![]() |
|||||||
|
Fusion Protein:TNC-GABBR2 |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: TNC-GABBR2 | FusionPDB ID: 92583 | FusionGDB2.0 ID: 92583 | Hgene | Tgene | Gene symbol | TNC | GABBR2 | Gene ID | 7134 | 9568 |
Gene name | troponin C1, slow skeletal and cardiac type | gamma-aminobutyric acid type B receptor subunit 2 | |
Synonyms | CMD1Z|CMH13|TN-C|TNC|TNNC | EIEE59|GABABR2|GPR51|GPRC3B|HG20|HRIHFB2099|NDPLHS | |
Cytomap | 3p21.1 | 9q22.33 | |
Type of gene | protein-coding | protein-coding | |
Description | troponin C, slow skeletal and cardiac musclescardiac troponin Cslow twitch skeletal/cardiac muscle troponin Ctroponin C type 1 (slow) | gamma-aminobutyric acid type B receptor subunit 2G-protein coupled receptor 51GABA-B receptor 2GABA-B receptor, R2 subunitGABA-B-R2GABA-BR2gamma-aminobutyric acid (GABA) B receptor, 2gamma-aminobutyric acid B receptor 2gb2 | |
Modification date | 20200313 | 20200313 | |
UniProtAcc | . | O75899 Main function of 5'-partner protein: FUNCTION: Component of a heterodimeric G-protein coupled receptor for GABA, formed by GABBR1 and GABBR2 (PubMed:9872316, PubMed:9872744, PubMed:15617512, PubMed:18165688, PubMed:22660477, PubMed:24305054). Within the heterodimeric GABA receptor, only GABBR1 seems to bind agonists, while GABBR2 mediates coupling to G proteins (PubMed:18165688). Ligand binding causes a conformation change that triggers signaling via guanine nucleotide-binding proteins (G proteins) and modulates the activity of down-stream effectors, such as adenylate cyclase (PubMed:10075644, PubMed:10773016, PubMed:24305054). Signaling inhibits adenylate cyclase, stimulates phospholipase A2, activates potassium channels, inactivates voltage-dependent calcium-channels and modulates inositol phospholipid hydrolysis (PubMed:10075644, PubMed:9872744, PubMed:10906333, PubMed:10773016). Plays a critical role in the fine-tuning of inhibitory synaptic transmission (PubMed:9872744, PubMed:22660477). Pre-synaptic GABA receptor inhibits neurotransmitter release by down-regulating high-voltage activated calcium channels, whereas postsynaptic GABA receptor decreases neuronal excitability by activating a prominent inwardly rectifying potassium (Kir) conductance that underlies the late inhibitory postsynaptic potentials (PubMed:9872316, PubMed:10075644, PubMed:9872744, PubMed:22660477). Not only implicated in synaptic inhibition but also in hippocampal long-term potentiation, slow wave sleep, muscle relaxation and antinociception (Probable). {ECO:0000269|PubMed:10075644, ECO:0000269|PubMed:10328880, ECO:0000269|PubMed:15617512, ECO:0000269|PubMed:18165688, ECO:0000269|PubMed:22660477, ECO:0000269|PubMed:24305054, ECO:0000269|PubMed:9872316, ECO:0000269|PubMed:9872744, ECO:0000305}. | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000340094, ENST00000341037, ENST00000345230, ENST00000346706, ENST00000350763, ENST00000423613, ENST00000535648, ENST00000537320, ENST00000542877, ENST00000481475, | ENST00000477471, ENST00000259455, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 6 X 9 X 3=162 | 8 X 8 X 5=320 |
