Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:TSEN2-PPARG

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: TSEN2-PPARG
	FusionPDB ID: 94534
	FusionGDB2.0 ID: 94534
		Hgene	Tgene
	Gene symbol	TSEN2	PPARG
	Gene ID	80746	5468
	Gene name	tRNA splicing endonuclease subunit 2	peroxisome proliferator activated receptor gamma
	Synonyms	PCH2B\|SEN2\|SEN2L	CIMT1\|GLM1\|NR1C3\|PPARG1\|PPARG2\|PPARgamma
	Cytomap	3p25.2	3p25.2
	Type of gene	protein-coding	protein-coding
	Description	tRNA-splicing endonuclease subunit Sen2TSEN2 tRNA splicing endonuclease subunithsSen2tRNA-intron endonuclease Sen2	peroxisome proliferator-activated receptor gammaPPAR-gammanuclear receptor subfamily 1 group C member 3peroxisome proliferator-activated nuclear receptor gamma variant 1
	Modification date	20200313	20200329
	UniProtAcc	.	P37231 Main function of 5'-partner protein: FUNCTION: Nuclear receptor that binds peroxisome proliferators such as hypolipidemic drugs and fatty acids. Once activated by a ligand, the nuclear receptor binds to DNA specific PPAR response elements (PPRE) and modulates the transcription of its target genes, such as acyl-CoA oxidase. It therefore controls the peroxisomal beta-oxidation pathway of fatty acids. Key regulator of adipocyte differentiation and glucose homeostasis. ARF6 acts as a key regulator of the tissue-specific adipocyte P2 (aP2) enhancer. Acts as a critical regulator of gut homeostasis by suppressing NF-kappa-B-mediated proinflammatory responses. Plays a role in the regulation of cardiovascular circadian rhythms by regulating the transcription of ARNTL/BMAL1 in the blood vessels (By similarity). {ECO:0000250\|UniProtKB:P37238, ECO:0000269\|PubMed:16150867, ECO:0000269\|PubMed:20829347, ECO:0000269\|PubMed:23525231, ECO:0000269\|PubMed:9065481}.; FUNCTION: (Microbial infection) Upon treatment with M.tuberculosis or its lipoprotein LpqH, phosphorylation of MAPK p38 and IL-6 production are modulated, probably via this protein. {ECO:0000269\|PubMed:25504154}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000284995, ENST00000314571, ENST00000383797, ENST00000402228, ENST00000415684, ENST00000444864, ENST00000454502, ENST00000475595,	ENST00000287820, ENST00000309576, ENST00000397000, ENST00000397010, ENST00000397012, ENST00000397015, ENST00000397026, ENST00000539812,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	7 X 12 X 4=336	11 X 14 X 10=1540
	# samples	13	23
	** MAII score	log2(13/336*10)=-1.36994960975031 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(23/1540*10)=-2.74322458463789 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: TSEN2 [Title/Abstract] AND PPARG [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: TSEN2 [Title/Abstract] AND PPARG [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	TSEN2(12538053)-PPARG(12475397), # samples:2 TSEN2(12546730)-PPARG(12458203), # samples:2
Anticipated loss of major functional domain due to fusion event.	TSEN2-PPARG seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. TSEN2-PPARG seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. TSEN2-PPARG seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. TSEN2-PPARG seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. TSEN2-PPARG seems lost the major protein functional domain in Hgene partner, which is a essential gene due to the frame-shifted ORF. TSEN2-PPARG seems lost the major protein functional domain in Tgene partner, which is a cell metabolism gene due to the frame-shifted ORF. TSEN2-PPARG seems lost the major protein functional domain in Tgene partner, which is a CGC due to the frame-shifted ORF. TSEN2-PPARG seems lost the major protein functional domain in Tgene partner, which is a IUPHAR drug target due to the frame-shifted ORF. TSEN2-PPARG seems lost the major protein functional domain in Tgene partner, which is a transcription factor due to the frame-shifted ORF. TSEN2-PPARG seems lost the major protein functional domain in Tgene partner, which is a tumor suppressor due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	TSEN2	GO:0006388	tRNA splicing, via endonucleolytic cleavage and ligation	17495927
Tgene	PPARG	GO:0000122	negative regulation of transcription by RNA polymerase II	12700342
Tgene	PPARG	GO:0006919	activation of cysteine-type endopeptidase activity involved in apoptotic process	18293083
Tgene	PPARG	GO:0007165	signal transduction	9568716
Tgene	PPARG	GO:0010742	macrophage derived foam cell differentiation	26504087
Tgene	PPARG	GO:0010745	negative regulation of macrophage derived foam cell differentiation	19114110
Tgene	PPARG	GO:0010871	negative regulation of receptor biosynthetic process	12700342
Tgene	PPARG	GO:0010887	negative regulation of cholesterol storage	19114110
Tgene	PPARG	GO:0010891	negative regulation of sequestering of triglyceride	12700342
Tgene	PPARG	GO:0016525	negative regulation of angiogenesis	28566713
Tgene	PPARG	GO:0030224	monocyte differentiation	9568716
Tgene	PPARG	GO:0032526	response to retinoic acid	16239304
Tgene	PPARG	GO:0042953	lipoprotein transport	9568716
Tgene	PPARG	GO:0043537	negative regulation of blood vessel endothelial cell migration	28566713
Tgene	PPARG	GO:0045713	low-density lipoprotein particle receptor biosynthetic process	9568716
Tgene	PPARG	GO:0045944	positive regulation of transcription by RNA polymerase II	9568715\|12700342\|16239304\|17611579
Tgene	PPARG	GO:0048469	cell maturation	9568716
Tgene	PPARG	GO:0048662	negative regulation of smooth muscle cell proliferation	20622039
Tgene	PPARG	GO:0051091	positive regulation of DNA-binding transcription factor activity	18293083
Tgene	PPARG	GO:0061614	pri-miRNA transcription by RNA polymerase II	28566713
Tgene	PPARG	GO:0071404	cellular response to low-density lipoprotein particle stimulus	9568716
Tgene	PPARG	GO:1904706	negative regulation of vascular smooth muscle cell proliferation	28522568

