Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:TP53BP2-PPP1R13B

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: TP53BP2-PPP1R13B
	FusionPDB ID: 93193
	FusionGDB2.0 ID: 93193
		Hgene	Tgene
	Gene symbol	TP53BP2	PPP1R13B
	Gene ID	7159	23368
	Gene name	tumor protein p53 binding protein 2	protein phosphatase 1 regulatory subunit 13B
	Synonyms	53BP2\|ASPP2\|BBP\|P53BP2\|PPP1R13A	ASPP1\|p53BP2-like\|p85
	Cytomap	1q41	14q32.33
	Type of gene	protein-coding	protein-coding
	Description	apoptosis-stimulating of p53 protein 2BCL2-binding proteinapoptosis-stimulating protein of p53, 2renal carcinoma antigen NY-REN-51tumor suppressor p53-binding protein 2	apoptosis-stimulating of p53 protein 1apoptosis-stimulating protein of p53, 1protein phosphatase 1, regulatory (inhibitor) subunit 13B
	Modification date	20200313	20200313
	UniProtAcc	.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000343537, ENST00000391878, ENST00000391879, ENST00000498843,	ENST00000555391, ENST00000202556, ENST00000423488,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	5 X 5 X 5=125	10 X 10 X 5=500
	# samples	5	10
	** MAII score	log2(5/125*10)=-1.32192809488736 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(10/500*10)=-2.32192809488736 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: TP53BP2 [Title/Abstract] AND PPP1R13B [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: TP53BP2 [Title/Abstract] AND PPP1R13B [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	TP53BP2(223980090)-PPP1R13B(104202539), # samples:1
Anticipated loss of major functional domain due to fusion event.	TP53BP2-PPP1R13B seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. TP53BP2-PPP1R13B seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. TP53BP2-PPP1R13B seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. TP53BP2-PPP1R13B seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. TP53BP2-PPP1R13B seems lost the major protein functional domain in Hgene partner, which is a essential gene due to the frame-shifted ORF. TP53BP2-PPP1R13B seems lost the major protein functional domain in Hgene partner, which is a tumor suppressor due to the frame-shifted ORF. TP53BP2-PPP1R13B seems lost the major protein functional domain in Tgene partner, which is a essential gene due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	TP53BP2	GO:0072332	intrinsic apoptotic signaling pathway by p53 class mediator	11684014
Tgene	PPP1R13B	GO:0072332	intrinsic apoptotic signaling pathway by p53 class mediator	11684014

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr1:223980090/chr14:104202539)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across TP53BP2 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across PPP1R13B (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000391878	TP53BP2	chr1	223980090	-	ENST00000423488	PPP1R13B	chr14	104202539	-	5021	3378	583	3453	956
ENST00000343537	TP53BP2	chr1	223980090	-	ENST00000423488	PPP1R13B	chr14	104202539	-	4931	3288	1	3363	1120
ENST00000391879	TP53BP2	chr1	223980090	-	ENST00000423488	PPP1R13B	chr14	104202539	-	2867	1224	352	1299	315

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000391878	ENST00000423488	TP53BP2	chr1	223980090	-	PPP1R13B	chr14	104202539	-	0.001300017	0.9986999
ENST00000343537	ENST00000423488	TP53BP2	chr1	223980090	-	PPP1R13B	chr14	104202539	-	0.000561211	0.9994388
ENST00000391879	ENST00000423488	TP53BP2	chr1	223980090	-	PPP1R13B	chr14	104202539	-	0.001038794	0.9989612

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for TP53BP2-PPP1R13B

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
TP53BP2	chr1	223980090	PPP1R13B	chr14	104202539	3288	106	PPASMRFGSKMMPMFLTVYLSNNEQH
TP53BP2	chr1	223980090	PPP1R13B	chr14	104202539	3378	52	LKRNGVKVPGEYRRKENGVNSPRMDL

Top

Potential FusionNeoAntigen Information of TP53BP2-PPP1R13B in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

