	chr2	170661983	735	HLA-B15:01	SLSDKESEY	0.9985	0.9235	7	16
TLK1-SSB	chr2	171939290	chr2	170661983	735	HLA-B15:25	SLSDKESEY	0.9563	0.9256	7	16
TLK1-SSB	chr2	171939290	chr2	170661983	735	HLA-B15:02	SLSDKESEY	0.9132	0.9174	7	16
TLK1-SSB	chr2	171939290	chr2	170661983	735	HLA-B35:08	LSDKESEYY	0.8565	0.7576	8	17
TLK1-SSB	chr2	171939290	chr2	170661983	735	HLA-B15:03	SLSDKESEY	0.4029	0.708	7	16
TLK1-SSB	chr2	171939290	chr2	170661983	735	HLA-B15:01	SLSDKESEYY	0.9985	0.8837	7	17
TLK1-SSB	chr2	171939290	chr2	170661983	735	HLA-B57:01	LSDKESEYYF	0.9985	0.8733	8	18
TLK1-SSB	chr2	171939290	chr2	170661983	735	HLA-B57:03	LSDKESEYYF	0.9888	0.7586	8	18
TLK1-SSB	chr2	171939290	chr2	170661983	735	HLA-B15:07	SLSDKESEY	0.9891	0.6783	7	16
TLK1-SSB	chr2	171939290	chr2	170661983	735	HLA-C05:09	LSDKESEYY	0.9698	0.839	8	17
TLK1-SSB	chr2	171939290	chr2	170661983	735	HLA-B15:21	SLSDKESEY	0.9183	0.9074	7	16
TLK1-SSB	chr2	171939290	chr2	170661983	735	HLA-B15:04	SLSDKESEY	0.8294	0.9206	7	16
TLK1-SSB	chr2	171939290	chr2	170661983	735	HLA-B15:05	SLSDKESEY	0.744	0.8841	7	16
TLK1-SSB	chr2	171939290	chr2	170661983	735	HLA-B15:31	SLSDKESEY	0.6796	0.892	7	16
TLK1-SSB	chr2	171939290	chr2	170661983	735	HLA-C03:14	SLSDKESEY	0.1317	0.9572	7	16
TLK1-SSB	chr2	171939290	chr2	170661983	735	HLA-C05:09	LSDKESEYYF	0.9999	0.8561	8	18
TLK1-SSB	chr2	171939290	chr2	170661983	735	HLA-B15:34	SLSDKESEY	0.9985	0.9235	7	16
TLK1-SSB	chr2	171939290	chr2	170661983	735	HLA-B15:33	SLSDKESEY	0.9985	0.9235	7	16
TLK1-SSB	chr2	171939290	chr2	170661983	735	HLA-B15:125	SLSDKESEY	0.9985	0.9235	7	16
TLK1-SSB	chr2	171939290	chr2	170661983	735	HLA-B15:27	SLSDKESEY	0.9985	0.9016	7	16
TLK1-SSB	chr2	171939290	chr2	170661983	735	HLA-B15:135	SLSDKESEY	0.9984	0.922	7	16
TLK1-SSB	chr2	171939290	chr2	170661983	735	HLA-B15:50	SLSDKESEY	0.9979	0.8949	7	16
TLK1-SSB	chr2	171939290	chr2	170661983	735	HLA-B15:11	SLSDKESEY	0.9952	0.8623	7	16
TLK1-SSB	chr2	171939290	chr2	170661983	735	HLA-B15:12	SLSDKESEY	0.9951	0.9064	7	16
TLK1-SSB	chr2	171939290	chr2	170661983	735	HLA-B15:08	SLSDKESEY	0.994	0.8598	7	16
TLK1-SSB	chr2	171939290	chr2	170661983	735	HLA-B15:35	SLSDKESEY	0.9814	0.895	7	16
TLK1-SSB	chr2	171939290	chr2	170661983	735	HLA-B15:53	SLSDKESEY	0.9702	0.9028	7	16
TLK1-SSB	chr2	171939290	chr2	170661983	735	HLA-C05:01	LSDKESEYY	0.9698	0.839	8	17
TLK1-SSB	chr2	171939290	chr2	170661983	735	HLA-B15:39	SLSDKESEY	0.9569	0.8187	7	16
TLK1-SSB	chr2	171939290	chr2	170661983	735	HLA-B15:54	SLSDKESEY	0.7587	0.8809	7	16
TLK1-SSB	chr2	171939290	chr2	170661983	735	HLA-B15:20	SLSDKESEY	0.7572	0.9297	7	16
TLK1-SSB	chr2	171939290	chr2	170661983	735	HLA-B35:28	SLSDKESEY	0.6548	0.9192	7	16
TLK1-SSB	chr2	171939290	chr2	170661983	735	HLA-B35:20	SLSDKESEY	0.6502	0.9239	7	16
TLK1-SSB	chr2	171939290	chr2	170661983	735	HLA-C12:02	SLSDKESEY	0.6169	0.9577	7	16
TLK1-SSB	chr2	171939290	chr2	170661983	735	HLA-B18:08	SDKESEYYF	0.5105	0.7506	9	18
TLK1-SSB	chr2	171939290	chr2	170661983	735	HLA-C02:10	SLSDKESEY	0.0249	0.9649	7	16
TLK1-SSB	chr2	171939290	chr2	170661983	735	HLA-C02:02	SLSDKESEY	0.0249	0.9649	7	16
TLK1-SSB	chr2	171939290	chr2	170661983	735	HLA-C05:01	LSDKESEYYF	0.9999	0.8561	8	18
TLK1-SSB	chr2	171939290	chr2	170661983	735	HLA-B15:33	SLSDKESEYY	0.9985	0.8837	7	17
TLK1-SSB	chr2	171939290	chr2	170661983	735	HLA-B15:125	SLSDKESEYY	0.9985	0.8837	7	17
TLK1-SSB	chr2	171939290	chr2	170661983	735	HLA-B57:10	LSDKESEYYF	0.9985	0.8733	8	18
TLK1-SSB	chr2	171939290	chr2	170661983	735	HLA-B15:34	SLSDKESEYY	0.9985	0.8837	7	17
TLK1-SSB	chr2	171939290	chr2	170661983	735	HLA-B15:135	SLSDKESEYY	0.9983	0.8827	7	17
TLK1-SSB	chr2	171939290	chr2	170661983	735	HLA-B15:50	SLSDKESEYY	0.998	0.8625	7	17
TLK1-SSB	chr2	171939290	chr2	170661983	735	HLA-B15:12	SLSDKESEYY	0.9972	0.8631	7	17
TLK1-SSB	chr2	171939290	chr2	170661983	735	HLA-B57:04	LSDKESEYYF	0.9953	0.5368	8	18
TLK1-SSB	chr2	171939290	chr2	170661983	735	HLA-B57:02	LSDKESEYYF	0.989	0.6385	8	18