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr3:12538053/chr3:12475397)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across TSEN2 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across PPARG (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000314571	TSEN2	chr3	12545283	+	ENST00000397010	PPARG	chr3	12434113	+	2171	934	103	1971	622
ENST00000314571	TSEN2	chr3	12545283	+	ENST00000309576	PPARG	chr3	12434113	+	2171	934	103	1971	622
ENST00000314571	TSEN2	chr3	12545283	+	ENST00000397015	PPARG	chr3	12434113	+	2138	934	103	1971	622
ENST00000314571	TSEN2	chr3	12545283	+	ENST00000397012	PPARG	chr3	12434113	+	2171	934	103	1971	622
ENST00000314571	TSEN2	chr3	12545283	+	ENST00000397026	PPARG	chr3	12434113	+	2166	934	103	1971	622
ENST00000314571	TSEN2	chr3	12545283	+	ENST00000397000	PPARG	chr3	12434113	+	1592	934	103	1290	395
ENST00000314571	TSEN2	chr3	12545283	+	ENST00000539812	PPARG	chr3	12434113	+	1592	934	103	1290	395
ENST00000314571	TSEN2	chr3	12545283	+	ENST00000287820	PPARG	chr3	12434113	+	2183	934	103	1971	622
ENST00000383797	TSEN2	chr3	12545283	+	ENST00000397010	PPARG	chr3	12434113	+	2160	923	92	1960	622
ENST00000383797	TSEN2	chr3	12545283	+	ENST00000309576	PPARG	chr3	12434113	+	2160	923	92	1960	622
ENST00000383797	TSEN2	chr3	12545283	+	ENST00000397015	PPARG	chr3	12434113	+	2127	923	92	1960	622
ENST00000383797	TSEN2	chr3	12545283	+	ENST00000397012	PPARG	chr3	12434113	+	2160	923	92	1960	622
ENST00000383797	TSEN2	chr3	12545283	+	ENST00000397026	PPARG	chr3	12434113	+	2155	923	92	1960	622
ENST00000383797	TSEN2	chr3	12545283	+	ENST00000397000	PPARG	chr3	12434113	+	1581	923	92	1279	395
ENST00000383797	TSEN2	chr3	12545283	+	ENST00000539812	PPARG	chr3	12434113	+	1581	923	92	1279	395
ENST00000383797	TSEN2	chr3	12545283	+	ENST00000287820	PPARG	chr3	12434113	+	2172	923	92	1960	622
ENST00000454502	TSEN2	chr3	12545283	+	ENST00000397010	PPARG	chr3	12434113	+	1983	746	92	1783	563
ENST00000454502	TSEN2	chr3	12545283	+	ENST00000309576	PPARG	chr3	12434113	+	1983	746	92	1783	563
ENST00000454502	TSEN2	chr3	12545283	+	ENST00000397015	PPARG	chr3	12434113	+	1950	746	92	1783	563
ENST00000454502	TSEN2	chr3	12545283	+	ENST00000397012	PPARG	chr3	12434113	+	1983	746	92	1783	563
ENST00000454502	TSEN2	chr3	12545283	+	ENST00000397026	PPARG	chr3	12434113	+	1978	746	92	1783	563
ENST00000454502	TSEN2	chr3	12545283	+	ENST00000397000	PPARG	chr3	12434113	+	1404	746	92	1102	336
ENST00000454502	TSEN2	chr3	12545283	+	ENST00000539812	PPARG	chr3	12434113	+	1404	746	92	1102	336
ENST00000454502	TSEN2	chr3	12545283	+	ENST00000287820	PPARG	chr3	12434113	+	1995	746	92	1783	563
ENST00000402228	TSEN2	chr3	12545283	+	ENST00000397010	PPARG	chr3	12434113	+	2223	986	155	2023	622
ENST00000402228	TSEN2	chr3	12545283	+	ENST00000309576	PPARG	chr3	12434113	+	2223	986	155	2023	622
ENST00000402228	TSEN2	chr3	12545283	+	ENST00000397015	PPARG	chr3	12434113	+	2190	986	155	2023	622
ENST00000402228	TSEN2	chr3	12545283	+	ENST00000397012	PPARG	chr3	12434113	+	2223	986	155	2023	622
ENST00000402228	TSEN2	chr3	12545283	+	ENST00000397026	PPARG	chr3	12434113	+	2218	986	155	2023	622
ENST00000402228	TSEN2	chr3	12545283	+	ENST00000397000	PPARG	chr3	12434113	+	1644	986	155	1342	395
ENST00000402228	TSEN2	chr3	12545283	+	ENST00000539812	PPARG	chr3	12434113	+	1644	986	155	1342	395
ENST00000402228	TSEN2	chr3	12545283	+	ENST00000287820	PPARG	chr3	12434113	+	2235	986	155	2023	622
ENST00000444864	TSEN2	chr3	12545283	+	ENST00000397010	PPARG	chr3	12434113	+	2455	1218	387	2255	622
ENST00000444864	TSEN2	chr3	12545283	+	ENST00000309576	PPARG	chr3	12434113	+	2455	1218	387	2255	622
ENST00000444864	TSEN2	chr3	12545283	+	ENST00000397015	PPARG	chr3	12434113	+	2422	1218	387	2255	622
ENST00000444864	TSEN2	chr3	12545283	+	ENST00000397012	PPARG	chr3	12434113	+	2455	1218	387	2255	622
ENST00000444864	TSEN2	chr3	12545283	+	ENST00000397026	PPARG	chr3	12434113	+	2450	1218	387	2255	622
ENST00000444864	TSEN2	chr3	12545283	+	ENST00000397000	PPARG	chr3	12434113	+	1876	1218	387	1574	395
ENST00000444864	TSEN2	chr3	12545283	+	ENST00000539812	PPARG	chr3	12434113	+	1876	1218	387	1574	395
ENST00000444864	TSEN2	chr3	12545283	+	ENST00000287820	PPARG	chr3	12434113	+	2467	1218	387	2255	622
ENST00000284995	TSEN2	chr3	12545283	+	ENST00000397010	PPARG	chr3	12434113	+	2455	1218	387	2255	622
ENST00000284995	TSEN2	chr3	12545283	+	ENST00000309576	PPARG	chr3	12434113	+	2455	1218	387	2255	622
ENST00000284995	TSEN2	chr3	12545283	+	ENST00000397015	PPARG	chr3	12434113	+	2422	1218	387	2255	622
