Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:BCAS3-RAD51C

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: BCAS3-RAD51C
	FusionPDB ID: 9227
	FusionGDB2.0 ID: 9227
		Hgene	Tgene
	Gene symbol	BCAS3	RAD51C
	Gene ID	54828	5889
	Gene name	BCAS3 microtubule associated cell migration factor	RAD51 paralog C
	Synonyms	GAOB1\|MAAB	BROVCA3\|FANCO\|R51H3\|RAD51L2
	Cytomap	17q23.2	17q22
	Type of gene	protein-coding	protein-coding
	Description	breast carcinoma-amplified sequence 3BCAS4/BCAS3 fusionRudhirabreast carcinoma amplified sequence 4/3 fusion proteinmetastasis associated antigen of breast cancerprotein Maab1	DNA repair protein RAD51 homolog 3RAD51-like protein 2yeast RAD51 homolog 3
	Modification date	20200313	20200313
	UniProtAcc	Q9H6U6 Main function of 5'-partner protein: FUNCTION: Plays a role in angiogenesis. Participates in the regulation of cell polarity and directional endothelial cell migration by mediating both the activation and recruitment of CDC42 and the reorganization of the actin cytoskeleton at the cell leading edge. Promotes filipodia formation (By similarity). Functions synergistically with PELP1 as a transcriptional coactivator of estrogen receptor-responsive genes. Stimulates histone acetyltransferase activity. Binds to chromatin. {ECO:0000250\|UniProtKB:Q8CCN5, ECO:0000269\|PubMed:17505058}.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000390652, ENST00000407086, ENST00000408905, ENST00000585744, ENST00000588462, ENST00000588874, ENST00000589222, ENST00000585812,	ENST00000421782, ENST00000487921, ENST00000337432, ENST00000583539,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	53 X 35 X 17=31535	12 X 11 X 4=528
	# samples	61	15
	** MAII score	log2(61/31535*10)=-5.69200088030826 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(15/528*10)=-1.81557542886257 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: BCAS3 [Title/Abstract] AND RAD51C [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: BCAS3 [Title/Abstract] AND RAD51C [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	BCAS3(58885437)-RAD51C(56801401), # samples:3
Anticipated loss of major functional domain due to fusion event.	BCAS3-RAD51C seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. BCAS3-RAD51C seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. BCAS3-RAD51C seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. BCAS3-RAD51C seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. BCAS3-RAD51C seems lost the major protein functional domain in Hgene partner, which is a essential gene due to the frame-shifted ORF. BCAS3-RAD51C seems lost the major protein functional domain in Tgene partner, which is a essential gene due to the frame-shifted ORF. BCAS3-RAD51C seems lost the major protein functional domain in Tgene partner, which is a tumor suppressor due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	BCAS3	GO:0043085	positive regulation of catalytic activity	17505058
Hgene	BCAS3	GO:0045944	positive regulation of transcription by RNA polymerase II	17505058
Hgene	BCAS3	GO:0071391	cellular response to estrogen stimulus	17505058
Tgene	RAD51C	GO:0006281	DNA repair	19451272
Tgene	RAD51C	GO:0006310	DNA recombination	19451272

