Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:TSFM-CPM

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: TSFM-CPM
	FusionPDB ID: 94547
	FusionGDB2.0 ID: 94547
		Hgene	Tgene
	Gene symbol	TSFM	CPM
	Gene ID	10102	1368
	Gene name	Ts translation elongation factor, mitochondrial	carboxypeptidase M
	Synonyms	EFTS\|EFTSMT	-
	Cytomap	12q14.1	12q15
	Type of gene	protein-coding	protein-coding
	Description	elongation factor Ts, mitochondrialEF-TsEF-TsMtmitochondrial elongation factor Ts	carboxypeptidase Mrenal carboxypeptidaseurinary carboxypeptidase B
	Modification date	20200313	20200313
	UniProtAcc	.	P14384 Main function of 5'-partner protein: FUNCTION: Specifically removes C-terminal basic residues (Arg or Lys) from peptides and proteins. It is believed to play important roles in the control of peptide hormone and growth factor activity at the cell surface, and in the membrane-localized degradation of extracellular proteins. {ECO:0000269\|PubMed:12457462}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000497617, ENST00000323833, ENST00000350762, ENST00000454289, ENST00000543727, ENST00000548851, ENST00000550559, ENST00000540550,	ENST00000338356, ENST00000546373, ENST00000551568, ENST00000549691,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	26 X 8 X 7=1456	48 X 16 X 10=7680
	# samples	30	45
	** MAII score	log2(30/1456*10)=-2.27897594970282 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(45/7680*10)=-4.09310940439148 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: TSFM [Title/Abstract] AND CPM [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: TSFM [Title/Abstract] AND CPM [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	TSFM(58186856)-CPM(69279669), # samples:2
Anticipated loss of major functional domain due to fusion event.	TSFM-CPM seems lost the major protein functional domain in Hgene partner, which is a essential gene due to the frame-shifted ORF. TSFM-CPM seems lost the major protein functional domain in Tgene partner, which is a IUPHAR drug target due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	TSFM	GO:0070129	regulation of mitochondrial translation	27677415

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr12:58186856/chr12:69279669)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across TSFM (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across CPM (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000543727	TSFM	chr12	58186856	+	ENST00000546373	CPM	chr12	69279669	-	2480	628	6	1799	597
ENST00000543727	TSFM	chr12	58186856	+	ENST00000551568	CPM	chr12	69279669	-	7062	628	6	1799	597
ENST00000543727	TSFM	chr12	58186856	+	ENST00000338356	CPM	chr12	69279669	-	7057	628	6	1799	597
ENST00000550559	TSFM	chr12	58186856	+	ENST00000546373	CPM	chr12	69279669	-	2438	586	15	1757	580
ENST00000550559	TSFM	chr12	58186856	+	ENST00000551568	CPM	chr12	69279669	-	7020	586	15	1757	580
ENST00000550559	TSFM	chr12	58186856	+	ENST00000338356	CPM	chr12	69279669	-	7015	586	15	1757	580
ENST00000548851	TSFM	chr12	58186856	+	ENST00000546373	CPM	chr12	69279669	-	2438	586	15	1757	580
ENST00000548851	TSFM	chr12	58186856	+	ENST00000551568	CPM	chr12	69279669	-	7020	586	15	1757	580
ENST00000548851	TSFM	chr12	58186856	+	ENST00000338356	CPM	chr12	69279669	-	7015	586	15	1757	580
ENST00000454289	TSFM	chr12	58186856	+	ENST00000546373	CPM	chr12	69279669	-	2636	784	42	1955	637
ENST00000454289	TSFM	chr12	58186856	+	ENST00000551568	CPM	chr12	69279669	-	7218	784	42	1955	637
ENST00000454289	TSFM	chr12	58186856	+	ENST00000338356	CPM	chr12	69279669	-	7213	784	42	1955	637
ENST00000323833	TSFM	chr12	58186856	+	ENST00000546373	CPM	chr12	69279669	-	2512	660	26	1831	601
ENST00000323833	TSFM	chr12	58186856	+	ENST00000551568	CPM	chr12	69279669	-	7094	660	26	1831	601
ENST00000323833	TSFM	chr12	58186856	+	ENST00000338356	CPM	chr12	69279669	-	7089	660	26	1831	601
ENST00000350762	TSFM	chr12	58186856	+	ENST00000546373	CPM	chr12	69279669	-	2712	860	409	2031	540
ENST00000350762	TSFM	chr12	58186856	+	ENST00000551568	CPM	chr12	69279669	-	7294	860	409	2031	540
ENST00000350762	TSFM	chr12	58186856	+	ENST00000338356	CPM	chr12	69279669	-	7289	860	409	2031	540