ENST00000284995	TSEN2	chr3	12545283	+	ENST00000397012	PPARG	chr3	12434113	+	2455	1218	387	2255	622
ENST00000284995	TSEN2	chr3	12545283	+	ENST00000397026	PPARG	chr3	12434113	+	2450	1218	387	2255	622
ENST00000284995	TSEN2	chr3	12545283	+	ENST00000397000	PPARG	chr3	12434113	+	1876	1218	387	1574	395
ENST00000284995	TSEN2	chr3	12545283	+	ENST00000539812	PPARG	chr3	12434113	+	1876	1218	387	1574	395
ENST00000284995	TSEN2	chr3	12545283	+	ENST00000287820	PPARG	chr3	12434113	+	2467	1218	387	2255	622
ENST00000415684	TSEN2	chr3	12545283	+	ENST00000397010	PPARG	chr3	12434113	+	2089	852	21	1889	622
ENST00000415684	TSEN2	chr3	12545283	+	ENST00000309576	PPARG	chr3	12434113	+	2089	852	21	1889	622
ENST00000415684	TSEN2	chr3	12545283	+	ENST00000397015	PPARG	chr3	12434113	+	2056	852	21	1889	622
ENST00000415684	TSEN2	chr3	12545283	+	ENST00000397012	PPARG	chr3	12434113	+	2089	852	21	1889	622
ENST00000415684	TSEN2	chr3	12545283	+	ENST00000397026	PPARG	chr3	12434113	+	2084	852	21	1889	622
ENST00000415684	TSEN2	chr3	12545283	+	ENST00000397000	PPARG	chr3	12434113	+	1510	852	21	1208	395
ENST00000415684	TSEN2	chr3	12545283	+	ENST00000539812	PPARG	chr3	12434113	+	1510	852	21	1208	395
ENST00000415684	TSEN2	chr3	12545283	+	ENST00000287820	PPARG	chr3	12434113	+	2101	852	21	1889	622
ENST00000383797	TSEN2	chr3	12546730	+	ENST00000397010	PPARG	chr3	12434113	+	2238	1001	92	2038	648
ENST00000383797	TSEN2	chr3	12546730	+	ENST00000309576	PPARG	chr3	12434113	+	2238	1001	92	2038	648
ENST00000383797	TSEN2	chr3	12546730	+	ENST00000397015	PPARG	chr3	12434113	+	2205	1001	92	2038	648
ENST00000383797	TSEN2	chr3	12546730	+	ENST00000397012	PPARG	chr3	12434113	+	2238	1001	92	2038	648
ENST00000383797	TSEN2	chr3	12546730	+	ENST00000397026	PPARG	chr3	12434113	+	2233	1001	92	2038	648
ENST00000383797	TSEN2	chr3	12546730	+	ENST00000397000	PPARG	chr3	12434113	+	1659	1001	92	1357	421
ENST00000383797	TSEN2	chr3	12546730	+	ENST00000539812	PPARG	chr3	12434113	+	1659	1001	92	1357	421
ENST00000383797	TSEN2	chr3	12546730	+	ENST00000287820	PPARG	chr3	12434113	+	2250	1001	92	2038	648
ENST00000454502	TSEN2	chr3	12546730	+	ENST00000397010	PPARG	chr3	12434113	+	2061	824	92	1861	589
ENST00000454502	TSEN2	chr3	12546730	+	ENST00000309576	PPARG	chr3	12434113	+	2061	824	92	1861	589
ENST00000454502	TSEN2	chr3	12546730	+	ENST00000397015	PPARG	chr3	12434113	+	2028	824	92	1861	589
ENST00000454502	TSEN2	chr3	12546730	+	ENST00000397012	PPARG	chr3	12434113	+	2061	824	92	1861	589
ENST00000454502	TSEN2	chr3	12546730	+	ENST00000397026	PPARG	chr3	12434113	+	2056	824	92	1861	589
ENST00000454502	TSEN2	chr3	12546730	+	ENST00000397000	PPARG	chr3	12434113	+	1482	824	92	1180	362
ENST00000454502	TSEN2	chr3	12546730	+	ENST00000539812	PPARG	chr3	12434113	+	1482	824	92	1180	362
ENST00000454502	TSEN2	chr3	12546730	+	ENST00000287820	PPARG	chr3	12434113	+	2073	824	92	1861	589
ENST00000402228	TSEN2	chr3	12546730	+	ENST00000397010	PPARG	chr3	12434113	+	2301	1064	155	2101	648
ENST00000402228	TSEN2	chr3	12546730	+	ENST00000309576	PPARG	chr3	12434113	+	2301	1064	155	2101	648
ENST00000402228	TSEN2	chr3	12546730	+	ENST00000397015	PPARG	chr3	12434113	+	2268	1064	155	2101	648
ENST00000402228	TSEN2	chr3	12546730	+	ENST00000397012	PPARG	chr3	12434113	+	2301	1064	155	2101	648
ENST00000402228	TSEN2	chr3	12546730	+	ENST00000397026	PPARG	chr3	12434113	+	2296	1064	155	2101	648
ENST00000402228	TSEN2	chr3	12546730	+	ENST00000397000	PPARG	chr3	12434113	+	1722	1064	155	1420	421
ENST00000402228	TSEN2	chr3	12546730	+	ENST00000539812	PPARG	chr3	12434113	+	1722	1064	155	1420	421
ENST00000402228	TSEN2	chr3	12546730	+	ENST00000287820	PPARG	chr3	12434113	+	2313	1064	155	2101	648
ENST00000284995	TSEN2	chr3	12546730	+	ENST00000397010	PPARG	chr3	12434113	+	2533	1296	387	2333	648
ENST00000284995	TSEN2	chr3	12546730	+	ENST00000309576	PPARG	chr3	12434113	+	2533	1296	387	2333	648
ENST00000284995	TSEN2	chr3	12546730	+	ENST00000397015	PPARG	chr3	12434113	+	2500	1296	387	2333	648
ENST00000284995	TSEN2	chr3	12546730	+	ENST00000397012	PPARG	chr3	12434113	+	2533	1296	387	2333	648
ENST00000284995	TSEN2	chr3	12546730	+	ENST00000397026	PPARG	chr3	12434113	+	2528	1296	387	2333	648
ENST00000284995	TSEN2	chr3	12546730	+	ENST00000397000	PPARG	chr3	12434113	+	1954	1296	387	1652	421
ENST00000284995	TSEN2	chr3	12546730	+	ENST00000539812	PPARG	chr3	12434113	+	1954	1296	387	1652	421
ENST00000284995	TSEN2	chr3	12546730	+	ENST00000287820	PPARG	chr3	12434113	+	2545	1296	387	2333	648