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr17:58885437/chr17:56801401)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across BCAS3 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across RAD51C (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000589222	BCAS3	chr17	59161925	+	ENST00000583539	RAD51C	chr17	56772292	+	3596	2493	68	3388	1106
ENST00000589222	BCAS3	chr17	59161925	+	ENST00000337432	RAD51C	chr17	56772292	+	3599	2493	68	3478	1136
ENST00000407086	BCAS3	chr17	59161925	+	ENST00000583539	RAD51C	chr17	56772292	+	3576	2473	48	3368	1106
ENST00000407086	BCAS3	chr17	59161925	+	ENST00000337432	RAD51C	chr17	56772292	+	3579	2473	48	3458	1136
ENST00000390652	BCAS3	chr17	59161925	+	ENST00000583539	RAD51C	chr17	56772292	+	3604	2501	31	3396	1121
ENST00000390652	BCAS3	chr17	59161925	+	ENST00000337432	RAD51C	chr17	56772292	+	3607	2501	31	3486	1151
ENST00000408905	BCAS3	chr17	59161925	+	ENST00000583539	RAD51C	chr17	56772292	+	3528	2425	0	3320	1106
ENST00000408905	BCAS3	chr17	59161925	+	ENST00000337432	RAD51C	chr17	56772292	+	3531	2425	0	3410	1136
ENST00000588462	BCAS3	chr17	59161925	+	ENST00000583539	RAD51C	chr17	56772292	+	3573	2470	0	3365	1121
ENST00000588462	BCAS3	chr17	59161925	+	ENST00000337432	RAD51C	chr17	56772292	+	3576	2470	0	3455	1151
ENST00000585744	BCAS3	chr17	59161925	+	ENST00000583539	RAD51C	chr17	56772292	+	2989	1886	13	2781	922
ENST00000585744	BCAS3	chr17	59161925	+	ENST00000337432	RAD51C	chr17	56772292	+	2992	1886	13	2871	952
ENST00000588874	BCAS3	chr17	59161925	+	ENST00000583539	RAD51C	chr17	56772292	+	3029	1926	188	2821	877
ENST00000588874	BCAS3	chr17	59161925	+	ENST00000337432	RAD51C	chr17	56772292	+	3032	1926	188	2911	907

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000589222	ENST00000583539	BCAS3	chr17	59161925	+	RAD51C	chr17	56772292	+	0.000419875	0.9995801
ENST00000589222	ENST00000337432	BCAS3	chr17	59161925	+	RAD51C	chr17	56772292	+	0.000372382	0.9996276
ENST00000407086	ENST00000583539	BCAS3	chr17	59161925	+	RAD51C	chr17	56772292	+	0.000418915	0.99958104
ENST00000407086	ENST00000337432	BCAS3	chr17	59161925	+	RAD51C	chr17	56772292	+	0.000371499	0.9996284
ENST00000390652	ENST00000583539	BCAS3	chr17	59161925	+	RAD51C	chr17	56772292	+	0.000345772	0.9996542
ENST00000390652	ENST00000337432	BCAS3	chr17	59161925	+	RAD51C	chr17	56772292	+	0.000247511	0.99975246
ENST00000408905	ENST00000583539	BCAS3	chr17	59161925	+	RAD51C	chr17	56772292	+	0.000408653	0.9995914
ENST00000408905	ENST00000337432	BCAS3	chr17	59161925	+	RAD51C	chr17	56772292	+	0.000366113	0.9996339
ENST00000588462	ENST00000583539	BCAS3	chr17	59161925	+	RAD51C	chr17	56772292	+	0.000343496	0.99965656
ENST00000588462	ENST00000337432	BCAS3	chr17	59161925	+	RAD51C	chr17	56772292	+	0.000247223	0.9997528
ENST00000585744	ENST00000583539	BCAS3	chr17	59161925	+	RAD51C	chr17	56772292	+	0.002147688	0.9978523
ENST00000585744	ENST00000337432	BCAS3	chr17	59161925	+	RAD51C	chr17	56772292	+	0.001642886	0.9983571
ENST00000588874	ENST00000583539	BCAS3	chr17	59161925	+	RAD51C	chr17	56772292	+	0.001926027	0.99807394
ENST00000588874	ENST00000337432	BCAS3	chr17	59161925	+	RAD51C	chr17	56772292	+	0.001477313	0.9985227

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for BCAS3-RAD51C

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
BCAS3	chr17	59161925	RAD51C	chr17	56772292	1886	623	SDRRGVSTVIDAASEVGISKAEALET
BCAS3	chr17	59161925	RAD51C	chr17	56772292	1926	578	SDRRGVSTVIDAASEVGISKAEALET
BCAS3	chr17	59161925	RAD51C	chr17	56772292	2425	807	SDRRGVSTVIDAASEVGISKAEALET
BCAS3	chr17	59161925	RAD51C	chr17	56772292	2470	822	SDRRGVSTVIDAASEVGISKAEALET
BCAS3	chr17	59161925	RAD51C	chr17	56772292	2473	807	SDRRGVSTVIDAASEVGISKAEALET
BCAS3	chr17	59161925	RAD51C	chr17	56772292	2493	807	SDRRGVSTVIDAASEVGISKAEALET
BCAS3	chr17	59161925	RAD51C	chr17	56772292	2501	822	SDRRGVSTVIDAASEVGISKAEALET