TP53BP2-PPP1R13B_223980090_104202539.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B35:01	MPMFLTVY	0.9983	0.8341	11	19
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B35:08	MPMFLTVY	0.9956	0.8463	11	19
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B15:02	MPMFLTVY	0.9924	0.9418	11	19
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B15:01	MMPMFLTVY	0.9991	0.9211	10	19
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-A02:13	KMMPMFLTV	0.9989	0.5363	9	18
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-A02:38	KMMPMFLTV	0.9978	0.5411	9	18
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-A02:04	KMMPMFLTV	0.9977	0.5811	9	18
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-A02:17	KMMPMFLTV	0.9964	0.5093	9	18
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B35:03	MPMFLTVYL	0.996	0.8461	11	20
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B35:01	MPMFLTVYL	0.9933	0.837	11	20
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B15:25	MMPMFLTVY	0.993	0.9471	10	19
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B15:02	MMPMFLTVY	0.9929	0.9552	10	19
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B35:08	MPMFLTVYL	0.9882	0.8303	11	20
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B35:04	MPMFLTVYL	0.9796	0.8741	11	20
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B35:02	MPMFLTVYL	0.9796	0.8741	11	20
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-A30:08	KMMPMFLTV	0.9752	0.7048	9	18
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3378	HLA-A30:08	KVPGEYRRK	0.9475	0.6264	6	15
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-A30:08	GSKMMPMFL	0.9449	0.7342	7	16
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-A32:13	KMMPMFLTV	0.9009	0.9687	9	18
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B08:01	MPMFLTVYL	0.8981	0.8664	11	20
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B08:09	MPMFLTVYL	0.8461	0.7806	11	20
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B13:02	KMMPMFLTV	0.4661	0.5721	9	18
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B13:01	KMMPMFLTV	0.3753	0.9455	9	18
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B52:01	KMMPMFLTV	0.0624	0.854	9	18
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B27:05	MRFGSKMMPM	1	0.8961	4	14
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B27:04	MRFGSKMMPM	0.9999	0.7569	4	14
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B27:02	MRFGSKMMPM	0.9999	0.5868	4	14
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B15:01	KMMPMFLTVY	0.9999	0.9138	9	19
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B15:25	KMMPMFLTVY	0.9987	0.9219	9	19
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-A32:13	KMMPMFLTVY	0.8931	0.9135	9	19
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3378	HLA-A31:06	GVKVPGEYRR	0.7085	0.5308	4	14
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B27:04	MRFGSKMMPMF	1	0.759	4	15
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B27:02	MRFGSKMMPMF	1	0.5601	4	15
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B27:05	MRFGSKMMPMF	1	0.8849	4	15
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3378	HLA-B27:05	RRKENGVNSPR	0.9995	0.7823	12	23
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B15:03	SKMMPMFLTVY	0.8853	0.6127	8	19
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B15:31	MPMFLTVY	0.9983	0.7898	11	19
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-A02:07	KMMPMFLTV	0.9985	0.5039	9	18
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B15:07	MMPMFLTVY	0.9954	0.6542	10	19
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B15:21	MMPMFLTVY	0.9929	0.9415	10	19
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-C04:06	KMMPMFLTV	0.9898	0.8901	9	18
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B15:31	MMPMFLTVY	0.9811	0.8471	10	19
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B35:12	MPMFLTVYL	0.9796	0.8741	11	20
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B15:05	MMPMFLTVY	0.9728	0.8338	10	19
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B51:07	MPMFLTVYL	0.9649	0.5689	11	20
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B42:02	MPMFLTVYL	0.9502	0.8529	11	20
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B39:10	MPMFLTVYL	0.9441	0.8349	11	20
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B42:01	MPMFLTVYL	0.9364	0.853	11	20
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B15:04	MMPMFLTVY	0.9173	0.9228	10	19
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B15:04	KMMPMFLTV	0.8698	0.8649	9	18
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B07:12	MPMFLTVYL	0.8689	0.5082	11	20
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-C02:06	KMMPMFLTV	0.7761	0.9473	9	18
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B51:07	KMMPMFLTV	0.0567	0.7842	9	18
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B27:14	MRFGSKMMPM	0.9999	0.8139	4	14
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B15:07	KMMPMFLTVY	0.9998	0.6862	9	19
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B27:03	MRFGSKMMPM	0.9983	0.9162	4	14
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B15:04	KMMPMFLTVY	0.9964	0.9461	9	19
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B15:05	KMMPMFLTVY	0.9931	0.8398	9	19
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3378	HLA-A31:01	GVKVPGEYRR	0.9457	0.6671	4	14
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B27:14	MRFGSKMMPMF	1	0.7976	4	15
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B27:03	MRFGSKMMPMF	0.9997	0.9049	4	15
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B35:77	MPMFLTVY	0.9983	0.8341	11	19
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B35:23	MPMFLTVY	0.9983	0.8297	11	19
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B35:20	MPMFLTVY	0.9979	0.8657	11	19
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B35:30	MPMFLTVY	0.9971	0.5658	11	19
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B35:17	MPMFLTVY	0.9971	0.5658	11	19
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B35:24	MPMFLTVY	0.9952	0.7973	11	19