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000314571	ENST00000397010	TSEN2	chr3	12545283	+	PPARG	chr3	12434113	+	0.001842679	0.9981573
ENST00000314571	ENST00000309576	TSEN2	chr3	12545283	+	PPARG	chr3	12434113	+	0.001842679	0.9981573
ENST00000314571	ENST00000397015	TSEN2	chr3	12545283	+	PPARG	chr3	12434113	+	0.002016344	0.9979837
ENST00000314571	ENST00000397012	TSEN2	chr3	12545283	+	PPARG	chr3	12434113	+	0.001842679	0.9981573
ENST00000314571	ENST00000397026	TSEN2	chr3	12545283	+	PPARG	chr3	12434113	+	0.001841643	0.9981584
ENST00000314571	ENST00000397000	TSEN2	chr3	12545283	+	PPARG	chr3	12434113	+	0.002375507	0.99762446
ENST00000314571	ENST00000539812	TSEN2	chr3	12545283	+	PPARG	chr3	12434113	+	0.002375507	0.99762446
ENST00000314571	ENST00000287820	TSEN2	chr3	12545283	+	PPARG	chr3	12434113	+	0.001789262	0.9982108
ENST00000383797	ENST00000397010	TSEN2	chr3	12545283	+	PPARG	chr3	12434113	+	0.001832074	0.9981679
ENST00000383797	ENST00000309576	TSEN2	chr3	12545283	+	PPARG	chr3	12434113	+	0.001832074	0.9981679
ENST00000383797	ENST00000397015	TSEN2	chr3	12545283	+	PPARG	chr3	12434113	+	0.002010897	0.99798906
ENST00000383797	ENST00000397012	TSEN2	chr3	12545283	+	PPARG	chr3	12434113	+	0.001832074	0.9981679
ENST00000383797	ENST00000397026	TSEN2	chr3	12545283	+	PPARG	chr3	12434113	+	0.001831676	0.99816835
ENST00000383797	ENST00000397000	TSEN2	chr3	12545283	+	PPARG	chr3	12434113	+	0.002455072	0.99754494
ENST00000383797	ENST00000539812	TSEN2	chr3	12545283	+	PPARG	chr3	12434113	+	0.002455072	0.99754494
ENST00000383797	ENST00000287820	TSEN2	chr3	12545283	+	PPARG	chr3	12434113	+	0.001783013	0.9982169
ENST00000454502	ENST00000397010	TSEN2	chr3	12545283	+	PPARG	chr3	12434113	+	0.001725917	0.9982741
ENST00000454502	ENST00000309576	TSEN2	chr3	12545283	+	PPARG	chr3	12434113	+	0.001725917	0.9982741
ENST00000454502	ENST00000397015	TSEN2	chr3	12545283	+	PPARG	chr3	12434113	+	0.001879221	0.9981207
ENST00000454502	ENST00000397012	TSEN2	chr3	12545283	+	PPARG	chr3	12434113	+	0.001725917	0.9982741
ENST00000454502	ENST00000397026	TSEN2	chr3	12545283	+	PPARG	chr3	12434113	+	0.001725521	0.99827445
ENST00000454502	ENST00000397000	TSEN2	chr3	12545283	+	PPARG	chr3	12434113	+	0.002542663	0.9974573
ENST00000454502	ENST00000539812	TSEN2	chr3	12545283	+	PPARG	chr3	12434113	+	0.002542663	0.9974573
ENST00000454502	ENST00000287820	TSEN2	chr3	12545283	+	PPARG	chr3	12434113	+	0.00167958	0.9983204
ENST00000402228	ENST00000397010	TSEN2	chr3	12545283	+	PPARG	chr3	12434113	+	0.00200842	0.99799156
ENST00000402228	ENST00000309576	TSEN2	chr3	12545283	+	PPARG	chr3	12434113	+	0.00200842	0.99799156
ENST00000402228	ENST00000397015	TSEN2	chr3	12545283	+	PPARG	chr3	12434113	+	0.002288477	0.99771154
ENST00000402228	ENST00000397012	TSEN2	chr3	12545283	+	PPARG	chr3	12434113	+	0.00200842	0.99799156
ENST00000402228	ENST00000397026	TSEN2	chr3	12545283	+	PPARG	chr3	12434113	+	0.002011302	0.9979887
ENST00000402228	ENST00000397000	TSEN2	chr3	12545283	+	PPARG	chr3	12434113	+	0.0035428	0.99645716
ENST00000402228	ENST00000539812	TSEN2	chr3	12545283	+	PPARG	chr3	12434113	+	0.0035428	0.99645716
ENST00000402228	ENST00000287820	TSEN2	chr3	12545283	+	PPARG	chr3	12434113	+	0.001963886	0.9980361
ENST00000444864	ENST00000397010	TSEN2	chr3	12545283	+	PPARG	chr3	12434113	+	0.001653088	0.9983469
ENST00000444864	ENST00000309576	TSEN2	chr3	12545283	+	PPARG	chr3	12434113	+	0.001653088	0.9983469
ENST00000444864	ENST00000397015	TSEN2	chr3	12545283	+	PPARG	chr3	12434113	+	0.001933794	0.99806625
ENST00000444864	ENST00000397012	TSEN2	chr3	12545283	+	PPARG	chr3	12434113	+	0.001653088	0.9983469
ENST00000444864	ENST00000397026	TSEN2	chr3	12545283	+	PPARG	chr3	12434113	+	0.001652474	0.9983475
ENST00000444864	ENST00000397000	TSEN2	chr3	12545283	+	PPARG	chr3	12434113	+	0.003118212	0.99688184
ENST00000444864	ENST00000539812	TSEN2	chr3	12545283	+	PPARG	chr3	12434113	+	0.003118212	0.99688184
ENST00000444864	ENST00000287820	TSEN2	chr3	12545283	+	PPARG	chr3	12434113	+	0.001628298	0.9983718
ENST00000284995	ENST00000397010	TSEN2	chr3	12545283	+	PPARG	chr3	12434113	+	0.001653088	0.9983469
ENST00000284995	ENST00000309576	TSEN2	chr3	12545283	+	PPARG	chr3	12434113	+	0.001653088	0.9983469
ENST00000284995	ENST00000397015	TSEN2	chr3	12545283	+	PPARG	chr3	12434113	+	0.001933794	0.99806625
ENST00000284995	ENST00000397012	TSEN2	chr3	12545283	+	PPARG	chr3	12434113	+	0.001653088	0.9983469
ENST00000284995	ENST00000397026	TSEN2	chr3	12545283	+	PPARG	chr3	12434113	+	0.001652474	0.9983475
ENST00000284995	ENST00000397000	TSEN2	chr3	12545283	+	PPARG	chr3	12434113	+	0.003118212	0.99688184
ENST00000284995	ENST00000539812	TSEN2	chr3	12545283	+	PPARG	chr3	12434113	+	0.003118212	0.99688184
ENST00000284995	ENST00000287820	TSEN2	chr3	12545283	+	PPARG	chr3	12434113	+	0.001628298	0.9983718
ENST00000415684	ENST00000397010	TSEN2	chr3	12545283	+	PPARG	chr3	12434113	+	0.001947193	0.99805284
ENST00000415684	ENST00000309576	TSEN2	chr3	12545283	+	PPARG	chr3	12434113	+	0.001947193	0.99805284
ENST00000415684	ENST00000397015	TSEN2	chr3	12545283	+	PPARG	chr3	12434113	+	0.002092973	0.99790704
ENST00000415684	ENST00000397012	TSEN2	chr3	12545283	+	PPARG	chr3	12434113	+	0.001947193	0.99805284
ENST00000415684	ENST00000397026	TSEN2	chr3	12545283	+	PPARG	chr3	12434113	+	0.001955493	0.9980445
ENST00000415684	ENST00000397000	TSEN2	chr3	12545283	+	PPARG	chr3	12434113	+	0.002670701	0.99732935
ENST00000415684	ENST00000539812	TSEN2	chr3	12545283	+	PPARG	chr3	12434113	+	0.002670701	0.99732935
ENST00000415684	ENST00000287820	TSEN2	chr3	12545283	+	PPARG	chr3	12434113	+	0.001890786	0.9981092
ENST00000383797	ENST00000397010	TSEN2	chr3	12546730	+	PPARG	chr3	12434113	+	0.002612515	0.99738747
ENST00000383797	ENST00000309576	TSEN2	chr3	12546730	+	PPARG	chr3	12434113	+	0.002612515	0.99738747
ENST00000383797	ENST00000397015	TSEN2	chr3	12546730	+	PPARG	chr3	12434113	+	0.002931271	0.9970687
ENST00000383797	ENST00000397012	TSEN2	chr3	12546730	+	PPARG	chr3	12434113	+	0.002612515	0.99738747
ENST00000383797	ENST00000397026	TSEN2	chr3	12546730	+	PPARG	chr3	12434113	+	0.002597264	0.9974027
ENST00000383797	ENST00000397000	TSEN2	chr3	12546730	+	PPARG	chr3	12434113	+	0.002563868	0.9974361
ENST00000383797	ENST00000539812	TSEN2	chr3	12546730	+	PPARG	chr3	12434113	+	0.002563868	0.9974361
ENST00000383797	ENST00000287820	TSEN2	chr3	12546730	+	PPARG	chr3	12434113	+	0.002543924	0.99745613
ENST00000454502	ENST00000397010	TSEN2	chr3	12546730	+	PPARG	chr3	12434113	+	0.001325969	0.99867404
ENST00000454502	ENST00000309576	TSEN2	chr3	12546730	+	PPARG	chr3	12434113	+	0.001325969	0.99867404
ENST00000454502	ENST00000397015	TSEN2	chr3	12546730	+	PPARG	chr3	12434113	+	0.001494112	0.99850595
ENST00000454502	ENST00000397012	TSEN2	chr3	12546730	+	PPARG	chr3	12434113	+	0.001325969	0.99867404
ENST00000454502	ENST00000397026	TSEN2	chr3	12546730	+	PPARG	chr3	12434113	+	0.001325839	0.99867415
ENST00000454502	ENST00000397000	TSEN2	chr3	12546730	+	PPARG	chr3	12434113	+	0.001858572	0.9981414
ENST00000454502	ENST00000539812	TSEN2	chr3	12546730	+	PPARG	chr3	12434113	+	0.001858572	0.9981414
ENST00000454502	ENST00000287820	TSEN2	chr3	12546730	+	PPARG	chr3	12434113	+	0.001300399	0.99869955
ENST00000402228	ENST00000397010	TSEN2	chr3	12546730	+	PPARG	chr3	12434113	+	0.002795887	0.9972042
ENST00000402228	ENST00000309576	TSEN2	chr3	12546730	+	PPARG	chr3	12434113	+	0.002795887	0.9972042
ENST00000402228	ENST00000397015	TSEN2	chr3	12546730	+	PPARG	chr3	12434113	+	0.003187927	0.99681205
ENST00000402228	ENST00000397012	TSEN2	chr3	12546730	+	PPARG	chr3	12434113	+	0.002795887	0.9972042
ENST00000402228	ENST00000397026	TSEN2	chr3	12546730	+	PPARG	chr3	12434113	+	0.002800701	0.9971993
ENST00000402228	ENST00000397000	TSEN2	chr3	12546730	+	PPARG	chr3	12434113	+	0.003497216	0.99650276
ENST00000402228	ENST00000539812	TSEN2	chr3	12546730	+	PPARG	chr3	12434113	+	0.003497216	0.99650276
ENST00000402228	ENST00000287820	TSEN2	chr3	12546730	+	PPARG	chr3	12434113	+	0.002738752	0.9972613
ENST00000284995	ENST00000397010	TSEN2	chr3	12546730	+	PPARG	chr3	12434113	+	0.002314351	0.9976857
ENST00000284995	ENST00000309576	TSEN2	chr3	12546730	+	PPARG	chr3	12434113	+	0.002314351	0.9976857
ENST00000284995	ENST00000397015	TSEN2	chr3	12546730	+	PPARG	chr3	12434113	+	0.002715729	0.9972843
ENST00000284995	ENST00000397012	TSEN2	chr3	12546730	+	PPARG	chr3	12434113	+	0.002314351	0.9976857
ENST00000284995	ENST00000397026	TSEN2	chr3	12546730	+	PPARG	chr3	12434113	+	0.002309455	0.99769056
ENST00000284995	ENST00000397000	TSEN2	chr3	12546730	+	PPARG	chr3	12434113	+	0.003123964	0.996876
ENST00000284995	ENST00000539812	TSEN2	chr3	12546730	+	PPARG	chr3	12434113	+	0.003123964	0.996876
ENST00000284995	ENST00000287820	TSEN2	chr3	12546730	+	PPARG	chr3	12434113	+	0.002278186	0.99772185