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000543727	ENST00000546373	TSFM	chr12	58186856	+	CPM	chr12	69279669	-	0.000415583	0.9995844
ENST00000543727	ENST00000551568	TSFM	chr12	58186856	+	CPM	chr12	69279669	-	0.000255387	0.9997446
ENST00000543727	ENST00000338356	TSFM	chr12	58186856	+	CPM	chr12	69279669	-	0.000257288	0.9997427
ENST00000550559	ENST00000546373	TSFM	chr12	58186856	+	CPM	chr12	69279669	-	0.000428416	0.9995716
ENST00000550559	ENST00000551568	TSFM	chr12	58186856	+	CPM	chr12	69279669	-	0.000254559	0.9997454
ENST00000550559	ENST00000338356	TSFM	chr12	58186856	+	CPM	chr12	69279669	-	0.000256791	0.99974316
ENST00000548851	ENST00000546373	TSFM	chr12	58186856	+	CPM	chr12	69279669	-	0.000428416	0.9995716
ENST00000548851	ENST00000551568	TSFM	chr12	58186856	+	CPM	chr12	69279669	-	0.000254559	0.9997454
ENST00000548851	ENST00000338356	TSFM	chr12	58186856	+	CPM	chr12	69279669	-	0.000256791	0.99974316
ENST00000454289	ENST00000546373	TSFM	chr12	58186856	+	CPM	chr12	69279669	-	0.001304059	0.9986959
ENST00000454289	ENST00000551568	TSFM	chr12	58186856	+	CPM	chr12	69279669	-	0.000981871	0.9990181
ENST00000454289	ENST00000338356	TSFM	chr12	58186856	+	CPM	chr12	69279669	-	0.000987696	0.99901223
ENST00000323833	ENST00000546373	TSFM	chr12	58186856	+	CPM	chr12	69279669	-	0.000688074	0.9993119
ENST00000323833	ENST00000551568	TSFM	chr12	58186856	+	CPM	chr12	69279669	-	0.000413251	0.99958676
ENST00000323833	ENST00000338356	TSFM	chr12	58186856	+	CPM	chr12	69279669	-	0.000416578	0.9995834
ENST00000350762	ENST00000546373	TSFM	chr12	58186856	+	CPM	chr12	69279669	-	0.00075886	0.9992411
ENST00000350762	ENST00000551568	TSFM	chr12	58186856	+	CPM	chr12	69279669	-	0.000483524	0.9995165
ENST00000350762	ENST00000338356	TSFM	chr12	58186856	+	CPM	chr12	69279669	-	0.000488087	0.99951196

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for TSFM-CPM

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
TSFM	chr12	58186856	CPM	chr12	69279669	586	190	REGSLKDQLALAIGRNLWVLVVGRFP
TSFM	chr12	58186856	CPM	chr12	69279669	628	207	REGSLKDQLALAIGRNLWVLVVGRFP
TSFM	chr12	58186856	CPM	chr12	69279669	660	161	CQTLKDQPSAYSKVQWLTPVNLALWE
TSFM	chr12	58186856	CPM	chr12	69279669	784	247	REGSLKDQLALAIGRNLWVLVVGRFP
TSFM	chr12	58186856	CPM	chr12	69279669	860	150	REGSLKDQLALAIGRNLWVLVVGRFP

Top

Potential FusionNeoAntigen Information of TSFM-CPM in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