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B35:11	MPMFLTVY	0.991	0.9181	11	19
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B18:04	MPMFLTVY	0.958	0.7545	11	19
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B15:11	MPMFLTVY	0.9374	0.8507	11	19
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B15:08	MPMFLTVY	0.9362	0.8531	11	19
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B35:43	MPMFLTVY	0.9258	0.8566	11	19
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B18:07	MPMFLTVY	0.923	0.6952	11	19
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B15:27	MMPMFLTVY	0.9992	0.9183	10	19
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B15:34	MMPMFLTVY	0.9991	0.9211	10	19
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B15:125	MMPMFLTVY	0.9991	0.9211	10	19
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B15:33	MMPMFLTVY	0.9991	0.9211	10	19
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B15:50	MMPMFLTVY	0.999	0.9497	10	19
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B15:135	MMPMFLTVY	0.999	0.9128	10	19
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B15:11	MMPMFLTVY	0.999	0.8923	10	19
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-A02:03	KMMPMFLTV	0.9989	0.6119	9	18
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B15:08	MMPMFLTVY	0.9988	0.8914	10	19
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B15:12	MMPMFLTVY	0.9968	0.8131	10	19
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-C15:02	KMMPMFLTV	0.9964	0.7396	9	18
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B35:13	MPMFLTVYL	0.9951	0.8541	11	20
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-C15:05	KMMPMFLTV	0.9949	0.8721	9	18
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B15:35	MMPMFLTVY	0.9944	0.895	10	19
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-C15:02	GSKMMPMFL	0.9944	0.7989	7	16
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B35:23	MPMFLTVYL	0.9941	0.8328	11	20
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B35:77	MPMFLTVYL	0.9933	0.837	11	20
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B15:39	MMPMFLTVY	0.9931	0.8707	10	19
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B35:24	MPMFLTVYL	0.9819	0.7756	11	20
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B35:17	MPMFLTVYL	0.9812	0.6172	11	20
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B35:30	MPMFLTVYL	0.9812	0.6172	11	20
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B35:20	MMPMFLTVY	0.9809	0.9001	10	19
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B35:09	MPMFLTVYL	0.9796	0.8741	11	20
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-A30:01	KMMPMFLTV	0.9774	0.8729	9	18
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-C04:04	KMMPMFLTV	0.9751	0.89	9	18
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B15:20	MMPMFLTVY	0.9746	0.8904	10	19
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-A32:01	KMMPMFLTV	0.9695	0.948	9	18
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B35:11	MPMFLTVYL	0.9639	0.9094	11	20
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3378	HLA-A30:01	KVPGEYRRK	0.952	0.7155	6	15
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B67:01	MPMFLTVYL	0.9506	0.5876	11	20
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B08:18	MPMFLTVYL	0.8981	0.8664	11	20
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B15:73	KMMPMFLTV	0.8792	0.906	9	18
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B08:12	MPMFLTVYL	0.8563	0.9599	11	20
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-C17:01	KMMPMFLTV	0.7866	0.9337	9	18
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B18:07	MPMFLTVYL	0.5375	0.7071	11	20
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-C07:04	KMMPMFLTV	0.3683	0.9188	9	18
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B35:43	MPMFLTVYL	0.0921	0.8438	11	20
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B15:08	MPMFLTVYL	0.0889	0.8406	11	20
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B15:11	MPMFLTVYL	0.0761	0.8236	11	20
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B27:08	MRFGSKMMPM	1	0.7833	4	14
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B15:34	KMMPMFLTVY	0.9999	0.9138	9	19
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B15:135	KMMPMFLTVY	0.9999	0.9221	9	19
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B15:50	KMMPMFLTVY	0.9999	0.9375	9	19
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B27:10	MRFGSKMMPM	0.9999	0.8832	4	14
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B15:33	KMMPMFLTVY	0.9999	0.9138	9	19
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B15:125	KMMPMFLTVY	0.9999	0.9138	9	19
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B15:27	KMMPMFLTVY	0.9999	0.9277	9	19
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B27:09	MRFGSKMMPM	0.9998	0.8587	4	14
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B27:06	MRFGSKMMPM	0.9998	0.7695	4	14
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B15:12	KMMPMFLTVY	0.9998	0.8761	9	19
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B15:35	KMMPMFLTVY	0.9998	0.9156	9	19
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B15:24	KMMPMFLTVY	0.9997	0.9262	9	19
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B15:39	KMMPMFLTVY	0.9989	0.8591	9	19
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B15:20	KMMPMFLTVY	0.9938	0.8944	9	19
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B35:28	KMMPMFLTVY	0.9904	0.8996	9	19
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-A32:01	KMMPMFLTVY	0.9684	0.9185	9	19
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B27:06	MRFGSKMMPMF	1	0.7789	4	15
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B27:10	MRFGSKMMPMF	1	0.8908	4	15
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B27:08	MRFGSKMMPMF	1	0.7568	4	15
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-B27:09	MRFGSKMMPMF	0.9999	0.8436	4	15
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3378	HLA-B27:10	RRKENGVNSPR	0.9993	0.8287	12	23
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3288	HLA-A32:01	KMMPMFLTVYL	0.9837	0.936	9	20