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for TSEN2-PPARG

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
TSEN2	chr3	12545283	PPARG	chr3	12434113	1218	277	CAMSEREAAPNEEGFFRRTIRLKLIY
TSEN2	chr3	12545283	PPARG	chr3	12434113	746	218	CAMSEREAAPNEEGFFRRTIRLKLIY
TSEN2	chr3	12545283	PPARG	chr3	12434113	852	277	CAMSEREAAPNEEGFFRRTIRLKLIY
TSEN2	chr3	12545283	PPARG	chr3	12434113	923	277	CAMSEREAAPNEEGFFRRTIRLKLIY
TSEN2	chr3	12545283	PPARG	chr3	12434113	934	277	CAMSEREAAPNEEGFFRRTIRLKLIY
TSEN2	chr3	12545283	PPARG	chr3	12434113	986	277	CAMSEREAAPNEEGFFRRTIRLKLIY
TSEN2	chr3	12546730	PPARG	chr3	12434113	1001	303	YRIFEYLQLSLEEGFFRRTIRLKLIY
TSEN2	chr3	12546730	PPARG	chr3	12434113	1064	303	YRIFEYLQLSLEEGFFRRTIRLKLIY
TSEN2	chr3	12546730	PPARG	chr3	12434113	1296	303	YRIFEYLQLSLEEGFFRRTIRLKLIY
TSEN2	chr3	12546730	PPARG	chr3	12434113	824	244	YRIFEYLQLSLEEGFFRRTIRLKLIY

Top

Potential FusionNeoAntigen Information of TSEN2-PPARG in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