# samples | 8 | 8 | |
** MAII score | log2(8/162*10)=-1.01792190799726 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(8/320*10)=-2 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: TNC [Title/Abstract] AND GABBR2 [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: TNC [Title/Abstract] AND GABBR2 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | TNC(117819432)-GABBR2(101340354), # samples:2 | ||
Anticipated loss of major functional domain due to fusion event. | TNC-GABBR2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. TNC-GABBR2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. TNC-GABBR2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. TNC-GABBR2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. TNC-GABBR2 seems lost the major protein functional domain in Hgene partner, which is a CGC due to the frame-shifted ORF. TNC-GABBR2 seems lost the major protein functional domain in Tgene partner, which is a essential gene due to the frame-shifted ORF. TNC-GABBR2 seems lost the major protein functional domain in Tgene partner, which is a IUPHAR drug target due to the frame-shifted ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Hgene | TNC | GO:0006937 | regulation of muscle contraction | 18092822 |
Hgene | TNC | GO:0060048 | cardiac muscle contraction | 25771144 |
Tgene | GABBR2 | GO:0007214 | gamma-aminobutyric acid signaling pathway | 9872316 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr9:117819432/chr9:101340354) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000535648 | TNC | chr9 | 117819432 | - | ENST00000259455 | GABBR2 | chr9 | 101340354 | - | 8829 | 3849 | 296 | 3904 | 1202 |
ENST00000340094 | TNC | chr9 | 117819432 | - | ENST00000259455 | GABBR2 | chr9 | 101340354 | - | 8829 | 3849 | 296 | 3904 | 1202 |
ENST00000350763 | TNC | chr9 | 117819432 | - | ENST00000259455 | GABBR2 | chr9 | 101340354 | - | 9971 | 4991 | 346 | 5046 | 1566 |
ENST00000535648 | TNC | chr9 | 117835882 | - | ENST00000259455 | GABBR2 | chr9 | 101340354 | - | 8556 | 3576 | 296 | 3631 | 1111 |
ENST00000346706 | TNC | chr9 | 117835882 | - | ENST00000259455 | GABBR2 | chr9 | 101340354 | - | 8556 | 3576 | 296 | 3631 | 1111 |
ENST00000340094 | TNC | chr9 | 117835882 | - | ENST00000259455 | GABBR2 | chr9 | 101340354 | - | 8556 | 3576 | 296 | 3631 | 1111 |
ENST00000345230 | TNC | chr9 | 117835882 | - | ENST00000259455 | GABBR2 | chr9 | 101340354 | - | 8556 | 3576 | 296 | 3631 | 1111 |