Top

Potential FusionNeoAntigen Information of TP53BP2-PPP1R13B in HLA II

TP53BP2-PPP1R13B_223980090_104202539.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3378	DRB1-0801	PGEYRRKENGVNSPR	8	23
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3378	DRB1-0802	PGEYRRKENGVNSPR	8	23
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3378	DRB1-0802	VPGEYRRKENGVNSP	7	22
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3378	DRB1-0808	PGEYRRKENGVNSPR	8	23
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3378	DRB1-0808	VPGEYRRKENGVNSP	7	22
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3378	DRB1-0809	PGEYRRKENGVNSPR	8	23
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3378	DRB1-0809	VPGEYRRKENGVNSP	7	22
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3378	DRB1-0811	PGEYRRKENGVNSPR	8	23
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3378	DRB1-0811	VPGEYRRKENGVNSP	7	22
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3378	DRB1-0813	PGEYRRKENGVNSPR	8	23
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3378	DRB1-0813	VPGEYRRKENGVNSP	7	22
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3378	DRB1-0815	PGEYRRKENGVNSPR	8	23
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3378	DRB1-0816	PGEYRRKENGVNSPR	8	23
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3378	DRB1-0821	PGEYRRKENGVNSPR	8	23
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3378	DRB1-0821	VPGEYRRKENGVNSP	7	22
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3378	DRB1-0826	PGEYRRKENGVNSPR	8	23
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3378	DRB1-0830	PGEYRRKENGVNSPR	8	23
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3378	DRB1-0839	PGEYRRKENGVNSPR	8	23
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3378	DRB1-1130	PGEYRRKENGVNSPR	8	23
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3378	DRB1-1130	VPGEYRRKENGVNSP	7	22
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3378	DRB1-1347	PGEYRRKENGVNSPR	8	23
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3378	DRB1-1367	PGEYRRKENGVNSPR	8	23
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3378	DRB1-1367	VPGEYRRKENGVNSP	7	22
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3378	DRB1-1403	PGEYRRKENGVNSPR	8	23
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3378	DRB1-1427	PGEYRRKENGVNSPR	8	23
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3378	DRB1-1440	PGEYRRKENGVNSPR	8	23
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	3378	DRB1-1477	PGEYRRKENGVNSPR	8	23

Top

Fusion breakpoint peptide structures of TP53BP2-PPP1R13B

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
2388	FGSKMMPMFLTVYL	TP53BP2	PPP1R13B	chr1	223980090	chr14	104202539	3288

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
4690	KVPGEYRRKENGVN	TP53BP2	PPP1R13B	chr1	223980090	chr14	104202539	3378