TSEN2-PPARG_12545283_12434113.msa
TSEN2-PPARG_12546730_12434113.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
TSEN2-PPARG	chr3	12545283	chr3	12434113	1218	HLA-B35:08	EAAPNEEGF	0.9605	0.8198	6	15
TSEN2-PPARG	chr3	12545283	chr3	12434113	1218	HLA-B35:01	EAAPNEEGF	0.9156	0.8547	6	15
TSEN2-PPARG	chr3	12545283	chr3	12434113	1218	HLA-B35:03	EAAPNEEGF	0.7815	0.8553	6	15
TSEN2-PPARG	chr3	12545283	chr3	12434113	1218	HLA-B35:02	EAAPNEEGF	0.3962	0.9176	6	15
TSEN2-PPARG	chr3	12545283	chr3	12434113	1218	HLA-B35:04	EAAPNEEGF	0.3962	0.9176	6	15
TSEN2-PPARG	chr3	12545283	chr3	12434113	1218	HLA-B44:03	REAAPNEEGF	0.9807	0.841	5	15
TSEN2-PPARG	chr3	12545283	chr3	12434113	1218	HLA-B44:03	REAAPNEEGFF	0.9787	0.8645	5	16
TSEN2-PPARG	chr3	12545283	chr3	12434113	1218	HLA-B35:12	EAAPNEEGF	0.3962	0.9176	6	15
TSEN2-PPARG	chr3	12545283	chr3	12434113	1218	HLA-B39:08	REAAPNEEGF	0.9294	0.8467	5	15
TSEN2-PPARG	chr3	12545283	chr3	12434113	1218	HLA-A25:01	EAAPNEEGF	0.9675	0.851	6	15
TSEN2-PPARG	chr3	12545283	chr3	12434113	1218	HLA-B35:77	EAAPNEEGF	0.9156	0.8547	6	15
TSEN2-PPARG	chr3	12545283	chr3	12434113	1218	HLA-B35:23	EAAPNEEGF	0.9059	0.8502	6	15
TSEN2-PPARG	chr3	12545283	chr3	12434113	1218	HLA-B35:11	EAAPNEEGF	0.8692	0.9048	6	15
TSEN2-PPARG	chr3	12545283	chr3	12434113	1218	HLA-B35:24	EAAPNEEGF	0.7585	0.9037	6	15
TSEN2-PPARG	chr3	12545283	chr3	12434113	1218	HLA-B35:09	EAAPNEEGF	0.3962	0.9176	6	15
TSEN2-PPARG	chr3	12545283	chr3	12434113	1218	HLA-B15:08	EAAPNEEGF	0.2931	0.7129	6	15
TSEN2-PPARG	chr3	12545283	chr3	12434113	1218	HLA-B15:11	EAAPNEEGF	0.279	0.7006	6	15
TSEN2-PPARG	chr3	12545283	chr3	12434113	1218	HLA-B35:43	EAAPNEEGF	0.2667	0.7299	6	15
TSEN2-PPARG	chr3	12545283	chr3	12434113	1218	HLA-B15:53	REAAPNEEGF	0.9902	0.7551	5	15
TSEN2-PPARG	chr3	12545283	chr3	12434113	1218	HLA-B44:07	REAAPNEEGF	0.9807	0.841	5	15
TSEN2-PPARG	chr3	12545283	chr3	12434113	1218	HLA-B44:26	REAAPNEEGF	0.9807	0.841	5	15
TSEN2-PPARG	chr3	12545283	chr3	12434113	1218	HLA-B44:13	REAAPNEEGF	0.9807	0.841	5	15
TSEN2-PPARG	chr3	12545283	chr3	12434113	1218	HLA-B40:04	REAAPNEEGF	0.9769	0.6256	5	15
TSEN2-PPARG	chr3	12545283	chr3	12434113	1218	HLA-B48:02	REAAPNEEGF	0.9088	0.9093	5	15
TSEN2-PPARG	chr3	12545283	chr3	12434113	1218	HLA-B41:03	REAAPNEEGF	0.8045	0.5567	5	15
TSEN2-PPARG	chr3	12545283	chr3	12434113	1218	HLA-B40:04	REAAPNEEGFF	0.9978	0.6506	5	16
TSEN2-PPARG	chr3	12545283	chr3	12434113	1218	HLA-B44:13	REAAPNEEGFF	0.9787	0.8645	5	16
TSEN2-PPARG	chr3	12545283	chr3	12434113	1218	HLA-B44:26	REAAPNEEGFF	0.9787	0.8645	5	16
TSEN2-PPARG	chr3	12545283	chr3	12434113	1218	HLA-B44:07	REAAPNEEGFF	0.9787	0.8645	5	16
TSEN2-PPARG	chr3	12545283	chr3	12434113	1218	HLA-B41:03	REAAPNEEGFF	0.9452	0.5281	5	16
TSEN2-PPARG	chr3	12546730	chr3	12434113	1296	HLA-B44:03	EEGFFRRTI	0.9902	0.9559	11	20
TSEN2-PPARG	chr3	12546730	chr3	12434113	1296	HLA-A74:09	SLEEGFFRR	0.9089	0.5907	9	18
TSEN2-PPARG	chr3	12546730	chr3	12434113	1296	HLA-A74:11	SLEEGFFRR	0.9089	0.5907	9	18
TSEN2-PPARG	chr3	12546730	chr3	12434113	1296	HLA-A74:03	SLEEGFFRR	0.9089	0.5907	9	18
TSEN2-PPARG	chr3	12546730	chr3	12434113	1296	HLA-A31:02	SLEEGFFRR	0.7972	0.5465	9	18
TSEN2-PPARG	chr3	12546730	chr3	12434113	1296	HLA-B13:01	LQLSLEEGF	0.3985	0.9924	6	15
TSEN2-PPARG	chr3	12546730	chr3	12434113	1296	HLA-A24:25	EYLQLSLEEGF	0.999	0.6162	4	15
TSEN2-PPARG	chr3	12546730	chr3	12434113	1296	HLA-A24:20	EYLQLSLEEGF	0.9988	0.6107	4	15
TSEN2-PPARG	chr3	12546730	chr3	12434113	1296	HLA-A24:15	EYLQLSLEEGF	0.9987	0.6229	4	15
TSEN2-PPARG	chr3	12546730	chr3	12434113	1296	HLA-A24:31	EYLQLSLEEGF	0.9986	0.5861	4	15
TSEN2-PPARG	chr3	12546730	chr3	12434113	1296	HLA-B15:05	LQLSLEEGF	0.5674	0.9612	6	15
TSEN2-PPARG	chr3	12546730	chr3	12434113	1296	HLA-A24:02	EYLQLSLEEGF	0.9988	0.6107	4	15
TSEN2-PPARG	chr3	12546730	chr3	12434113	1296	HLA-B44:07	EEGFFRRTI	0.9902	0.9559	11	20
TSEN2-PPARG	chr3	12546730	chr3	12434113	1296	HLA-B44:13	EEGFFRRTI	0.9902	0.9559	11	20
TSEN2-PPARG	chr3	12546730	chr3	12434113	1296	HLA-B44:26	EEGFFRRTI	0.9902	0.9559	11	20
TSEN2-PPARG	chr3	12546730	chr3	12434113	1296	HLA-B15:24	LQLSLEEGF	0.963	0.9306	6	15
TSEN2-PPARG	chr3	12546730	chr3	12434113	1296	HLA-A74:01	SLEEGFFRR	0.9089	0.5907	9	18
TSEN2-PPARG	chr3	12546730	chr3	12434113	1296	HLA-B18:03	EEGFFRRTI	0.773	0.934	11	20
TSEN2-PPARG	chr3	12546730	chr3	12434113	1296	HLA-B15:20	LQLSLEEGF	0.5708	0.9712	6	15
TSEN2-PPARG	chr3	12546730	chr3	12434113	1296	HLA-B35:28	LQLSLEEGF	0.5243	0.9729	6	15
TSEN2-PPARG	chr3	12546730	chr3	12434113	1296	HLA-B48:02	LQLSLEEGF	0.2592	0.9689	6	15

Top

Potential FusionNeoAntigen Information of TSEN2-PPARG in HLA II

TSEN2-PPARG_12545283_12434113.msa
TSEN2-PPARG_12546730_12434113.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
TSEN2-PPARG	chr3	12545283	chr3	12434113	1218	DRB1-1407	EEGFFRRTIRLKLIY	11	26
TSEN2-PPARG	chr3	12545283	chr3	12434113	1218	DRB1-1407	NEEGFFRRTIRLKLI	10	25
TSEN2-PPARG	chr3	12545283	chr3	12434113	1218	DRB1-1442	EEGFFRRTIRLKLIY	11	26
TSEN2-PPARG	chr3	12546730	chr3	12434113	1296	DRB1-1407	EEGFFRRTIRLKLIY	11	26
TSEN2-PPARG	chr3	12546730	chr3	12434113	1296	DRB1-1407	LEEGFFRRTIRLKLI	10	25
TSEN2-PPARG	chr3	12546730	chr3	12434113	1296	DRB1-1442	EEGFFRRTIRLKLIY	11	26

Top

Fusion breakpoint peptide structures of TSEN2-PPARG

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
1505	EAAPNEEGFFRRTI	TSEN2	PPARG	chr3	12545283	chr3	12434113	1218

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
5466	LQLSLEEGFFRRTI	TSEN2	PPARG	chr3	12546730	chr3	12434113	1296