TSFM-CPM_58186856_69279669.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-B57:01	SAYSKVQW	0.9998	0.9718	8	16
TSFM-CPM	chr12	58186856	chr12	69279669	860	HLA-B58:02	LAIGRNLW	0.9996	0.9669	10	18
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-B58:02	SAYSKVQW	0.9994	0.9448	8	16
TSFM-CPM	chr12	58186856	chr12	69279669	860	HLA-B58:01	LAIGRNLW	0.9993	0.9714	10	18
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-B15:17	SAYSKVQW	0.999	0.9039	8	16
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-B58:01	SAYSKVQW	0.9988	0.9588	8	16
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-B57:03	SAYSKVQW	0.9984	0.9815	8	16
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-B57:01	PSAYSKVQW	0.9955	0.9476	7	16
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-B14:02	SAYSKVQWL	0.9887	0.5908	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-B14:01	SAYSKVQWL	0.9887	0.5908	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-B58:02	PSAYSKVQW	0.9873	0.8605	7	16
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-B58:01	PSAYSKVQW	0.9831	0.9224	7	16
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-B52:01	SAYSKVQWL	0.9713	0.9039	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	860	HLA-A32:13	ALAIGRNLW	0.9663	0.9323	9	18
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-B57:03	PSAYSKVQW	0.914	0.9594	7	16
TSFM-CPM	chr12	58186856	chr12	69279669	860	HLA-B57:01	LALAIGRNLW	0.9999	0.9914	8	18
TSFM-CPM	chr12	58186856	chr12	69279669	860	HLA-B58:01	LALAIGRNLW	0.9992	0.9854	8	18
TSFM-CPM	chr12	58186856	chr12	69279669	860	HLA-B58:02	LALAIGRNLW	0.9992	0.9742	8	18
TSFM-CPM	chr12	58186856	chr12	69279669	860	HLA-B57:03	LALAIGRNLW	0.9967	0.9941	8	18
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-B57:01	QPSAYSKVQW	0.9956	0.9595	6	16
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-B58:02	QPSAYSKVQW	0.9737	0.914	6	16
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-B58:01	QPSAYSKVQW	0.9052	0.926	6	16
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-B57:03	QPSAYSKVQW	0.8578	0.974	6	16
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-B53:01	QPSAYSKVQW	0.8333	0.506	6	16
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-B48:01	KVQWLTPVNL	0.6606	0.5585	12	22
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-B13:02	KVQWLTPVNL	0.3761	0.7166	12	22
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-C15:04	SAYSKVQWL	0.9996	0.6987	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-C03:07	SAYSKVQWL	0.9995	0.9285	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-C15:06	SAYSKVQWL	0.9995	0.7938	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-C03:19	SAYSKVQWL	0.9995	0.9597	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-C03:08	SAYSKVQWL	0.9994	0.8547	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	860	HLA-C03:19	LALAIGRNL	0.9992	0.9884	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	860	HLA-C03:07	LALAIGRNL	0.9992	0.9892	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	860	HLA-C03:08	LALAIGRNL	0.9991	0.9203	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	860	HLA-C15:06	LAIGRNLWV	0.9988	0.9314	10	19
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-C04:06	SAYSKVQWL	0.9974	0.7922	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	860	HLA-C15:06	LALAIGRNL	0.9969	0.9472	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-C06:03	SAYSKVQWL	0.9944	0.9573	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-C12:04	SAYSKVQWL	0.9938	0.9597	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-C12:12	SAYSKVQWL	0.9937	0.8106	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-C04:14	SAYSKVQWL	0.9935	0.8221	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-C08:04	SAYSKVQWL	0.9916	0.8036	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-C08:13	SAYSKVQWL	0.9916	0.8036	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	860	HLA-C12:04	LAIGRNLWV	0.9908	0.9929	10	19
TSFM-CPM	chr12	58186856	chr12	69279669	860	HLA-C06:03	LAIGRNLWV	0.9905	0.9914	10	19