ENST00000350763 | TNC | chr9 | 117835882 | - | ENST00000259455 | GABBR2 | chr9 | 101340354 | - | 8606 | 3626 | 346 | 3681 | 1111 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000535648 | ENST00000259455 | TNC | chr9 | 117819432 | - | GABBR2 | chr9 | 101340354 | - | 0.000720205 | 0.9992798 |
ENST00000340094 | ENST00000259455 | TNC | chr9 | 117819432 | - | GABBR2 | chr9 | 101340354 | - | 0.000720205 | 0.9992798 |
ENST00000350763 | ENST00000259455 | TNC | chr9 | 117819432 | - | GABBR2 | chr9 | 101340354 | - | 0.001911011 | 0.998089 |
ENST00000535648 | ENST00000259455 | TNC | chr9 | 117835882 | - | GABBR2 | chr9 | 101340354 | - | 0.000982449 | 0.9990176 |
ENST00000346706 | ENST00000259455 | TNC | chr9 | 117835882 | - | GABBR2 | chr9 | 101340354 | - | 0.000982449 | 0.9990176 |
ENST00000340094 | ENST00000259455 | TNC | chr9 | 117835882 | - | GABBR2 | chr9 | 101340354 | - | 0.000982449 | 0.9990176 |
ENST00000345230 | ENST00000259455 | TNC | chr9 | 117835882 | - | GABBR2 | chr9 | 101340354 | - | 0.000982449 | 0.9990176 |
ENST00000350763 | ENST00000259455 | TNC | chr9 | 117835882 | - | GABBR2 | chr9 | 101340354 | - | 0.001023489 | 0.9989766 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for TNC-GABBR2 |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
TNC | chr9 | 117819432 | GABBR2 | chr9 | 101340354 | 3849 | 1184 | SIRTKTISATATTVRQRKRVESLLRC |
TNC | chr9 | 117819432 | GABBR2 | chr9 | 101340354 | 4991 | 1548 | SIRTKTISATATTVRQRKRVESLLRC |
TNC | chr9 | 117835882 | GABBR2 | chr9 | 101340354 | 3576 | 1093 | RHKSKPARVKASTVRQRKRVESLLRC |
TNC | chr9 | 117835882 | GABBR2 | chr9 | 101340354 | 3626 | 1093 | RHKSKPARVKASTVRQRKRVESLLRC |
Top |
Potential FusionNeoAntigen Information of TNC-GABBR2 in HLA I |
![]() |
TNC-GABBR2_117819432_101340354.msa | |
TNC-GABBR2_117835882_101340354.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
TNC-GABBR2 | chr9 | 117819432 | chr9 | 101340354 | 3849 | HLA-A68:24 | ATATTVRQR | 0.9892 | 0.6367 | 8 | 17 |
TNC-GABBR2 | chr9 | 117819432 | chr9 | 101340354 | 3849 | HLA-A68:08 | ATATTVRQR | 0.9876 | 0.5801 | 8 | 17 |
TNC-GABBR2 | chr9 | 117819432 | chr9 | 101340354 | 3849 | HLA-A02:38 | TISATATTV | 0.9857 | 0.6688 | 5 | 14 |
TNC-GABBR2 | chr9 | 117819432 | chr9 | 101340354 | 3849 | HLA-A68:03 | ATATTVRQR | 0.9823 | 0.627 | 8 | 17 |
TNC-GABBR2 | chr9 | 117819432 | chr9 | 101340354 | 3849 | HLA-A31:06 | ATATTVRQR | 0.9769 | 0.6838 | 8 | 17 |
TNC-GABBR2 | chr9 | 117819432 | chr9 | 101340354 | 3849 | HLA-A74:09 | ATATTVRQR | 0.973 | 0.7608 | 8 | 17 |
TNC-GABBR2 | chr9 | 117819432 | chr9 | 101340354 | 3849 | HLA-A74:11 | ATATTVRQR | 0.973 | 0.7608 | 8 | 17 |
TNC-GABBR2 | chr9 | 117819432 | chr9 | 101340354 | 3849 | HLA-A74:03 | ATATTVRQR | 0.973 | 0.7608 | 8 | 17 |
TNC-GABBR2 | chr9 | 117819432 | chr9 | 101340354 | 3849 | HLA-A68:06 | ATATTVRQR | 0.95 | 0.5492 | 8 | 17 |