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of TSEN2-PPARG

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	1505	EAAPNEEGFFRRTI	-5.97838	-6.17038
HLA-B14:02	3BVN	1505	EAAPNEEGFFRRTI	-5.11598	-5.87698
HLA-B52:01	3W39	1505	EAAPNEEGFFRRTI	-6.32933	-6.52133
HLA-B52:01	3W39	1505	EAAPNEEGFFRRTI	-4.64746	-5.40846
HLA-A11:01	4UQ2	1505	EAAPNEEGFFRRTI	-9.33363	-9.52563
HLA-A11:01	4UQ2	1505	EAAPNEEGFFRRTI	-7.32423	-8.08523
HLA-A24:02	5HGA	1505	EAAPNEEGFFRRTI	-8.6321	-8.8241
HLA-A24:02	5HGA	1505	EAAPNEEGFFRRTI	-4.97839	-5.73939
HLA-B44:05	3DX8	1505	EAAPNEEGFFRRTI	-5.12105	-5.31305
HLA-B44:05	3DX8	1505	EAAPNEEGFFRRTI	-4.87756	-5.63856
HLA-A02:01	6TDR	1505	EAAPNEEGFFRRTI	-6.14766	-6.33966
HLA-B14:02	3BVN	5466	LQLSLEEGFFRRTI	-6.00367	-7.03897
HLA-B14:02	3BVN	5466	LQLSLEEGFFRRTI	-5.39279	-5.50619
HLA-B52:01	3W39	5466	LQLSLEEGFFRRTI	-6.37513	-6.48853
HLA-B52:01	3W39	5466	LQLSLEEGFFRRTI	-5.71942	-6.75472
HLA-A11:01	4UQ2	5466	LQLSLEEGFFRRTI	-11.5708	-11.6842
HLA-A11:01	4UQ2	5466	LQLSLEEGFFRRTI	-8.11091	-9.14621
HLA-A24:02	5HGA	5466	LQLSLEEGFFRRTI	-6.75661	-6.87001
HLA-A24:02	5HGA	5466	LQLSLEEGFFRRTI	-5.30147	-6.33677
HLA-B27:05	6PYJ	5466	LQLSLEEGFFRRTI	-4.27108	-5.30638
HLA-B44:05	3DX8	5466	LQLSLEEGFFRRTI	-6.47731	-6.59071
HLA-B44:05	3DX8	5466	LQLSLEEGFFRRTI	-3.23433	-4.26963

Top

Vaccine Design for the FusionNeoAntigens of TSEN2-PPARG

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
TSEN2-PPARG	chr3	12545283	chr3	12434113	5	15	REAAPNEEGF	AGGGAGGCTGCCCCAAATGAGGAAGGTTTC
TSEN2-PPARG	chr3	12545283	chr3	12434113	5	16	REAAPNEEGFF	AGGGAGGCTGCCCCAAATGAGGAAGGTTTCTTC
TSEN2-PPARG	chr3	12545283	chr3	12434113	6	15	EAAPNEEGF	GAGGCTGCCCCAAATGAGGAAGGTTTC
TSEN2-PPARG	chr3	12546730	chr3	12434113	11	20	EEGFFRRTI	GAAGAGGGTTTCTTCCGGAGAACAATC
TSEN2-PPARG	chr3	12546730	chr3	12434113	4	15	EYLQLSLEEGF	GAGTATTTGCAACTCAGCCTAGAAGAGGGTTTC
TSEN2-PPARG	chr3	12546730	chr3	12434113	6	15	LQLSLEEGF	TTGCAACTCAGCCTAGAAGAGGGTTTC
TSEN2-PPARG	chr3	12546730	chr3	12434113	9	18	SLEEGFFRR	AGCCTAGAAGAGGGTTTCTTCCGGAGA

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
TSEN2-PPARG	chr3	12545283	chr3	12434113	10	25	NEEGFFRRTIRLKLI	AATGAGGAAGGTTTCTTCCGGAGAACAATCAGATTGAAGCTTATC
TSEN2-PPARG	chr3	12545283	chr3	12434113	11	26	EEGFFRRTIRLKLIY	GAGGAAGGTTTCTTCCGGAGAACAATCAGATTGAAGCTTATCTAT
TSEN2-PPARG	chr3	12546730	chr3	12434113	10	25	LEEGFFRRTIRLKLI	CTAGAAGAGGGTTTCTTCCGGAGAACAATCAGATTGAAGCTTATC
TSEN2-PPARG	chr3	12546730	chr3	12434113	11	26	EEGFFRRTIRLKLIY	GAAGAGGGTTTCTTCCGGAGAACAATCAGATTGAAGCTTATCTAT

Top

Information of the samples that have these potential fusion neoantigens of TSEN2-PPARG

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
BLCA	TSEN2-PPARG	chr3	12545283	ENST00000284995	chr3	12434113	ENST00000287820	TCGA-BL-A13J-01A
BLCA	TSEN2-PPARG	chr3	12546730	ENST00000284995	chr3	12434113	ENST00000287820	TCGA-BL-A13J-01A