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-C07:05	SAYSKVQWL	0.9861	0.9111	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-C12:16	SAYSKVQWL	0.9798	0.8662	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-C07:10	SAYSKVQWL	0.9781	0.8919	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-C07:67	SAYSKVQWL	0.9741	0.8354	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-C07:80	SAYSKVQWL	0.9741	0.8354	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-B51:07	SAYSKVQWL	0.9678	0.8502	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	860	HLA-C06:03	LALAIGRNL	0.9641	0.9947	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-C07:29	SAYSKVQWL	0.9618	0.8664	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-C07:19	SAYSKVQWL	0.9617	0.6427	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	860	HLA-C12:04	LALAIGRNL	0.9617	0.9953	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	860	HLA-C12:12	LALAIGRNL	0.9596	0.9201	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-C07:46	SAYSKVQWL	0.9487	0.7467	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-C07:95	SAYSKVQWL	0.9461	0.5831	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-C07:27	SAYSKVQWL	0.9451	0.875	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-C03:14	SAYSKVQWL	0.9449	0.9187	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-C07:13	SAYSKVQWL	0.944	0.8361	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-B51:07	DQPSAYSKV	0.9221	0.8958	5	14
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-C02:06	SAYSKVQWL	0.9144	0.9027	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-C08:03	SAYSKVQWL	0.902	0.9077	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	860	HLA-C02:06	LAIGRNLWV	0.8236	0.9819	10	19
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-B14:03	SAYSKVQWL	0.7845	0.6744	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-C01:30	SAYSKVQWL	0.7614	0.9277	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-C01:17	SAYSKVQWL	0.7124	0.9052	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	860	HLA-B44:08	ALAIGRNLW	0.1884	0.6194	9	18
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-B57:10	SAYSKVQW	0.9998	0.9718	8	16
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-B58:06	SAYSKVQW	0.9994	0.9407	8	16
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-B57:04	SAYSKVQW	0.9994	0.7694	8	16
TSFM-CPM	chr12	58186856	chr12	69279669	860	HLA-B58:06	LAIGRNLW	0.9993	0.9076	10	18
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-B15:13	SAYSKVQW	0.9966	0.8098	8	16
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-C15:09	SAYSKVQWL	0.9996	0.6987	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-C15:05	SAYSKVQWL	0.9994	0.7521	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	860	HLA-C03:04	LALAIGRNL	0.9993	0.9893	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-C03:04	SAYSKVQWL	0.9993	0.9803	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-C03:03	SAYSKVQWL	0.9993	0.9803	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	860	HLA-C15:02	LAIGRNLWV	0.9993	0.8994	10	19
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-C03:05	SAYSKVQWL	0.9993	0.8964	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-C03:17	SAYSKVQWL	0.9993	0.925	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	860	HLA-C03:03	LALAIGRNL	0.9993	0.9893	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	860	HLA-C15:05	LAIGRNLWV	0.9992	0.9398	10	19
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-C03:67	SAYSKVQWL	0.9992	0.9677	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-C15:02	SAYSKVQWL	0.9992	0.6907	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	860	HLA-C03:17	LALAIGRNL	0.9987	0.9682	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	860	HLA-C03:05	LALAIGRNL	0.9986	0.9174	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-C16:04	SAYSKVQWL	0.9978	0.9038	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-C03:02	SAYSKVQWL	0.9964	0.9137	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-B57:10	PSAYSKVQW	0.9955	0.9476	7	16