TNC-GABBR2 | chr9 | 117819432 | chr9 | 101340354 | 3849 | HLA-A68:05 | ATATTVRQR | 0.9414 | 0.6467 | 8 | 17 |
TNC-GABBR2 | chr9 | 117819432 | chr9 | 101340354 | 3849 | HLA-A31:02 | ATATTVRQR | 0.8793 | 0.7561 | 8 | 17 |
TNC-GABBR2 | chr9 | 117819432 | chr9 | 101340354 | 3849 | HLA-A34:05 | ATATTVRQR | 0.8384 | 0.5208 | 8 | 17 |
TNC-GABBR2 | chr9 | 117819432 | chr9 | 101340354 | 3849 | HLA-A34:01 | ATATTVRQR | 0.8384 | 0.5208 | 8 | 17 |
TNC-GABBR2 | chr9 | 117819432 | chr9 | 101340354 | 3849 | HLA-A30:08 | ATATTVRQRK | 0.9811 | 0.663 | 8 | 18 |
TNC-GABBR2 | chr9 | 117819432 | chr9 | 101340354 | 3849 | HLA-A74:11 | KTISATATTVR | 0.9898 | 0.6655 | 4 | 15 |
TNC-GABBR2 | chr9 | 117819432 | chr9 | 101340354 | 3849 | HLA-A74:03 | KTISATATTVR | 0.9898 | 0.6655 | 4 | 15 |
TNC-GABBR2 | chr9 | 117819432 | chr9 | 101340354 | 3849 | HLA-A74:09 | KTISATATTVR | 0.9898 | 0.6655 | 4 | 15 |
TNC-GABBR2 | chr9 | 117819432 | chr9 | 101340354 | 3849 | HLA-A31:02 | KTISATATTVR | 0.9644 | 0.6719 | 4 | 15 |
TNC-GABBR2 | chr9 | 117819432 | chr9 | 101340354 | 3849 | HLA-A68:01 | ATATTVRQR | 0.9892 | 0.6367 | 8 | 17 |
TNC-GABBR2 | chr9 | 117819432 | chr9 | 101340354 | 3849 | HLA-A31:01 | ATATTVRQR | 0.9773 | 0.7331 | 8 | 17 |
TNC-GABBR2 | chr9 | 117819432 | chr9 | 101340354 | 3849 | HLA-A31:01 | SATATTVRQR | 0.8962 | 0.538 | 7 | 17 |
TNC-GABBR2 | chr9 | 117819432 | chr9 | 101340354 | 3849 | HLA-A31:01 | KTISATATTVR | 0.9913 | 0.6349 | 4 | 15 |
TNC-GABBR2 | chr9 | 117819432 | chr9 | 101340354 | 3849 | HLA-A69:01 | TISATATTV | 0.9885 | 0.5019 | 5 | 14 |
TNC-GABBR2 | chr9 | 117819432 | chr9 | 101340354 | 3849 | HLA-A74:01 | ATATTVRQR | 0.973 | 0.7608 | 8 | 17 |
TNC-GABBR2 | chr9 | 117819432 | chr9 | 101340354 | 3849 | HLA-A30:01 | ATATTVRQRK | 0.9778 | 0.804 | 8 | 18 |
TNC-GABBR2 | chr9 | 117819432 | chr9 | 101340354 | 3849 | HLA-A74:01 | KTISATATTVR | 0.9898 | 0.6655 | 4 | 15 |
TNC-GABBR2 | chr9 | 117835882 | chr9 | 101340354 | 3576 | HLA-B27:05 | ARVKASTVR | 0.9984 | 0.5516 | 6 | 15 |
TNC-GABBR2 | chr9 | 117835882 | chr9 | 101340354 | 3576 | HLA-A30:08 | KASTVRQRK | 0.9958 | 0.6768 | 9 | 18 |
TNC-GABBR2 | chr9 | 117835882 | chr9 | 101340354 | 3576 | HLA-A30:08 | RVKASTVRQ | 0.9833 | 0.5006 | 7 | 16 |
TNC-GABBR2 | chr9 | 117835882 | chr9 | 101340354 | 3576 | HLA-A30:08 | RVKASTVRQR | 0.9954 | 0.5573 | 7 | 17 |
TNC-GABBR2 | chr9 | 117835882 | chr9 | 101340354 | 3576 | HLA-A30:08 | RVKASTVRQRK | 0.9978 | 0.7131 | 7 | 18 |
TNC-GABBR2 | chr9 | 117835882 | chr9 | 101340354 | 3576 | HLA-B27:14 | ARVKASTVR | 0.9984 | 0.6095 | 6 | 15 |
TNC-GABBR2 | chr9 | 117835882 | chr9 | 101340354 | 3576 | HLA-B27:10 | ARVKASTVR | 0.997 | 0.6312 | 6 | 15 |
TNC-GABBR2 | chr9 | 117835882 | chr9 | 101340354 | 3576 | HLA-A30:01 | KASTVRQRK | 0.996 | 0.8459 | 9 | 18 |
TNC-GABBR2 | chr9 | 117835882 | chr9 | 101340354 | 3576 | HLA-A30:01 | RVKASTVRQ | 0.9846 | 0.6999 | 7 | 16 |