Top

Potential target of CAR-T therapy development for TSEN2-PPARG

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to TSEN2-PPARG

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to TSEN2-PPARG

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner	Gene	Disease ID	Disease name	# pubmeds	Source
Tgene	PPARG	C0011860	Diabetes Mellitus, Non-Insulin-Dependent	6	CTD_human;GENOMICS_ENGLAND
Tgene	PPARG	C0238463	Papillary thyroid carcinoma	4	ORPHANET
Tgene	PPARG	C0002152	Alloxan Diabetes	3	CTD_human
Tgene	PPARG	C0002395	Alzheimer's Disease	3	CTD_human
Tgene	PPARG	C0011265	Presenile dementia	3	CTD_human
Tgene	PPARG	C0011853	Diabetes Mellitus, Experimental	3	CTD_human
Tgene	PPARG	C0020538	Hypertensive disease	3	CTD_human
Tgene	PPARG	C0021655	Insulin Resistance	3	CTD_human
Tgene	PPARG	C0022660	Kidney Failure, Acute	3	CTD_human
Tgene	PPARG	C0028754	Obesity	3	CTD_human;GENOMICS_ENGLAND;UNIPROT
Tgene	PPARG	C0035126	Reperfusion Injury	3	CTD_human
Tgene	PPARG	C0038433	Streptozotocin Diabetes	3	CTD_human
Tgene	PPARG	C0276496	Familial Alzheimer Disease (FAD)	3	CTD_human
Tgene	PPARG	C0494463	Alzheimer Disease, Late Onset	3	CTD_human
Tgene	PPARG	C0546126	Acute Confusional Senile Dementia	3	CTD_human
Tgene	PPARG	C0750900	Alzheimer's Disease, Focal Onset	3	CTD_human
Tgene	PPARG	C0750901	Alzheimer Disease, Early Onset	3	CTD_human
Tgene	PPARG	C0920563	Insulin Sensitivity	3	CTD_human
Tgene	PPARG	C1565662	Acute Kidney Insufficiency	3	CTD_human
Tgene	PPARG	C1720861	Familial Partial Lipodystrophy, Type 3	3	CTD_human;GENOMICS_ENGLAND;ORPHANET;UNIPROT
Tgene	PPARG	C2609414	Acute kidney injury	3	CTD_human
Tgene	PPARG	C0021368	Inflammation	2	CTD_human
Tgene	PPARG	C0022116	Ischemia	2	CTD_human
Tgene	PPARG	C0024623	Malignant neoplasm of stomach	2	CTD_human
Tgene	PPARG	C0025202	melanoma	2	CTD_human
Tgene	PPARG	C0030297	Pancreatic Neoplasm	2	CTD_human
Tgene	PPARG	C0038356	Stomach Neoplasms	2	CTD_human
Tgene	PPARG	C0346647	Malignant neoplasm of pancreas	2	CTD_human
Tgene	PPARG	C1708349	Hereditary Diffuse Gastric Cancer	2	CTD_human
Tgene	PPARG	C0001418	Adenocarcinoma	1	CTD_human
Tgene	PPARG	C0004153	Atherosclerosis	1	CTD_human
Tgene	PPARG	C0004763	Barrett Esophagus	1	CTD_human
Tgene	PPARG	C0007102	Malignant tumor of colon	1	CTD_human;UNIPROT
Tgene	PPARG	C0009375	Colonic Neoplasms	1	CTD_human
Tgene	PPARG	C0009402	Colorectal Carcinoma	1	CTD_human
Tgene	PPARG	C0009404	Colorectal Neoplasms	1	CTD_human
Tgene	PPARG	C0010346	Crohn Disease	1	CTD_human
Tgene	PPARG	C0011849	Diabetes Mellitus	1	CTD_human
Tgene	PPARG	C0011859	Lipoatrophic Diabetes Mellitus	1	ORPHANET
Tgene	PPARG	C0011881	Diabetic Nephropathy	1	CTD_human
Tgene	PPARG	C0017658	Glomerulonephritis	1	CTD_human
Tgene	PPARG	C0017667	Nodular glomerulosclerosis	1	CTD_human
Tgene	PPARG	C0018801	Heart failure	1	CTD_human
Tgene	PPARG	C0018802	Congestive heart failure	1	CTD_human
Tgene	PPARG	C0023212	Left-Sided Heart Failure	1	CTD_human
Tgene	PPARG	C0023645	Lichen planus follicularis	1	GENOMICS_ENGLAND
Tgene	PPARG	C0023794	Lipoidosis	1	CTD_human
Tgene	PPARG	C0023903	Liver neoplasms	1	CTD_human
Tgene	PPARG	C0025517	Metabolic Diseases	1	CTD_human
Tgene	PPARG	C0027746	Nerve Degeneration	1	CTD_human
Tgene	PPARG	C0029408	Degenerative polyarthritis	1	CTD_human
Tgene	PPARG	C0030246	Pustulosis of Palms and Soles	1	CTD_human
Tgene	PPARG	C0030625	Passive Cutaneous Anaphylaxis	1	GENOMICS_ENGLAND
Tgene	PPARG	C0033860	Psoriasis	1	CTD_human
Tgene	PPARG	C0035078	Kidney Failure	1	CTD_human
Tgene	PPARG	C0038525	Subarachnoid Hemorrhage	1	CTD_human
Tgene	PPARG	C0040136	Thyroid Neoplasm	1	CTD_human
Tgene	PPARG	C0079772	T-Cell Lymphoma	1	CTD_human
Tgene	PPARG	C0085278	Antiphospholipid Syndrome	1	CTD_human
Tgene	PPARG	C0085413	Polycystic Kidney, Autosomal Dominant	1	CTD_human
Tgene	PPARG	C0086743	Osteoarthrosis Deformans	1	CTD_human
Tgene	PPARG	C0086873	Pseudopelade	1	GENOMICS_ENGLAND
Tgene	PPARG	C0151468	Thyroid Gland Follicular Adenoma	1	CTD_human
Tgene	PPARG	C0156147	Crohn's disease of large bowel	1	CTD_human
Tgene	PPARG	C0205641	Adenocarcinoma, Basal Cell	1	CTD_human
Tgene	PPARG	C0205642	Adenocarcinoma, Oxyphilic	1	CTD_human
Tgene	PPARG	C0205643	Carcinoma, Cribriform	1	CTD_human
Tgene	PPARG	C0205644	Carcinoma, Granular Cell	1	CTD_human
Tgene	PPARG	C0205645	Adenocarcinoma, Tubular	1	CTD_human
Tgene	PPARG	C0206726	gliosarcoma	1	ORPHANET
Tgene	PPARG	C0221032	Familial generalized lipodystrophy	1	ORPHANET
Tgene	PPARG	C0221406	Pituitary-dependent Cushing's disease	1	CTD_human
Tgene	PPARG	C0235527	Heart Failure, Right-Sided	1	CTD_human
Tgene	PPARG	C0236811	Chronobiology Disorders	1	CTD_human
Tgene	PPARG	C0242339	Dyslipidemias	1	CTD_human
Tgene	PPARG	C0242488	Acute Lung Injury	1	CTD_human
Tgene	PPARG	C0267380	Crohn's disease of the ileum	1	CTD_human
Tgene	PPARG	C0270192	Perinatal Subarachnoid Hemorrhage	1	CTD_human
Tgene	PPARG	C0271694	Familial partial lipodystrophy	1	CTD_human
Tgene	PPARG	C0282548	Leukostasis	1	CTD_human
Tgene	PPARG	C0334588	Giant Cell Glioblastoma	1	ORPHANET
Tgene	PPARG	C0345904	Malignant neoplasm of liver	1	CTD_human
Tgene	PPARG	C0472383	Subarachnoid Hemorrhage, Spontaneous	1	CTD_human
Tgene	PPARG	C0525045	Mood Disorders	1	PSYGENET
Tgene	PPARG	C0549473	Thyroid carcinoma	1	CTD_human
Tgene	PPARG	C0598784	Dyslipoproteinemias	1	CTD_human
Tgene	PPARG	C0678202	Regional enteritis	1	CTD_human
Tgene	PPARG	C0751220	Inappropriate ACTH Secretion Syndrome	1	CTD_human
Tgene	PPARG	C0751530	Subarachnoid Hemorrhage, Aneurysmal	1	CTD_human
Tgene	PPARG	C0795688	Subarachnoid Hemorrhage, Intracranial	1	CTD_human
Tgene	PPARG	C0813142	Circadian Rhythm Disorders	1	CTD_human
Tgene	PPARG	C0887800	Psychogenic Inversion of Circadian Rhythm	1	CTD_human
Tgene	PPARG	C0887850	Polycystic Kidney, Type 1 Autosomal Dominant Disease	1	CTD_human
Tgene	PPARG	C0949272	IIeocolitis	1	CTD_human
Tgene	PPARG	C1258085	Barrett Epithelium	1	CTD_human
Tgene	PPARG	C1563937	Atherogenesis	1	CTD_human
Tgene	PPARG	C1565489	Renal Insufficiency	1	CTD_human
Tgene	PPARG	C1704377	Bright Disease	1	CTD_human
Tgene	PPARG	C1720859	Familial Partial Lipodystrophy, Type 1	1	CTD_human
Tgene	PPARG	C1720860	Familial Partial Lipodystrophy, Type 2	1	CTD_human
Tgene	PPARG	C1959583	Myocardial Failure	1	CTD_human
Tgene	PPARG	C1961112	Heart Decompensation	1	CTD_human
Tgene	PPARG	C2239176	Liver carcinoma	1	CTD_human
Tgene	PPARG	C2751306	Polycystic kidney disease, type 2	1	CTD_human
Tgene	PPARG	C2931367	Thyroid cancer, follicular	1	CTD_human
Tgene	PPARG	C2936846	Scarring alopecia	1	GENOMICS_ENGLAND

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)