Top

Potential FusionNeoAntigen Information of BCAS3-RAD51C in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

BCAS3-RAD51C_59161925_56772292.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
BCAS3-RAD51C	chr17	59161925	chr17	56772292	2501	HLA-A66:01	TVIDAASEV	0.9991	0.5139	7	16
BCAS3-RAD51C	chr17	59161925	chr17	56772292	2501	HLA-A34:05	TVIDAASEV	0.9974	0.5206	7	16
BCAS3-RAD51C	chr17	59161925	chr17	56772292	2501	HLA-A34:01	TVIDAASEV	0.9974	0.5206	7	16
BCAS3-RAD51C	chr17	59161925	chr17	56772292	2501	HLA-A26:03	TVIDAASEV	0.9966	0.5324	7	16
BCAS3-RAD51C	chr17	59161925	chr17	56772292	2501	HLA-A02:38	TVIDAASEV	0.9946	0.7565	7	16
BCAS3-RAD51C	chr17	59161925	chr17	56772292	2501	HLA-A02:21	TVIDAASEV	0.9845	0.6156	7	16
BCAS3-RAD51C	chr17	59161925	chr17	56772292	2501	HLA-A02:13	TVIDAASEV	0.9611	0.7544	7	16
BCAS3-RAD51C	chr17	59161925	chr17	56772292	2501	HLA-A26:14	TVIDAASEV	0.9499	0.5605	7	16
BCAS3-RAD51C	chr17	59161925	chr17	56772292	2501	HLA-A26:15	TVIDAASEV	0.9499	0.5605	7	16
BCAS3-RAD51C	chr17	59161925	chr17	56772292	2501	HLA-A30:08	AASEVGISK	0.9302	0.7017	11	20
BCAS3-RAD51C	chr17	59161925	chr17	56772292	2501	HLA-A66:03	TVIDAASEV	0.7191	0.6646	7	16
BCAS3-RAD51C	chr17	59161925	chr17	56772292	2501	HLA-C05:09	VIDAASEV	1	0.985	8	16
BCAS3-RAD51C	chr17	59161925	chr17	56772292	2501	HLA-C08:15	VIDAASEV	0.9999	0.9915	8	16
BCAS3-RAD51C	chr17	59161925	chr17	56772292	2501	HLA-C15:06	TVIDAASEV	0.9994	0.9659	7	16
BCAS3-RAD51C	chr17	59161925	chr17	56772292	2501	HLA-C04:06	TVIDAASEV	0.9993	0.9804	7	16
BCAS3-RAD51C	chr17	59161925	chr17	56772292	2501	HLA-C12:04	TVIDAASEV	0.9946	0.9932	7	16
BCAS3-RAD51C	chr17	59161925	chr17	56772292	2501	HLA-C08:13	TVIDAASEV	0.9932	0.9883	7	16
BCAS3-RAD51C	chr17	59161925	chr17	56772292	2501	HLA-C08:04	TVIDAASEV	0.9932	0.9883	7	16
BCAS3-RAD51C	chr17	59161925	chr17	56772292	2501	HLA-C06:03	TVIDAASEV	0.9913	0.9936	7	16
BCAS3-RAD51C	chr17	59161925	chr17	56772292	2501	HLA-C08:03	TVIDAASEV	0.9833	0.988	7	16
BCAS3-RAD51C	chr17	59161925	chr17	56772292	2501	HLA-A26:01	TVIDAASEV	0.9499	0.5605	7	16
BCAS3-RAD51C	chr17	59161925	chr17	56772292	2501	HLA-C02:06	TVIDAASEV	0.9379	0.9786	7	16
BCAS3-RAD51C	chr17	59161925	chr17	56772292	2501	HLA-C05:01	VIDAASEV	1	0.985	8	16
BCAS3-RAD51C	chr17	59161925	chr17	56772292	2501	HLA-C04:03	VIDAASEV	1	0.9615	8	16
BCAS3-RAD51C	chr17	59161925	chr17	56772292	2501	HLA-C08:02	VIDAASEV	0.9999	0.9915	8	16
BCAS3-RAD51C	chr17	59161925	chr17	56772292	2501	HLA-C15:02	TVIDAASEV	0.9996	0.9626	7	16
BCAS3-RAD51C	chr17	59161925	chr17	56772292	2501	HLA-C15:05	TVIDAASEV	0.9995	0.9738	7	16
BCAS3-RAD51C	chr17	59161925	chr17	56772292	2501	HLA-A69:01	TVIDAASEV	0.9981	0.6217	7	16
BCAS3-RAD51C	chr17	59161925	chr17	56772292	2501	HLA-C03:06	TVIDAASEV	0.998	0.9887	7	16
BCAS3-RAD51C	chr17	59161925	chr17	56772292	2501	HLA-C12:03	TVIDAASEV	0.9899	0.9798	7	16
BCAS3-RAD51C	chr17	59161925	chr17	56772292	2501	HLA-A02:14	TVIDAASEV	0.9847	0.5023	7	16
BCAS3-RAD51C	chr17	59161925	chr17	56772292	2501	HLA-A02:06	TVIDAASEV	0.9845	0.6156	7	16
BCAS3-RAD51C	chr17	59161925	chr17	56772292	2501	HLA-A02:03	TVIDAASEV	0.984	0.6232	7	16
BCAS3-RAD51C	chr17	59161925	chr17	56772292	2501	HLA-C08:01	TVIDAASEV	0.9833	0.988	7	16
BCAS3-RAD51C	chr17	59161925	chr17	56772292	2501	HLA-A25:01	TVIDAASEV	0.9722	0.9379	7	16
BCAS3-RAD51C	chr17	59161925	chr17	56772292	2501	HLA-A66:02	TVIDAASEV	0.9506	0.6492	7	16
BCAS3-RAD51C	chr17	59161925	chr17	56772292	2501	HLA-A30:01	AASEVGISK	0.9125	0.8269	11	20
BCAS3-RAD51C	chr17	59161925	chr17	56772292	2501	HLA-C17:01	TVIDAASEV	0.8742	0.9861	7	16
BCAS3-RAD51C	chr17	59161925	chr17	56772292	2501	HLA-A68:02	STVIDAASEV	0.9975	0.5459	6	16
BCAS3-RAD51C	chr17	59161925	chr17	56772292	2501	HLA-A69:01	STVIDAASEV	0.9937	0.5985	6	16
BCAS3-RAD51C	chr17	59161925	chr17	56772292	2501	HLA-A68:02	TVIDAASEVGI	0.9939	0.5179	7	18
BCAS3-RAD51C	chr17	59161925	chr17	56772292	2501	HLA-A69:01	TVIDAASEVGI	0.9834	0.563	7	18

Top

Potential FusionNeoAntigen Information of BCAS3-RAD51C in HLA II

BCAS3-RAD51C_59161925_56772292.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
BCAS3-RAD51C	chr17	59161925	chr17	56772292	2501	DRB1-0451	RRGVSTVIDAASEVG	2	17
BCAS3-RAD51C	chr17	59161925	chr17	56772292	2501	DRB1-0455	RRGVSTVIDAASEVG	2	17
BCAS3-RAD51C	chr17	59161925	chr17	56772292	2501	DRB1-0458	RRGVSTVIDAASEVG	2	17
BCAS3-RAD51C	chr17	59161925	chr17	56772292	2501	DRB1-0470	RRGVSTVIDAASEVG	2	17
BCAS3-RAD51C	chr17	59161925	chr17	56772292	2501	DRB1-0904	AASEVGISKAEALET	11	26
BCAS3-RAD51C	chr17	59161925	chr17	56772292	2501	DRB1-0906	STVIDAASEVGISKA	6	21
BCAS3-RAD51C	chr17	59161925	chr17	56772292	2501	DRB1-0906	AASEVGISKAEALET	11	26
BCAS3-RAD51C	chr17	59161925	chr17	56772292	2501	DRB1-0906	VSTVIDAASEVGISK	5	20