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-C04:04	SAYSKVQWL	0.9954	0.748	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-C12:03	SAYSKVQWL	0.9938	0.8922	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-C06:02	SAYSKVQWL	0.9937	0.9593	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-C06:17	SAYSKVQWL	0.9937	0.9593	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-C03:06	SAYSKVQWL	0.9936	0.9777	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-C07:04	SAYSKVQWL	0.9935	0.9367	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-C16:02	SAYSKVQWL	0.992	0.9762	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	860	HLA-C03:02	LALAIGRNL	0.9915	0.978	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	860	HLA-B57:04	ALAIGRNLW	0.9911	0.9063	9	18
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-C16:01	SAYSKVQWL	0.9893	0.9448	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	860	HLA-A32:01	ALAIGRNLW	0.9843	0.9702	9	18
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-C06:06	SAYSKVQWL	0.9836	0.9701	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-B58:06	PSAYSKVQW	0.9821	0.8837	7	16
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-B57:04	PSAYSKVQW	0.9771	0.7067	7	16
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-C07:17	SAYSKVQWL	0.9761	0.8731	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	860	HLA-C16:04	LALAIGRNL	0.9757	0.988	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-C07:02	SAYSKVQWL	0.9741	0.8354	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-B35:13	SAYSKVQWL	0.9684	0.7703	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	860	HLA-C12:03	LALAIGRNL	0.9674	0.9821	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	860	HLA-C12:03	LAIGRNLWV	0.9671	0.9752	10	19
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-C12:02	SAYSKVQWL	0.9652	0.8628	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	860	HLA-C03:06	LALAIGRNL	0.9638	0.9913	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-C07:22	SAYSKVQWL	0.9564	0.605	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-C02:02	SAYSKVQWL	0.9457	0.927	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-C02:10	SAYSKVQWL	0.9457	0.927	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-C06:08	SAYSKVQWL	0.9416	0.9606	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-C07:01	SAYSKVQWL	0.9407	0.5841	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	860	HLA-C16:02	LALAIGRNL	0.9134	0.9941	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-C08:01	SAYSKVQWL	0.902	0.9077	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	860	HLA-C16:01	LALAIGRNL	0.843	0.9812	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	860	HLA-B15:13	ALAIGRNLW	0.8158	0.7866	9	18
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-C18:01	SAYSKVQWL	0.7829	0.7931	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	860	HLA-B15:24	ALAIGRNLW	0.7728	0.9524	9	18
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-C01:02	SAYSKVQWL	0.7304	0.9036	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-B57:02	PSAYSKVQW	0.7266	0.9102	7	16
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-C17:01	SAYSKVQWL	0.633	0.8698	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-C01:03	SAYSKVQWL	0.6325	0.8451	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-B07:13	SAYSKVQWL	0.5506	0.764	8	17
TSFM-CPM	chr12	58186856	chr12	69279669	860	HLA-B57:10	LALAIGRNLW	0.9999	0.9914	8	18
TSFM-CPM	chr12	58186856	chr12	69279669	860	HLA-B57:04	LALAIGRNLW	0.9997	0.8789	8	18
TSFM-CPM	chr12	58186856	chr12	69279669	860	HLA-B58:06	LALAIGRNLW	0.9983	0.9305	8	18
TSFM-CPM	chr12	58186856	chr12	69279669	860	HLA-B57:02	LALAIGRNLW	0.9957	0.9732	8	18
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-B57:10	QPSAYSKVQW	0.9956	0.9595	6	16
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-B57:04	QPSAYSKVQW	0.9831	0.7789	6	16
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-B58:06	QPSAYSKVQW	0.9582	0.9244	6	16
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-B57:02	QPSAYSKVQW	0.8633	0.9618	6	16
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-B53:02	QPSAYSKVQW	0.6973	0.5047	6	16
TSFM-CPM	chr12	58186856	chr12	69279669	660	HLA-B15:13	DQPSAYSKVQW	0.9873	0.8771	5	16