TNC-GABBR2 | chr9 | 117835882 | chr9 | 101340354 | 3576 | HLA-A30:01 | RVKASTVRQR | 0.9957 | 0.7241 | 7 | 17 |
TNC-GABBR2 | chr9 | 117835882 | chr9 | 101340354 | 3576 | HLA-A30:01 | RVKASTVRQRK | 0.9977 | 0.8608 | 7 | 18 |
Top |
Potential FusionNeoAntigen Information of TNC-GABBR2 in HLA II |
![]() |
TNC-GABBR2_117819432_101340354.msa | |
TNC-GABBR2_117835882_101340354.msa |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
TNC-GABBR2 | chr9 | 117819432 | chr9 | 101340354 | 3849 | DRB1-0303 | TKTISATATTVRQRK | 3 | 18 |
TNC-GABBR2 | chr9 | 117819432 | chr9 | 101340354 | 3849 | DRB1-1155 | ATTVRQRKRVESLLR | 10 | 25 |
TNC-GABBR2 | chr9 | 117819432 | chr9 | 101340354 | 3849 | DRB1-1155 | TATTVRQRKRVESLL | 9 | 24 |
TNC-GABBR2 | chr9 | 117819432 | chr9 | 101340354 | 3849 | DRB5-0106 | TKTISATATTVRQRK | 3 | 18 |
TNC-GABBR2 | chr9 | 117819432 | chr9 | 101340354 | 3849 | DRB5-0112 | TKTISATATTVRQRK | 3 | 18 |
TNC-GABBR2 | chr9 | 117819432 | chr9 | 101340354 | 3849 | DRB5-0205 | TKTISATATTVRQRK | 3 | 18 |
TNC-GABBR2 | chr9 | 117835882 | chr9 | 101340354 | 3576 | DRB1-0303 | PARVKASTVRQRKRV | 5 | 20 |
TNC-GABBR2 | chr9 | 117835882 | chr9 | 101340354 | 3576 | DRB1-0303 | KPARVKASTVRQRKR | 4 | 19 |
TNC-GABBR2 | chr9 | 117835882 | chr9 | 101340354 | 3576 | DRB1-1155 | ASTVRQRKRVESLLR | 10 | 25 |
TNC-GABBR2 | chr9 | 117835882 | chr9 | 101340354 | 3576 | DRB1-1155 | KASTVRQRKRVESLL | 9 | 24 |
TNC-GABBR2 | chr9 | 117835882 | chr9 | 101340354 | 3576 | DRB5-0106 | PARVKASTVRQRKRV | 5 | 20 |
TNC-GABBR2 | chr9 | 117835882 | chr9 | 101340354 | 3576 | DRB5-0106 | KPARVKASTVRQRKR | 4 | 19 |
TNC-GABBR2 | chr9 | 117835882 | chr9 | 101340354 | 3576 | DRB5-0112 | PARVKASTVRQRKRV | 5 | 20 |
TNC-GABBR2 | chr9 | 117835882 | chr9 | 101340354 | 3576 | DRB5-0112 | KPARVKASTVRQRKR | 4 | 19 |
Top |
Fusion breakpoint peptide structures of TNC-GABBR2 |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
572 | ARVKASTVRQRKRV | TNC | GABBR2 | chr9 | 117835882 | chr9 | 101340354 | 3576 |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
3973 | ISATATTVRQRKRV | TNC | GABBR2 | chr9 | 117819432 | chr9 | 101340354 | 3849 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of TNC-GABBR2 |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 572 | ARVKASTVRQRKRV | -7.15543 | -7.26883 |
HLA-B14:02 | 3BVN | 572 | ARVKASTVRQRKRV | -4.77435 | -5.80965 |
HLA-B52:01 | 3W39 | 572 | ARVKASTVRQRKRV | -6.80875 | -6.92215 |
HLA-B52:01 | 3W39 | 572 | ARVKASTVRQRKRV | -4.20386 | -5.23916 |
HLA-A11:01 | 4UQ2 | 572 | ARVKASTVRQRKRV | -7.5194 | -8.5547 |
HLA-A11:01 | 4UQ2 | 572 | ARVKASTVRQRKRV | -6.9601 | -7.0735 |
HLA-A24:02 | 5HGA | 572 | ARVKASTVRQRKRV | -7.52403 | -7.63743 |
HLA-A24:02 | 5HGA | 572 | ARVKASTVRQRKRV | -5.82433 | -6.85963 |
HLA-B27:05 | 6PYJ | 572 | ARVKASTVRQRKRV | -3.28285 | -4.31815 |