Top

Potential FusionNeoAntigen Information of TLK1-SSB in HLA II

TLK1-SSB_171939290_170661983.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
TLK1-SSB	chr2	171939290	chr2	170661983	735	DRB1-0305	KESEYYFGDFNLPRD	11	26
TLK1-SSB	chr2	171939290	chr2	170661983	735	DRB1-0405	HSFGSLGSLSDKESE	0	15
TLK1-SSB	chr2	171939290	chr2	170661983	735	DRB1-0429	HSFGSLGSLSDKESE	0	15
TLK1-SSB	chr2	171939290	chr2	170661983	735	DRB1-0430	HSFGSLGSLSDKESE	0	15
TLK1-SSB	chr2	171939290	chr2	170661983	735	DRB1-0445	HSFGSLGSLSDKESE	0	15
TLK1-SSB	chr2	171939290	chr2	170661983	735	DRB1-0448	HSFGSLGSLSDKESE	0	15
TLK1-SSB	chr2	171939290	chr2	170661983	735	DRB1-0457	HSFGSLGSLSDKESE	0	15
TLK1-SSB	chr2	171939290	chr2	170661983	735	DRB1-0477	HSFGSLGSLSDKESE	0	15
TLK1-SSB	chr2	171939290	chr2	170661983	735	DRB1-0483	HSFGSLGSLSDKESE	0	15
TLK1-SSB	chr2	171939290	chr2	170661983	735	DRB1-0484	HSFGSLGSLSDKESE	0	15
TLK1-SSB	chr2	171939290	chr2	170661983	735	DRB1-0489	HSFGSLGSLSDKESE	0	15

Top

Fusion breakpoint peptide structures of TLK1-SSB

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
3136	GSLSDKESEYYFGD	TLK1	SSB	chr2	171939290	chr2	170661983	735

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of TLK1-SSB

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B52:01	3W39	3136	GSLSDKESEYYFGD	-6.65674	-6.65674
HLA-B44:05	3DX8	3136	GSLSDKESEYYFGD	-6.36866	-6.36866

Top

Vaccine Design for the FusionNeoAntigens of TLK1-SSB

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
TLK1-SSB	chr2	171939290	chr2	170661983	7	16	SLSDKESEY	AGTGACAAAGAATCAGAGTATTATTTT
TLK1-SSB	chr2	171939290	chr2	170661983	7	17	SLSDKESEYY	AGTGACAAAGAATCAGAGTATTATTTTGGC
TLK1-SSB	chr2	171939290	chr2	170661983	8	17	LSDKESEYY	GACAAAGAATCAGAGTATTATTTTGGC
TLK1-SSB	chr2	171939290	chr2	170661983	8	18	LSDKESEYYF	GACAAAGAATCAGAGTATTATTTTGGCGAC
TLK1-SSB	chr2	171939290	chr2	170661983	9	18	SDKESEYYF	AAAGAATCAGAGTATTATTTTGGCGAC

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
TLK1-SSB	chr2	171939290	chr2	170661983	0	15	HSFGSLGSLSDKESE	TTTGGAAGCTTGGGATCTTTAAGTGACAAAGAATCAGAGTATTAT
TLK1-SSB	chr2	171939290	chr2	170661983	11	26	KESEYYFGDFNLPRD	TCAGAGTATTATTTTGGCGACTTCAATTTGCCACGGGACAAGTTT

Top

Information of the samples that have these potential fusion neoantigens of TLK1-SSB

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
BRCA	TLK1-SSB	chr2	171939290	ENST00000360843	chr2	170661983	ENST00000260956	TCGA-A8-A094

Top

Potential target of CAR-T therapy development for TLK1-SSB

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to TLK1-SSB

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to TLK1-SSB

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)