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of TP53BP2-PPP1R13B

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	2388	FGSKMMPMFLTVYL	-6.77781	-6.89121
HLA-B14:02	3BVN	2388	FGSKMMPMFLTVYL	-3.08719	-4.12249
HLA-B52:01	3W39	2388	FGSKMMPMFLTVYL	-6.66315	-6.77655
HLA-B52:01	3W39	2388	FGSKMMPMFLTVYL	-2.65785	-3.69315
HLA-A24:02	5HGA	2388	FGSKMMPMFLTVYL	-7.20627	-7.31967
HLA-A24:02	5HGA	2388	FGSKMMPMFLTVYL	-6.50211	-7.53741
HLA-B44:05	3DX8	2388	FGSKMMPMFLTVYL	-7.75024	-7.86364
HLA-B44:05	3DX8	2388	FGSKMMPMFLTVYL	-6.53073	-7.56603
HLA-A02:01	6TDR	2388	FGSKMMPMFLTVYL	-4.4528	-5.4881
HLA-B14:02	3BVN	4690	KVPGEYRRKENGVN	-7.32363	-7.43703
HLA-B14:02	3BVN	4690	KVPGEYRRKENGVN	-2.91635	-3.95165
HLA-B52:01	3W39	4690	KVPGEYRRKENGVN	-7.01993	-8.05523
HLA-B52:01	3W39	4690	KVPGEYRRKENGVN	-6.14811	-6.26151
HLA-A11:01	4UQ2	4690	KVPGEYRRKENGVN	-4.65881	-4.77221
HLA-A24:02	5HGA	4690	KVPGEYRRKENGVN	-6.9585	-7.0719
HLA-A24:02	5HGA	4690	KVPGEYRRKENGVN	-6.22358	-7.25888
HLA-B44:05	3DX8	4690	KVPGEYRRKENGVN	-7.18833	-7.30173
HLA-B44:05	3DX8	4690	KVPGEYRRKENGVN	-3.48335	-4.51865
HLA-A02:01	6TDR	4690	KVPGEYRRKENGVN	-5.74716	-5.86056

Top

Vaccine Design for the FusionNeoAntigens of TP53BP2-PPP1R13B

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	10	19	MMPMFLTVY	TGATGGATGGGGTGCAGGAAAAGCTGG
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	11	19	MPMFLTVY	TGGATGGGGTGCAGGAAAAGCTGG
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	11	20	MPMFLTVYL	TGGATGGGGTGCAGGAAAAGCTGGGTG
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	12	23	RRKENGVNSPR	ATGGGGTGCAGGAAAAGCTGGGTGTGATGAACA
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	4	14	GVKVPGEYRR	TGTAAATGCTGCTGATAGTGATGGATGGGG
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	4	14	MRFGSKMMPM	TGTAAATGCTGCTGATAGTGATGGATGGGG
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	4	15	MRFGSKMMPMF	TGTAAATGCTGCTGATAGTGATGGATGGGGTGC
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	6	15	KVPGEYRRK	TGCTGCTGATAGTGATGGATGGGGTGC
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	7	16	GSKMMPMFL	TGCTGATAGTGATGGATGGGGTGCAGG
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	8	19	SKMMPMFLTVY	TGATAGTGATGGATGGGGTGCAGGAAAAGCTGG
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	9	18	KMMPMFLTV	TAGTGATGGATGGGGTGCAGGAAAAGC
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	9	19	KMMPMFLTVY	TAGTGATGGATGGGGTGCAGGAAAAGCTGG
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	9	20	KMMPMFLTVYL	TAGTGATGGATGGGGTGCAGGAAAAGCTGGGTG

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	7	22	VPGEYRRKENGVNSP	TGCTGATAGTGATGGATGGGGTGCAGGAAAAGCTGGGTGTGATGA
TP53BP2-PPP1R13B	chr1	223980090	chr14	104202539	8	23	PGEYRRKENGVNSPR	TGATAGTGATGGATGGGGTGCAGGAAAAGCTGGGTGTGATGAACA

Top

Information of the samples that have these potential fusion neoantigens of TP53BP2-PPP1R13B

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
Non-Cancer	TP53BP2-PPP1R13B	chr1	223980090	ENST00000343537	chr14	104202539	ENST00000423488	TCGA-EL-A3H7-11A
Non-Cancer	TP53BP2-PPP1R13B	chr1	223980090	ENST00000391878	chr14	104202539	ENST00000423488	TCGA-EL-A3H7-11A

Top

Potential target of CAR-T therapy development for TP53BP2-PPP1R13B

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to TP53BP2-PPP1R13B

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to TP53BP2-PPP1R13B

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)