Top

Fusion breakpoint peptide structures of BCAS3-RAD51C

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
9129	STVIDAASEVGISK	BCAS3	RAD51C	chr17	59161925	chr17	56772292	2501

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of BCAS3-RAD51C

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	9129	STVIDAASEVGISK	-7.47338	-7.58678
HLA-B14:02	3BVN	9129	STVIDAASEVGISK	-4.02131	-5.05661
HLA-B52:01	3W39	9129	STVIDAASEVGISK	-6.09305	-6.20645
HLA-B52:01	3W39	9129	STVIDAASEVGISK	-5.89116	-6.92646
HLA-B18:01	4JQV	9129	STVIDAASEVGISK	-2.29971	-3.33501
HLA-A11:01	4UQ2	9129	STVIDAASEVGISK	-9.02997	-9.14337
HLA-A24:02	5HGA	9129	STVIDAASEVGISK	-7.5857	-7.6991
HLA-A24:02	5HGA	9129	STVIDAASEVGISK	-7.19093	-8.22623
HLA-B27:05	6PYJ	9129	STVIDAASEVGISK	-6.48577	-7.52107
HLA-B27:05	6PYJ	9129	STVIDAASEVGISK	-3.80826	-3.92166
HLA-B44:05	3DX8	9129	STVIDAASEVGISK	-4.50666	-4.62006
HLA-B44:05	3DX8	9129	STVIDAASEVGISK	-3.72245	-4.75775

Top

Vaccine Design for the FusionNeoAntigens of BCAS3-RAD51C

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
BCAS3-RAD51C	chr17	59161925	chr17	56772292	11	20	AASEVGISK	CCTCAGAAGTTGGGATATCTAAAGCAG
BCAS3-RAD51C	chr17	59161925	chr17	56772292	6	16	STVIDAASEV	CAGTGATTGATGCTGCCTCAGAAGTTGGGA
BCAS3-RAD51C	chr17	59161925	chr17	56772292	7	16	TVIDAASEV	TGATTGATGCTGCCTCAGAAGTTGGGA
BCAS3-RAD51C	chr17	59161925	chr17	56772292	7	18	TVIDAASEVGI	TGATTGATGCTGCCTCAGAAGTTGGGATATCTA
BCAS3-RAD51C	chr17	59161925	chr17	56772292	8	16	VIDAASEV	TTGATGCTGCCTCAGAAGTTGGGA

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
BCAS3-RAD51C	chr17	59161925	chr17	56772292	11	26	AASEVGISKAEALET	CCTCAGAAGTTGGGATATCTAAAGCAGAAGCCTTAGAAACTCTGC
BCAS3-RAD51C	chr17	59161925	chr17	56772292	2	17	RRGVSTVIDAASEVG	GGGGAGTTTCCACAGTGATTGATGCTGCCTCAGAAGTTGGGATAT
BCAS3-RAD51C	chr17	59161925	chr17	56772292	5	20	VSTVIDAASEVGISK	CCACAGTGATTGATGCTGCCTCAGAAGTTGGGATATCTAAAGCAG
BCAS3-RAD51C	chr17	59161925	chr17	56772292	6	21	STVIDAASEVGISKA	CAGTGATTGATGCTGCCTCAGAAGTTGGGATATCTAAAGCAGAAG

Top

Information of the samples that have these potential fusion neoantigens of BCAS3-RAD51C

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
BRCA	BCAS3-RAD51C	chr17	59161925	ENST00000390652	chr17	56772292	ENST00000337432	TCGA-A8-A09I-01A

Top

Potential target of CAR-T therapy development for BCAS3-RAD51C

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to BCAS3-RAD51C

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to BCAS3-RAD51C

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)