Top

Potential FusionNeoAntigen Information of TSFM-CPM in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of TSFM-CPM

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
1351	DQLALAIGRNLWVL	TSFM	CPM	chr12	58186856	chr12	69279669	860

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
7480	QPSAYSKVQWLTPV	TSFM	CPM	chr12	58186856	chr12	69279669	660

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of TSFM-CPM

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	1351	DQLALAIGRNLWVL	-7.9962	-8.1096
HLA-B14:02	3BVN	1351	DQLALAIGRNLWVL	-5.70842	-6.74372
HLA-B52:01	3W39	1351	DQLALAIGRNLWVL	-6.83737	-6.95077
HLA-B52:01	3W39	1351	DQLALAIGRNLWVL	-4.4836	-5.5189
HLA-A11:01	4UQ2	1351	DQLALAIGRNLWVL	-10.0067	-10.1201
HLA-A11:01	4UQ2	1351	DQLALAIGRNLWVL	-9.03915	-10.0745
HLA-A24:02	5HGA	1351	DQLALAIGRNLWVL	-6.56204	-6.67544
HLA-A24:02	5HGA	1351	DQLALAIGRNLWVL	-5.42271	-6.45801
HLA-B44:05	3DX8	1351	DQLALAIGRNLWVL	-7.85648	-8.89178
HLA-B44:05	3DX8	1351	DQLALAIGRNLWVL	-5.3978	-5.5112
HLA-A02:01	6TDR	1351	DQLALAIGRNLWVL	-3.37154	-4.40684
HLA-B14:02	3BVN	7480	QPSAYSKVQWLTPV	-5.49577	-5.60917
HLA-B14:02	3BVN	7480	QPSAYSKVQWLTPV	-4.37152	-5.40682
HLA-B52:01	3W39	7480	QPSAYSKVQWLTPV	-6.90336	-7.01676
HLA-B52:01	3W39	7480	QPSAYSKVQWLTPV	-4.80833	-5.84363
HLA-A11:01	4UQ2	7480	QPSAYSKVQWLTPV	-9.82261	-9.93601
HLA-A24:02	5HGA	7480	QPSAYSKVQWLTPV	-9.78612	-9.89952
HLA-A24:02	5HGA	7480	QPSAYSKVQWLTPV	-4.98992	-6.02522
HLA-B27:05	6PYJ	7480	QPSAYSKVQWLTPV	-5.31553	-6.35083
HLA-B44:05	3DX8	7480	QPSAYSKVQWLTPV	-5.70582	-5.81922
HLA-B44:05	3DX8	7480	QPSAYSKVQWLTPV	-4.32241	-5.35771

Top

Vaccine Design for the FusionNeoAntigens of TSFM-CPM

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
TSFM-CPM	chr12	58186856	chr12	69279669	10	18	LAIGRNLW	TAGCAATTGGTAGAAACCTGTGGG
TSFM-CPM	chr12	58186856	chr12	69279669	10	19	LAIGRNLWV	TAGCAATTGGTAGAAACCTGTGGGTTC
TSFM-CPM	chr12	58186856	chr12	69279669	12	22	KVQWLTPVNL	TTGGTAGAAACCTGTGGGTTCTTGTTGTGG
TSFM-CPM	chr12	58186856	chr12	69279669	5	14	DQPSAYSKV	AGGATCAGTTGGCTTTAGCAATTGGTA
TSFM-CPM	chr12	58186856	chr12	69279669	5	16	DQPSAYSKVQW	AGGATCAGTTGGCTTTAGCAATTGGTAGAAACC
TSFM-CPM	chr12	58186856	chr12	69279669	6	16	QPSAYSKVQW	ATCAGTTGGCTTTAGCAATTGGTAGAAACC
TSFM-CPM	chr12	58186856	chr12	69279669	7	16	PSAYSKVQW	AGTTGGCTTTAGCAATTGGTAGAAACC
TSFM-CPM	chr12	58186856	chr12	69279669	8	16	SAYSKVQW	TGGCTTTAGCAATTGGTAGAAACC
TSFM-CPM	chr12	58186856	chr12	69279669	8	17	LALAIGRNL	TGGCTTTAGCAATTGGTAGAAACCTGT
TSFM-CPM	chr12	58186856	chr12	69279669	8	17	SAYSKVQWL	TGGCTTTAGCAATTGGTAGAAACCTGT
TSFM-CPM	chr12	58186856	chr12	69279669	8	18	LALAIGRNLW	TGGCTTTAGCAATTGGTAGAAACCTGTGGG
TSFM-CPM	chr12	58186856	chr12	69279669	9	18	ALAIGRNLW	CTTTAGCAATTGGTAGAAACCTGTGGG

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of TSFM-CPM

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
SARC	TSFM-CPM	chr12	58186856	ENST00000323833	chr12	69279669	ENST00000338356	TCGA-DX-A3LS-01A
SARC	TSFM-CPM	chr12	58186856	ENST00000350762	chr12	69279669	ENST00000338356	TCGA-DX-A3LS-01A

Top

Potential target of CAR-T therapy development for TSFM-CPM

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to TSFM-CPM

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to TSFM-CPM

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)