HLA-B44:05 | 3DX8 | 572 | ARVKASTVRQRKRV | -5.91172 | -6.94702 |
HLA-B44:05 | 3DX8 | 572 | ARVKASTVRQRKRV | -4.24346 | -4.35686 |
HLA-B14:02 | 3BVN | 3973 | ISATATTVRQRKRV | -7.15543 | -7.26883 |
HLA-B14:02 | 3BVN | 3973 | ISATATTVRQRKRV | -4.77435 | -5.80965 |
HLA-B52:01 | 3W39 | 3973 | ISATATTVRQRKRV | -6.80875 | -6.92215 |
HLA-B52:01 | 3W39 | 3973 | ISATATTVRQRKRV | -4.20386 | -5.23916 |
HLA-A11:01 | 4UQ2 | 3973 | ISATATTVRQRKRV | -7.5194 | -8.5547 |
HLA-A11:01 | 4UQ2 | 3973 | ISATATTVRQRKRV | -6.9601 | -7.0735 |
HLA-A24:02 | 5HGA | 3973 | ISATATTVRQRKRV | -7.52403 | -7.63743 |
HLA-A24:02 | 5HGA | 3973 | ISATATTVRQRKRV | -5.82433 | -6.85963 |
HLA-B27:05 | 6PYJ | 3973 | ISATATTVRQRKRV | -3.28285 | -4.31815 |
HLA-B44:05 | 3DX8 | 3973 | ISATATTVRQRKRV | -5.91172 | -6.94702 |
HLA-B44:05 | 3DX8 | 3973 | ISATATTVRQRKRV | -4.24346 | -4.35686 |
Top |
Vaccine Design for the FusionNeoAntigens of TNC-GABBR2 |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
TNC-GABBR2 | chr9 | 117819432 | chr9 | 101340354 | 4 | 15 | KTISATATTVR | AAACCATCAGTGCCACAGCCACGACAGTGCGAC |
TNC-GABBR2 | chr9 | 117819432 | chr9 | 101340354 | 5 | 14 | TISATATTV | CCATCAGTGCCACAGCCACGACAGTGC |
TNC-GABBR2 | chr9 | 117819432 | chr9 | 101340354 | 7 | 17 | SATATTVRQR | GTGCCACAGCCACGACAGTGCGACAACGCA |
TNC-GABBR2 | chr9 | 117819432 | chr9 | 101340354 | 8 | 17 | ATATTVRQR | CCACAGCCACGACAGTGCGACAACGCA |
TNC-GABBR2 | chr9 | 117819432 | chr9 | 101340354 | 8 | 18 | ATATTVRQRK | CCACAGCCACGACAGTGCGACAACGCAAAA |
TNC-GABBR2 | chr9 | 117835882 | chr9 | 101340354 | 6 | 15 | ARVKASTVR | CACGTGTGAAGGCATCCACTGTGCGAC |
TNC-GABBR2 | chr9 | 117835882 | chr9 | 101340354 | 7 | 16 | RVKASTVRQ | GTGTGAAGGCATCCACTGTGCGACAAC |
TNC-GABBR2 | chr9 | 117835882 | chr9 | 101340354 | 7 | 17 | RVKASTVRQR | GTGTGAAGGCATCCACTGTGCGACAACGCA |
TNC-GABBR2 | chr9 | 117835882 | chr9 | 101340354 | 7 | 18 | RVKASTVRQRK | GTGTGAAGGCATCCACTGTGCGACAACGCAAAA |
TNC-GABBR2 | chr9 | 117835882 | chr9 | 101340354 | 9 | 18 | KASTVRQRK | AGGCATCCACTGTGCGACAACGCAAAA |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
TNC-GABBR2 | chr9 | 117819432 | chr9 | 101340354 | 10 | 25 | ATTVRQRKRVESLLR | CCACGACAGTGCGACAACGCAAAAGGGTTGAAAGCCTTCTACGAT |
TNC-GABBR2 | chr9 | 117819432 | chr9 | 101340354 | 3 | 18 | TKTISATATTVRQRK | CCAAAACCATCAGTGCCACAGCCACGACAGTGCGACAACGCAAAA |
TNC-GABBR2 | chr9 | 117819432 | chr9 | 101340354 | 9 | 24 | TATTVRQRKRVESLL | CAGCCACGACAGTGCGACAACGCAAAAGGGTTGAAAGCCTTCTAC |
TNC-GABBR2 | chr9 | 117835882 | chr9 | 101340354 | 10 | 25 | ASTVRQRKRVESLLR | CATCCACTGTGCGACAACGCAAAAGGGTTGAAAGCCTTCTACGAT |
TNC-GABBR2 | chr9 | 117835882 | chr9 | 101340354 | 4 | 19 | KPARVKASTVRQRKR | AGCCCGCACGTGTGAAGGCATCCACTGTGCGACAACGCAAAAGGG |
TNC-GABBR2 | chr9 | 117835882 | chr9 | 101340354 | 5 | 20 | PARVKASTVRQRKRV | CCGCACGTGTGAAGGCATCCACTGTGCGACAACGCAAAAGGGTTG |
TNC-GABBR2 | chr9 | 117835882 | chr9 | 101340354 | 9 | 24 | KASTVRQRKRVESLL | AGGCATCCACTGTGCGACAACGCAAAAGGGTTGAAAGCCTTCTAC |
Top |
Information of the samples that have these potential fusion neoantigens of TNC-GABBR2 |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
BRCA | TNC-GABBR2 | chr9 | 117819432 | ENST00000340094 | chr9 | 101340354 | ENST00000259455 | TCGA-D8-A1J9-01A |
BRCA | TNC-GABBR2 | chr9 | 117835882 | ENST00000340094 | chr9 | 101340354 | ENST00000259455 | TCGA-D8-A1J9-01A |
Top |
Potential target of CAR-T therapy development for TNC-GABBR2 |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
Tgene | GABBR2 | chr9:117819432 | chr9:101340354 | ENST00000259455 | 0 | 19 | 484_504 | 0 | 942.0 | Transmembrane | Helical%3B Name%3D1 | |
Tgene | GABBR2 | chr9:117819432 | chr9:101340354 | ENST00000259455 | 0 | 19 | 523_543 | 0 | 942.0 | Transmembrane | Helical%3B Name%3D2 | |
Tgene | GABBR2 | chr9:117819432 | chr9:101340354 | ENST00000259455 | 0 | 19 | 552_572 | 0 | 942.0 | Transmembrane | Helical%3B Name%3D3 | |
Tgene | GABBR2 | chr9:117819432 | chr9:101340354 | ENST00000259455 | 0 | 19 | 598_618 | 0 | 942.0 | Transmembrane | Helical%3B Name%3D4 | |
Tgene | GABBR2 | chr9:117819432 | chr9:101340354 | ENST00000259455 | 0 | 19 | 655_675 | 0 | 942.0 | Transmembrane | Helical%3B Name%3D5 | |
Tgene | GABBR2 | chr9:117819432 | chr9:101340354 | ENST00000259455 | 0 | 19 | 692_712 | 0 | 942.0 | Transmembrane | Helical%3B Name%3D6 | |
Tgene | GABBR2 | chr9:117819432 | chr9:101340354 | ENST00000259455 | 0 | 19 | 721_741 | 0 | 942.0 | Transmembrane | Helical%3B Name%3D7 | |
Tgene | GABBR2 | chr9:117835882 | chr9:101340354 | ENST00000259455 | 0 | 19 | 484_504 | 0 | 942.0 | Transmembrane | Helical%3B Name%3D1 | |
Tgene | GABBR2 | chr9:117835882 | chr9:101340354 | ENST00000259455 | 0 | 19 | 523_543 | 0 | 942.0 | Transmembrane | Helical%3B Name%3D2 | |
Tgene | GABBR2 | chr9:117835882 | chr9:101340354 | ENST00000259455 | 0 | 19 | 552_572 | 0 | 942.0 | Transmembrane | Helical%3B Name%3D3 | |
Tgene | GABBR2 | chr9:117835882 | chr9:101340354 | ENST00000259455 | 0 | 19 | 598_618 | 0 | 942.0 | Transmembrane | Helical%3B Name%3D4 | |
Tgene | GABBR2 | chr9:117835882 | chr9:101340354 | ENST00000259455 | 0 | 19 | 655_675 | 0 | 942.0 | Transmembrane | Helical%3B Name%3D5 | |
Tgene | GABBR2 | chr9:117835882 | chr9:101340354 | ENST00000259455 | 0 | 19 | 692_712 | 0 | 942.0 | Transmembrane | Helical%3B Name%3D6 | |
Tgene | GABBR2 | chr9:117835882 | chr9:101340354 | ENST00000259455 | 0 | 19 | 721_741 | 0 | 942.0 | Transmembrane | Helical%3B Name%3D7 |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to TNC-GABBR2 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to TNC-GABBR2 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |